Starting /dee2/code/volunteer_pipeline.sh SRR4237575 current disk space = 3050557915136 free memory = 1582563520 SRR4237575 SRAfilesize 4a157f252943149d10edaeacf57af0b1 SRR4237575.sra SRR4237575.sra file validated SRR4237575 is paired end SRR4237575 is conventional basespace SRR4237575 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237575_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.1785 33.0 32.0 34.0 2.0 34.0 2 32.1615 33.0 32.0 34.0 27.0 34.0 3 32.259 33.0 32.0 34.0 27.0 34.0 4 32.6115 34.0 33.0 34.0 32.0 34.0 5 32.74775 34.0 33.0 34.0 32.0 34.0 6 36.5365 38.0 37.0 38.0 34.0 38.0 7 36.931 38.0 38.0 38.0 35.0 38.0 8 37.04875 38.0 38.0 38.0 36.0 38.0 9 37.0105 38.0 38.0 38.0 36.0 38.0 10-14 36.806 38.0 38.0 38.0 34.8 38.0 15-19 36.966449999999995 38.0 38.0 38.0 35.6 38.0 20-24 36.9481 38.0 38.0 38.0 35.6 38.0 25-29 36.9774 38.0 38.0 38.0 35.6 38.0 30-34 36.954 38.0 38.0 38.0 35.8 38.0 35-39 36.897 38.0 38.0 38.0 35.6 38.0 40-44 36.834500000000006 38.0 38.0 38.0 35.0 38.0 45-49 36.455799999999996 38.0 37.8 38.0 33.0 38.0 50-54 36.6022 38.0 38.0 38.0 34.0 38.0 55-59 36.71445 38.0 38.0 38.0 34.6 38.0 60-64 36.5975 38.0 38.0 38.0 34.0 38.0 65-69 36.53285 38.0 38.0 38.0 34.2 38.0 70-74 36.03895000000001 38.0 37.2 38.0 31.6 38.0 75-79 36.325149999999994 38.0 37.6 38.0 33.6 38.0 80-84 36.4107 38.0 38.0 38.0 34.0 38.0 85-89 36.4391 38.0 37.8 38.0 33.8 38.0 90-94 36.34595 38.0 38.0 38.0 33.6 38.0 95-99 36.209450000000004 38.0 37.8 38.0 33.4 38.0 100-104 36.083299999999994 38.0 37.0 38.0 33.0 38.0 105-109 36.00945 38.0 37.0 38.0 32.6 38.0 110-114 35.9213 38.0 37.0 38.0 32.4 38.0 115-119 35.637 38.0 37.0 38.0 31.0 38.0 120-124 35.6436 38.0 36.8 38.0 31.2 38.0 125-129 35.5022 38.0 36.6 38.0 30.4 38.0 130-134 34.6417 38.0 35.2 38.0 24.8 38.0 135-139 34.5419 38.0 34.8 38.0 25.6 38.0 140-144 34.6879 38.0 35.2 38.0 27.2 38.0 145-149 33.83175 38.0 35.0 38.0 22.6 38.0 150 26.987 34.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 7.0 19 4.0 20 6.0 21 4.0 22 6.0 23 7.0 24 19.0 25 9.0 26 31.0 27 34.0 28 30.0 29 52.0 30 78.0 31 75.0 32 108.0 33 155.0 34 219.0 35 278.0 36 579.0 37 2290.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.21826406559231 12.185467910658751 8.9058524173028 34.69041560644614 2 21.3 17.549999999999997 33.900000000000006 27.250000000000004 3 21.15 20.825 26.150000000000002 31.874999999999996 4 23.125 30.049999999999997 22.775000000000002 24.05 5 21.425 34.425 24.4 19.75 6 18.325 36.15 24.349999999999998 21.175 7 14.75 24.725 42.9 17.625 8 16.900000000000002 24.875 32.550000000000004 25.674999999999997 9 16.75 25.3 33.85 24.099999999999998 10-14 19.470000000000002 30.485 26.295 23.75 15-19 19.375 29.794999999999998 27.474999999999998 23.355 20-24 19.605 29.15 27.544999999999998 23.7 25-29 19.28 29.56 27.224999999999998 23.935000000000002 30-34 19.765 29.175 27.894999999999996 23.165 35-39 19.38 28.845 27.625 24.15 40-44 19.93 28.910000000000004 27.284999999999997 23.875 45-49 19.88 29.270000000000003 27.139999999999997 23.71 50-54 19.38 29.345 27.42 23.855 55-59 19.585 29.709999999999997 26.740000000000002 23.965 60-64 20.115 29.175 26.979999999999997 23.73 65-69 20.119999999999997 29.15 26.735 23.995 70-74 20.04 28.794999999999998 27.43 23.735 75-79 19.900000000000002 29.270000000000003 27.105 23.724999999999998 80-84 19.495 29.015 27.36 24.13 85-89 19.955000000000002 28.744999999999997 27.805000000000003 23.494999999999997 90-94 19.875 28.794999999999998 26.895000000000003 24.435000000000002 95-99 19.535 28.88 27.98 23.605 100-104 19.985 29.04 27.639999999999997 23.335 105-109 20.39 28.27 27.805000000000003 23.535 110-114 20.69 28.494999999999997 27.525 23.29 115-119 20.265 28.935 27.339999999999996 23.46 120-124 20.03 28.325 27.439999999999998 24.205 125-129 19.919999999999998 28.689999999999998 27.400000000000002 23.990000000000002 130-134 20.349999999999998 27.97 27.384999999999998 24.295 135-139 20.685000000000002 28.749999999999996 27.22 23.345 140-144 20.535 28.895 26.375 24.195 145-149 20.05 28.199999999999996 27.395000000000003 24.355 150 18.975 28.675 27.35 25.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 2.5 26 5.0 27 10.0 28 14.0 29 16.0 30 17.0 31 29.0 32 51.0 33 54.5 34 64.0 35 87.5 36 94.5 37 106.5 38 127.5 39 155.5 40 187.5 41 223.0 42 255.5 43 268.0 44 272.0 45 270.0 46 253.0 47 245.0 48 234.0 49 201.0 50 158.0 51 128.0 52 123.5 53 97.5 54 63.5 55 41.0 56 28.0 57 23.0 58 18.5 59 18.0 60 13.0 61 11.0 62 10.0 63 5.0 64 2.0 65 2.0 66 3.0 67 1.5 68 1.0 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.575000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9750000000000001 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.9 0.0 0.0 0.0 0.0 128-129 4.3 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138 6.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237575 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237575_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09125 33.0 33.0 34.0 30.0 34.0 2 32.265 33.0 33.0 34.0 31.0 34.0 3 32.3105 33.0 33.0 34.0 31.0 34.0 4 32.125 33.0 33.0 34.0 31.0 34.0 5 32.194 33.0 33.0 34.0 31.0 34.0 6 36.18625 38.0 38.0 38.0 33.0 38.0 7 36.151 38.0 38.0 38.0 33.0 38.0 8 36.15675 38.0 38.0 38.0 33.0 38.0 9 36.1115 38.0 38.0 38.0 33.0 38.0 10-14 36.123450000000005 38.0 38.0 38.0 33.0 38.0 15-19 35.7415 38.0 37.4 38.0 30.6 38.0 20-24 35.721000000000004 38.0 37.4 38.0 30.6 38.0 25-29 36.049850000000006 38.0 38.0 38.0 33.0 38.0 30-34 36.032 38.0 38.0 38.0 32.8 38.0 35-39 35.997550000000004 38.0 38.0 38.0 32.6 38.0 40-44 36.1271 38.0 38.0 38.0 33.4 38.0 45-49 35.90205 38.0 38.0 38.0 31.8 38.0 50-54 35.94425 38.0 38.0 38.0 32.6 38.0 55-59 35.8929 38.0 37.8 38.0 32.2 38.0 60-64 35.732600000000005 38.0 37.0 38.0 31.0 38.0 65-69 35.8226 38.0 37.8 38.0 31.8 38.0 70-74 35.40845 38.0 36.8 38.0 29.2 38.0 75-79 35.28095 38.0 36.8 38.0 28.8 38.0 80-84 35.47520000000001 38.0 37.0 38.0 29.0 38.0 85-89 35.41605 38.0 37.0 38.0 29.0 38.0 90-94 35.35315000000001 38.0 37.0 38.0 29.4 38.0 95-99 35.3056 38.0 37.0 38.0 29.0 38.0 100-104 34.97015 38.0 36.2 38.0 27.0 38.0 105-109 34.18125 38.0 34.4 38.0 23.8 38.0 110-114 34.8182 38.0 36.0 38.0 26.4 38.0 115-119 34.529700000000005 38.0 35.6 38.0 25.2 38.0 120-124 34.35165000000001 38.0 35.4 38.0 23.4 38.0 125-129 33.931799999999996 38.0 34.8 38.0 21.0 38.0 130-134 33.35979999999999 38.0 34.0 38.0 16.2 38.0 135-139 33.09105 38.0 33.2 38.0 16.2 38.0 140-144 32.519400000000005 38.0 33.0 38.0 13.0 38.0 145-149 31.124149999999997 38.0 32.2 38.0 3.8 38.0 150 23.35475 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 13.0 4 2.0 5 3.0 6 2.0 7 3.0 8 3.0 9 1.0 10 2.0 11 5.0 12 4.0 13 2.0 14 3.0 15 2.0 16 6.0 17 8.0 18 12.0 19 9.0 20 10.0 21 15.0 22 9.0 23 33.0 24 34.0 25 36.0 26 35.0 27 63.0 28 60.0 29 70.0 30 89.0 31 95.0 32 125.0 33 139.0 34 207.0 35 299.0 36 516.0 37 2067.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.75 21.15 11.35 23.75 2 26.525 27.800000000000004 30.95 14.725 3 21.9 28.799999999999997 30.875000000000004 18.425 4 24.75 34.0 23.925 17.325 5 25.900000000000002 37.824999999999996 21.3 14.975 6 19.400000000000002 38.925 24.85 16.825000000000003 7 20.275000000000002 20.525 40.400000000000006 18.8 8 21.825 24.099999999999998 30.825000000000003 23.25 9 21.099999999999998 25.525 30.775000000000002 22.6 10-14 23.835 28.84 26.575 20.75 15-19 23.66 27.810000000000002 28.52 20.01 20-24 23.455000000000002 28.050000000000004 28.305000000000003 20.19 25-29 23.119999999999997 28.134999999999998 28.18 20.565 30-34 23.244999999999997 27.665 28.845 20.244999999999997 35-39 23.095 28.050000000000004 28.215 20.64 40-44 23.375 28.17 28.155 20.3 45-49 23.435 27.625 28.689999999999998 20.25 50-54 23.59 27.74 28.610000000000003 20.06 55-59 23.125 28.185 28.465 20.225 60-64 23.71 28.22 28.205000000000002 19.865 65-69 23.51 28.255000000000003 28.07 20.165 70-74 23.294999999999998 27.73 28.904999999999998 20.07 75-79 23.385 27.315 29.025000000000002 20.275000000000002 80-84 23.669999999999998 27.145000000000003 28.95 20.235 85-89 23.630000000000003 28.065 28.52 19.785 90-94 24.115000000000002 27.08 28.625 20.18 95-99 24.02 27.595 28.52 19.865 100-104 24.03 27.905 28.139999999999997 19.925 105-109 24.060000000000002 27.51 28.305000000000003 20.125 110-114 24.07 28.15 28.17 19.61 115-119 23.89 27.435 28.794999999999998 19.88 120-124 24.485 27.944999999999997 27.74 19.830000000000002 125-129 24.26 28.439999999999998 27.905 19.395 130-134 25.165 27.43 28.32 19.085 135-139 24.474999999999998 27.395000000000003 27.76 20.369999999999997 140-144 24.77 28.15 27.71 19.37 145-149 25.665 27.67 27.084999999999997 19.580000000000002 150 25.424999999999997 26.6 28.65 19.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.5 22 1.5 23 1.5 24 1.0 25 4.0 26 8.0 27 10.5 28 11.0 29 12.0 30 15.5 31 23.0 32 30.5 33 34.0 34 48.5 35 69.5 36 99.5 37 122.5 38 135.5 39 176.5 40 212.5 41 227.0 42 242.0 43 267.5 44 288.5 45 282.0 46 262.5 47 241.5 48 222.5 49 206.0 50 170.0 51 136.0 52 109.5 53 82.0 54 58.5 55 46.5 56 38.0 57 26.5 58 21.0 59 13.5 60 9.5 61 4.5 62 3.5 63 4.5 64 3.5 65 2.0 66 2.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.35 0.0 0.0 0.0 0.0 126-127 3.6625 0.0 0.0 0.0 0.0 128-129 4.05 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.55 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138 6.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAAGA 15 1.1730364E-4 144.0 5 GAGGGAA 10 0.006973645 144.0 8 >>END_MODULE Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247287 spots for SRR4237575.sra Written 3247287 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra Read 3247280 spots for SRR4237575.sra Written 3247280 spots for SRR4237575.sra SRR ids: ['SRR4237575.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8wjsk229 SRR4237575.sra spots: 64945607 blocks: [[1, 3247280], [3247281, 6494560], [6494561, 9741840], [9741841, 12989120], [12989121, 16236400], [16236401, 19483680], [19483681, 22730960], [22730961, 25978240], [25978241, 29225520], [29225521, 32472800], [32472801, 35720080], [35720081, 38967360], [38967361, 42214640], [42214641, 45461920], [45461921, 48709200], [48709201, 51956480], [51956481, 55203760], [55203761, 58451040], [58451041, 61698320], [61698321, 64945607]] SRR4237575 file size 21859387 SRR4237575 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237575 SRR4237575_1.fastq SRR4237575_2.fastq Input file: SRR4237575_1.fastq Paired file: SRR4237575_2.fastq trimmed: SRR4237575-trimmed-pair1.fastq, SRR4237575-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:49:22 2025 >> started Wed Feb 12 10:50:29 2025 >> done (66.814s) 64945607 read pairs processed; of these: 139336 ( 0.21%) short read pairs filtered out after trimming by size control 101342 ( 0.16%) empty read pairs filtered out after trimming by size control 64704929 (99.63%) read pairs available; of these: 25485888 (39.39%) trimmed read pairs available after processing 39219041 (60.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 12 0.00% 21 14 0.00% 22 13 0.00% 23 14 0.00% 24 17 0.00% 25 14 0.00% 26 17 0.00% 27 15 0.00% 28 24 0.00% 29 16 0.00% 30 40 0.00% 31 34 0.00% 32 38 0.00% 33 26 0.00% 34 46 0.00% 35 40 0.00% 36 42 0.00% 37 61 0.00% 38 54 0.00% 39 60 0.00% 40 69 0.00% 41 70 0.00% 42 97 0.00% 43 104 0.00% 44 110 0.00% 45 117 0.00% 46 134 0.00% 47 143 0.00% 48 177 0.00% 49 175 0.00% 50 212 0.00% 51 262 0.00% 52 264 0.00% 53 310 0.00% 54 334 0.00% 55 381 0.00% 56 410 0.00% 57 473 0.00% 58 548 0.00% 59 602 0.00% 60 736 0.00% 61 840 0.00% 62 940 0.00% 63 1007 0.00% 64 1084 0.00% 65 1304 0.00% 66 1506 0.00% 67 1765 0.00% 68 2192 0.00% 69 3580 0.01% 70 3263 0.01% 71 2969 0.00% 72 3352 0.01% 73 3775 0.01% 74 4069 0.01% 75 4502 0.01% 76 5261 0.01% 77 5689 0.01% 78 6496 0.01% 79 7401 0.01% 80 8168 0.01% 81 9643 0.01% 82 11101 0.02% 83 13269 0.02% 84 24013 0.04% 85 24800 0.04% 86 25621 0.04% 87 26853 0.04% 88 28390 0.04% 89 29740 0.05% 90 31701 0.05% 91 33727 0.05% 92 36372 0.06% 93 38421 0.06% 94 41306 0.06% 95 43768 0.07% 96 46557 0.07% 97 49270 0.08% 98 51555 0.08% 99 54898 0.08% 100 57715 0.09% 101 60609 0.09% 102 65241 0.10% 103 69021 0.11% 104 73190 0.11% 105 76659 0.12% 106 80879 0.12% 107 84363 0.13% 108 87746 0.14% 109 91505 0.14% 110 94857 0.15% 111 101059 0.16% 112 105527 0.16% 113 109930 0.17% 114 115472 0.18% 115 120108 0.19% 116 125230 0.19% 117 129486 0.20% 118 134129 0.21% 119 137026 0.21% 120 143682 0.22% 121 148604 0.23% 122 154021 0.24% 123 161524 0.25% 124 168954 0.26% 125 174655 0.27% 126 181189 0.28% 127 187445 0.29% 128 194335 0.30% 129 202845 0.31% 130 210214 0.32% 131 219127 0.34% 132 227967 0.35% 133 239996 0.37% 134 250586 0.39% 135 263955 0.41% 136 277505 0.43% 137 292269 0.45% 138 310580 0.48% 139 328259 0.51% 140 351672 0.54% 141 381036 0.59% 142 418616 0.65% 143 471001 0.73% 144 548347 0.85% 145 665055 1.03% 146 848221 1.31% 147 1193574 1.84% 148 2151358 3.32% 149 11503031 17.78% 150 39219041 60.61% 64704929 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=307.57 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=30.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=31 prefix-density=0.21 prefix-fanout=2.9 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=432.46 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=20.7 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCTGGCAAGTGCAAGCTTCCTCACCCTGCTAATTGCTAGACTACCGATCGTAATCGATCCAAGGGTTTTCCTCTACATATATGTATCATGTCATAAACGTC SRR4237575 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:51:12 Started mapping on | Feb 12 10:51:13 Finished on | Feb 12 10:56:48 Mapping speed, Million of reads per hour | 695.34 Number of input reads | 64704929 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 61923101 Uniquely mapped reads % | 95.70% Average mapped length | 291.84 Number of splices: Total | 55882231 Number of splices: Annotated (sjdb) | 54869741 Number of splices: GT/AG | 55023647 Number of splices: GC/AG | 672305 Number of splices: AT/AC | 50901 Number of splices: Non-canonical | 135378 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1161780 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 66976 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1764073 1764073 1764073 N_multimapping 1161780 1161780 1161780 N_noFeature 1918063 61145200 2335465 N_ambiguous 635097 4155 271410 UnstrandedReadsAssigned:59369941 PositiveStrandReadsAssigned:773746 NegativeStrandReadsAssigned:59316226 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237575 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237575-trimmed-pair1.fastq SRR4237575-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 64,704,929 reads, 58,975,798 reads pseudoaligned [quant] estimated average fragment length: 232.892 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR4237575.ke.tsv 34699 SRR4237575.se.tsv 87100 total ==> SRR4237575.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.11 1345 12.8852 Potri.005G024800.1.v4.1 1035 803.108 186 3.96291 Potri.004G059700.1.v4.1 961 729.128 45 1.05605 Potri.007G009000.2.v4.1 1416 1184.11 0 0 Potri.003G141000.2.v4.1 2943 2711.11 1013.47 6.39643 Potri.016G087400.1.v4.1 270 83.3671 6844.61 1404.85 Potri.015G069301.1.v4.1 564 336.029 0 0 Potri.010G195200.1.v4.1 1773 1541.11 122 1.35457 Potri.012G127500.1.v4.1 977 745.123 22584 518.618 ==> SRR4237575.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4996 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 891 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR4237575 completed mapping pipeline successfully