Starting /dee2/code/volunteer_pipeline.sh SRR4237576 current disk space = 3049584713728 free memory = 1433267796 SRR4237576 SRAfilesize d46aa5c86866948c1409da879bd554e1 SRR4237576.sra SRR4237576.sra file validated SRR4237576 is paired end SRR4237576 is conventional basespace SRR4237576 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237576_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.44625 33.0 32.0 34.0 2.0 34.0 2 32.19725 34.0 32.0 34.0 27.0 34.0 3 32.4315 34.0 32.0 34.0 28.0 34.0 4 32.789 34.0 33.0 34.0 32.0 34.0 5 32.55 34.0 33.0 34.0 32.0 34.0 6 36.53925 38.0 37.0 38.0 34.0 38.0 7 37.09575 38.0 38.0 38.0 36.0 38.0 8 37.07325 38.0 38.0 38.0 36.0 38.0 9 37.1735 38.0 38.0 38.0 36.0 38.0 10-14 37.21475 38.0 38.0 38.0 36.4 38.0 15-19 37.213150000000006 38.0 38.0 38.0 36.6 38.0 20-24 37.228300000000004 38.0 38.0 38.0 36.6 38.0 25-29 36.9413 38.0 38.0 38.0 35.8 38.0 30-34 37.15214999999999 38.0 38.0 38.0 36.6 38.0 35-39 36.4154 38.0 37.2 38.0 31.4 38.0 40-44 37.0694 38.0 38.0 38.0 36.0 38.0 45-49 36.70725 38.0 37.8 38.0 34.4 38.0 50-54 36.97835 38.0 38.0 38.0 35.8 38.0 55-59 36.03255 38.0 36.8 38.0 30.0 38.0 60-64 36.81225 38.0 38.0 38.0 35.0 38.0 65-69 36.8823 38.0 38.0 38.0 35.2 38.0 70-74 36.85965 38.0 38.0 38.0 35.4 38.0 75-79 36.7738 38.0 38.0 38.0 35.0 38.0 80-84 36.8304 38.0 38.0 38.0 35.0 38.0 85-89 36.66805 38.0 38.0 38.0 34.6 38.0 90-94 36.661350000000006 38.0 38.0 38.0 34.8 38.0 95-99 35.7987 38.0 36.8 38.0 29.6 38.0 100-104 35.4756 38.0 36.2 38.0 28.4 38.0 105-109 36.1685 38.0 37.4 38.0 33.2 38.0 110-114 36.157 38.0 37.4 38.0 33.4 38.0 115-119 36.1935 38.0 37.8 38.0 33.6 38.0 120-124 36.01369999999999 38.0 37.6 38.0 32.8 38.0 125-129 35.85395 38.0 36.8 38.0 32.2 38.0 130-134 35.752300000000005 38.0 36.6 38.0 31.8 38.0 135-139 35.439750000000004 38.0 36.0 38.0 31.0 38.0 140-144 35.071799999999996 38.0 36.0 38.0 29.2 38.0 145-149 34.37779999999999 38.0 35.4 38.0 28.0 38.0 150 28.65875 33.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 4.0 18 2.0 19 2.0 20 0.0 21 4.0 22 6.0 23 5.0 24 15.0 25 10.0 26 20.0 27 25.0 28 38.0 29 44.0 30 57.0 31 63.0 32 98.0 33 120.0 34 177.0 35 270.0 36 636.0 37 2401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.15851157339584 11.954292411368298 8.145326692059772 36.74186932317609 2 22.575 15.4 35.449999999999996 26.575 3 19.85 20.424999999999997 26.25 33.475 4 23.925 27.650000000000002 23.549999999999997 24.875 5 22.725 35.05 23.25 18.975 6 17.125 36.725 23.9 22.25 7 14.374999999999998 26.025 42.125 17.474999999999998 8 16.55 24.65 32.15 26.650000000000002 9 16.325 24.025 33.900000000000006 25.75 10-14 19.75 29.415000000000003 27.16 23.674999999999997 15-19 20.255000000000003 28.549999999999997 27.800000000000004 23.395 20-24 20.03 28.075 27.82 24.075 25-29 19.93 29.110000000000003 27.42 23.54 30-34 19.535 28.68 28.095 23.69 35-39 20.064999999999998 28.48 27.43 24.025 40-44 19.825 29.01 27.555000000000003 23.61 45-49 19.615 29.104999999999997 27.750000000000004 23.53 50-54 20.255000000000003 27.950000000000003 27.91 23.885 55-59 19.830000000000002 28.910000000000004 27.82 23.44 60-64 20.04 28.345 27.884999999999998 23.73 65-69 20.1 28.035 28.335 23.53 70-74 20.275000000000002 28.560000000000002 27.725 23.44 75-79 20.064999999999998 29.2 27.389999999999997 23.345 80-84 19.950000000000003 28.449999999999996 27.305 24.295 85-89 20.27 28.475 27.72 23.535 90-94 19.435 28.865000000000002 27.665 24.035 95-99 20.29 28.32 27.425 23.965 100-104 20.11 28.134999999999998 27.93 23.825 105-109 20.474999999999998 28.425 28.125 22.975 110-114 19.485 28.194999999999997 28.15 24.169999999999998 115-119 20.544999999999998 28.58 27.11 23.765 120-124 20.345 28.09 27.450000000000003 24.115000000000002 125-129 20.72 28.58 26.784999999999997 23.915 130-134 20.57 28.410000000000004 27.405 23.615 135-139 20.66 28.715000000000003 26.645000000000003 23.98 140-144 21.205 27.905 27.389999999999997 23.5 145-149 20.735 29.015 26.52 23.73 150 20.200000000000003 27.224999999999998 27.525 25.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 1.5 25 3.5 26 4.5 27 7.0 28 10.5 29 17.0 30 24.0 31 28.0 32 30.0 33 34.5 34 53.0 35 70.0 36 84.5 37 100.0 38 124.5 39 159.5 40 195.5 41 223.5 42 256.5 43 292.0 44 284.5 45 277.0 46 269.5 47 255.0 48 233.5 49 200.0 50 171.0 51 142.5 52 116.5 53 83.5 54 63.5 55 51.5 56 35.5 57 23.5 58 17.0 59 12.5 60 8.0 61 6.0 62 5.0 63 2.0 64 2.0 65 3.5 66 4.5 67 3.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.674999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.4500000000000002 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.4749999999999996 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.525 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.2125 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 90 2.1278298E-5 14.3862505 140-144 >>END_MODULE SRR4237576 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237576_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49875 33.0 33.0 34.0 31.0 34.0 2 32.61025 33.0 33.0 34.0 31.0 34.0 3 32.618 33.0 33.0 34.0 31.0 34.0 4 32.56375 33.0 33.0 34.0 32.0 34.0 5 32.55075 33.0 33.0 34.0 32.0 34.0 6 36.654 38.0 38.0 38.0 34.0 38.0 7 36.69475 38.0 38.0 38.0 35.0 38.0 8 36.5715 38.0 38.0 38.0 34.0 38.0 9 36.55375 38.0 38.0 38.0 34.0 38.0 10-14 36.61775 38.0 38.0 38.0 34.6 38.0 15-19 36.694 38.0 38.0 38.0 35.0 38.0 20-24 36.69095 38.0 38.0 38.0 35.2 38.0 25-29 36.5612 38.0 38.0 38.0 34.2 38.0 30-34 36.46939999999999 38.0 38.0 38.0 34.2 38.0 35-39 36.58434999999999 38.0 38.0 38.0 34.8 38.0 40-44 36.61125 38.0 38.0 38.0 34.8 38.0 45-49 36.1726 38.0 37.8 38.0 32.6 38.0 50-54 36.449299999999994 38.0 38.0 38.0 34.0 38.0 55-59 36.35815 38.0 38.0 38.0 33.8 38.0 60-64 36.05815 38.0 37.6 38.0 32.2 38.0 65-69 36.0434 38.0 37.8 38.0 32.4 38.0 70-74 35.7759 38.0 37.2 38.0 30.8 38.0 75-79 36.1109 38.0 37.8 38.0 33.4 38.0 80-84 35.87765 38.0 37.4 38.0 31.6 38.0 85-89 36.070100000000004 38.0 38.0 38.0 33.2 38.0 90-94 35.990300000000005 38.0 38.0 38.0 33.0 38.0 95-99 35.97775 38.0 38.0 38.0 33.0 38.0 100-104 35.80460000000001 38.0 37.0 38.0 31.8 38.0 105-109 35.62475 38.0 37.0 38.0 31.0 38.0 110-114 35.6529 38.0 37.0 38.0 31.0 38.0 115-119 35.4126 38.0 37.0 38.0 30.2 38.0 120-124 35.1661 38.0 36.2 38.0 28.8 38.0 125-129 34.74445 38.0 35.6 38.0 26.4 38.0 130-134 34.24715 38.0 34.8 38.0 23.4 38.0 135-139 34.038850000000004 38.0 34.4 38.0 23.4 38.0 140-144 33.4835 38.0 33.2 38.0 21.2 38.0 145-149 31.828649999999993 38.0 33.0 38.0 6.2 38.0 150 24.0565 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 4.0 5 1.0 6 3.0 7 1.0 8 2.0 9 3.0 10 2.0 11 1.0 12 1.0 13 4.0 14 3.0 15 1.0 16 5.0 17 5.0 18 8.0 19 4.0 20 7.0 21 14.0 22 20.0 23 27.0 24 18.0 25 25.0 26 34.0 27 38.0 28 40.0 29 46.0 30 62.0 31 67.0 32 91.0 33 160.0 34 201.0 35 253.0 36 557.0 37 2283.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.525 20.05 10.85 24.575 2 27.075 25.15 32.800000000000004 14.975 3 20.95 28.075 32.35 18.625 4 24.0 34.975 23.525 17.5 5 24.349999999999998 38.625 22.675 14.35 6 19.125 39.6 24.65 16.625 7 21.325 20.05 40.425 18.2 8 21.3 25.174999999999997 29.975 23.549999999999997 9 23.1 23.9 30.575000000000003 22.425 10-14 23.905 29.09 26.484999999999996 20.52 15-19 22.41 27.944999999999997 28.904999999999998 20.74 20-24 23.200000000000003 27.825 28.26 20.715 25-29 23.175 28.449999999999996 27.74 20.635 30-34 22.85 27.66 29.145 20.345 35-39 22.84 27.894999999999996 28.854999999999997 20.41 40-44 23.715 27.525 28.12 20.64 45-49 23.150000000000002 27.735 28.355000000000004 20.76 50-54 22.535 28.07 28.34 21.055 55-59 23.74 27.51 28.694999999999997 20.055 60-64 23.305 27.145000000000003 28.895 20.655 65-69 23.380000000000003 27.584999999999997 28.59 20.445 70-74 23.45 28.015 27.765 20.77 75-79 23.905 27.6 28.28 20.215 80-84 23.49 27.855 28.605000000000004 20.05 85-89 23.669999999999998 27.77 28.605000000000004 19.955000000000002 90-94 23.78 27.675 28.7 19.845 95-99 23.815 27.644999999999996 28.34 20.200000000000003 100-104 24.005000000000003 27.575 28.24 20.18 105-109 23.535 27.615000000000002 28.23 20.62 110-114 24.205 27.785 28.095 19.915 115-119 24.215 28.18 27.82 19.785 120-124 24.560000000000002 28.13 27.61 19.7 125-129 24.245 28.455000000000002 27.715 19.585 130-134 24.695 27.83 27.595 19.88 135-139 24.46 28.21 27.91 19.42 140-144 25.085 28.01 27.445000000000004 19.46 145-149 25.615 28.389999999999997 26.43 19.564999999999998 150 25.624999999999996 28.499999999999996 27.375 18.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 3.5 25 3.5 26 3.0 27 6.0 28 12.0 29 12.0 30 12.5 31 23.0 32 30.5 33 40.0 34 48.5 35 62.0 36 84.5 37 106.5 38 130.5 39 161.5 40 212.0 41 249.5 42 270.0 43 288.5 44 286.5 45 284.0 46 261.5 47 253.0 48 238.0 49 188.5 50 160.0 51 135.5 52 103.0 53 77.0 54 66.0 55 57.5 56 42.5 57 24.0 58 15.5 59 10.5 60 4.5 61 3.0 62 5.5 63 3.5 64 2.0 65 3.5 66 2.0 67 1.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.4749999999999996 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.3 0.0 0.0 0.0 0.0 130-131 4.675000000000001 0.0 0.0 0.0 0.0 132-133 5.2125 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.45 0.0 0.0 0.0 0.0 138 7.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAGC 10 0.006973645 144.0 1 CAAAGCA 10 0.006973645 144.0 2 AAAAAAA 55 0.0026350126 15.709091 135-139 >>END_MODULE Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617353 spots for SRR4237576.sra Written 2617353 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra Read 2617351 spots for SRR4237576.sra Written 2617351 spots for SRR4237576.sra SRR ids: ['SRR4237576.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fyan3_wc SRR4237576.sra spots: 52347022 blocks: [[1, 2617351], [2617352, 5234702], [5234703, 7852053], [7852054, 10469404], [10469405, 13086755], [13086756, 15704106], [15704107, 18321457], [18321458, 20938808], [20938809, 23556159], [23556160, 26173510], [26173511, 28790861], [28790862, 31408212], [31408213, 34025563], [34025564, 36642914], [36642915, 39260265], [39260266, 41877616], [41877617, 44494967], [44494968, 47112318], [47112319, 49729669], [49729670, 52347022]] SRR4237576 file size 17614747 SRR4237576 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237576 SRR4237576_1.fastq SRR4237576_2.fastq Input file: SRR4237576_1.fastq Paired file: SRR4237576_2.fastq trimmed: SRR4237576-trimmed-pair1.fastq, SRR4237576-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 09:52:59 2025 >> started Wed Feb 12 09:53:55 2025 >> done (55.319s) 52347022 read pairs processed; of these: 64183 ( 0.12%) short read pairs filtered out after trimming by size control 43849 ( 0.08%) empty read pairs filtered out after trimming by size control 52238990 (99.79%) read pairs available; of these: 19549970 (37.42%) trimmed read pairs available after processing 32689020 (62.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 12 0.00% 21 12 0.00% 22 13 0.00% 23 11 0.00% 24 7 0.00% 25 18 0.00% 26 6 0.00% 27 12 0.00% 28 14 0.00% 29 21 0.00% 30 21 0.00% 31 18 0.00% 32 25 0.00% 33 17 0.00% 34 26 0.00% 35 23 0.00% 36 27 0.00% 37 29 0.00% 38 30 0.00% 39 47 0.00% 40 43 0.00% 41 60 0.00% 42 74 0.00% 43 64 0.00% 44 74 0.00% 45 79 0.00% 46 105 0.00% 47 115 0.00% 48 122 0.00% 49 130 0.00% 50 145 0.00% 51 185 0.00% 52 175 0.00% 53 203 0.00% 54 217 0.00% 55 230 0.00% 56 261 0.00% 57 295 0.00% 58 341 0.00% 59 384 0.00% 60 395 0.00% 61 515 0.00% 62 554 0.00% 63 558 0.00% 64 706 0.00% 65 770 0.00% 66 870 0.00% 67 1001 0.00% 68 1294 0.00% 69 2112 0.00% 70 1914 0.00% 71 1693 0.00% 72 1771 0.00% 73 2097 0.00% 74 2362 0.00% 75 2690 0.01% 76 2952 0.01% 77 3223 0.01% 78 3619 0.01% 79 4237 0.01% 80 4651 0.01% 81 5492 0.01% 82 6131 0.01% 83 7361 0.01% 84 12594 0.02% 85 13348 0.03% 86 14212 0.03% 87 15084 0.03% 88 16112 0.03% 89 17115 0.03% 90 18336 0.04% 91 19457 0.04% 92 21476 0.04% 93 23126 0.04% 94 25348 0.05% 95 27079 0.05% 96 29282 0.06% 97 31214 0.06% 98 33066 0.06% 99 35191 0.07% 100 38158 0.07% 101 40626 0.08% 102 44159 0.08% 103 46795 0.09% 104 50054 0.10% 105 53951 0.10% 106 57346 0.11% 107 59785 0.11% 108 62638 0.12% 109 65987 0.13% 110 68961 0.13% 111 73757 0.14% 112 77625 0.15% 113 80983 0.16% 114 85571 0.16% 115 89839 0.17% 116 93778 0.18% 117 100105 0.19% 118 103186 0.20% 119 105622 0.20% 120 111015 0.21% 121 115399 0.22% 122 119882 0.23% 123 125241 0.24% 124 130058 0.25% 125 135345 0.26% 126 141415 0.27% 127 147179 0.28% 128 152563 0.29% 129 158155 0.30% 130 165152 0.32% 131 170150 0.33% 132 177978 0.34% 133 186132 0.36% 134 193811 0.37% 135 203641 0.39% 136 213629 0.41% 137 224541 0.43% 138 240096 0.46% 139 252988 0.48% 140 269072 0.52% 141 288780 0.55% 142 315851 0.60% 143 349326 0.67% 144 401933 0.77% 145 478140 0.92% 146 609510 1.17% 147 850047 1.63% 148 1539673 2.95% 149 9269630 17.74% 150 32689020 62.58% 52238990 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=13.05 fanout-score-rank=12 prefix-density=0.26 prefix-fanout=6.9 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=264.33 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=29.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=220.75 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=25.5 sequence=GAAGAAGAAGAAA SRR4237576 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 09:54:37 Started mapping on | Feb 12 09:54:38 Finished on | Feb 12 09:58:26 Mapping speed, Million of reads per hour | 824.83 Number of input reads | 52238990 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 50558244 Uniquely mapped reads % | 96.78% Average mapped length | 292.69 Number of splices: Total | 47383280 Number of splices: Annotated (sjdb) | 46565183 Number of splices: GT/AG | 46656515 Number of splices: GC/AG | 575107 Number of splices: AT/AC | 47869 Number of splices: Non-canonical | 103789 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 904877 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 61348 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.33% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 848521 848521 848521 N_multimapping 904877 904877 904877 N_noFeature 1420233 49962020 1770902 N_ambiguous 484235 2975 236521 UnstrandedReadsAssigned:48653776 PositiveStrandReadsAssigned:593249 NegativeStrandReadsAssigned:48550821 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237576 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237576-trimmed-pair1.fastq SRR4237576-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,238,990 reads, 48,248,567 reads pseudoaligned [quant] estimated average fragment length: 231.17 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR4237576.ke.tsv 34699 SRR4237576.se.tsv 87100 total ==> SRR4237576.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.83 1163 14.4636 Potri.005G024800.1.v4.1 1035 804.83 157 4.33728 Potri.004G059700.1.v4.1 961 730.868 31 0.943072 Potri.007G009000.2.v4.1 1416 1185.83 0 0 Potri.003G141000.2.v4.1 2943 2712.83 904.159 7.41044 Potri.016G087400.1.v4.1 270 83.5555 4096.59 1090.11 Potri.015G069301.1.v4.1 564 338.113 0 0 Potri.010G195200.1.v4.1 1773 1542.83 219 3.15608 Potri.012G127500.1.v4.1 977 746.841 29300 872.291 ==> SRR4237576.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4937 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 826 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 33 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237576 completed mapping pipeline successfully