Starting /dee2/code/volunteer_pipeline.sh SRR4237577 current disk space = 3050926923776 free memory = 1578630640 SRR4237577 SRAfilesize 9aa2ff4926be6215244fb3ab82372ab7 SRR4237577.sra SRR4237577.sra file validated SRR4237577 is paired end SRR4237577 is conventional basespace SRR4237577 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237577_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.31925 34.0 33.0 34.0 33.0 34.0 2 33.40375 34.0 33.0 34.0 33.0 34.0 3 33.27075 34.0 33.0 34.0 33.0 34.0 4 33.396 34.0 34.0 34.0 33.0 34.0 5 33.43525 34.0 34.0 34.0 33.0 34.0 6 36.71925 38.0 37.0 38.0 35.0 38.0 7 37.3375 38.0 38.0 38.0 37.0 38.0 8 37.22425 38.0 38.0 38.0 37.0 38.0 9 37.46975 38.0 38.0 38.0 37.0 38.0 10-14 37.1328 38.0 38.0 38.0 36.2 38.0 15-19 37.5304 38.0 38.0 38.0 38.0 38.0 20-24 37.507400000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.457800000000006 38.0 38.0 38.0 37.6 38.0 30-34 37.41205 38.0 38.0 38.0 37.0 38.0 35-39 37.211200000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.0441 38.0 38.0 38.0 36.0 38.0 45-49 37.119099999999996 38.0 38.0 38.0 36.0 38.0 50-54 37.196450000000006 38.0 38.0 38.0 36.2 38.0 55-59 36.96785 38.0 38.0 38.0 35.6 38.0 60-64 36.91565 38.0 38.0 38.0 35.6 38.0 65-69 37.00225 38.0 38.0 38.0 36.0 38.0 70-74 37.075050000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.949149999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.924 38.0 38.0 38.0 36.0 38.0 85-89 36.684900000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.724399999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.66355 38.0 38.0 38.0 34.6 38.0 100-104 36.58795 38.0 38.0 38.0 34.4 38.0 105-109 36.67205 38.0 38.0 38.0 35.0 38.0 110-114 36.4572 38.0 38.0 38.0 34.0 38.0 115-119 36.11845000000001 38.0 37.6 38.0 33.2 38.0 120-124 36.14935 38.0 38.0 38.0 33.8 38.0 125-129 36.20179999999999 38.0 38.0 38.0 33.8 38.0 130-134 36.0945 38.0 37.8 38.0 33.6 38.0 135-139 35.812 38.0 37.2 38.0 33.0 38.0 140-144 35.68715 38.0 36.6 38.0 33.0 38.0 145-149 34.426550000000006 38.0 35.2 38.0 26.2 38.0 150 30.1145 35.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 4.0 20 5.0 21 1.0 22 8.0 23 6.0 24 15.0 25 12.0 26 8.0 27 19.0 28 22.0 29 38.0 30 42.0 31 43.0 32 60.0 33 69.0 34 115.0 35 213.0 36 496.0 37 2815.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.22903629536921 12.265331664580724 9.486858573216521 35.018773466833544 2 23.45 14.899999999999999 35.125 26.525 3 20.025000000000002 21.075 25.424999999999997 33.475 4 22.825 30.099999999999998 22.425 24.65 5 22.45 36.15 22.3 19.1 6 19.3158953722334 36.016096579476866 23.91851106639839 20.74949698189135 7 14.149999999999999 25.6 41.9 18.35 8 17.150000000000002 24.8 31.7 26.35 9 17.424999999999997 24.6 33.074999999999996 24.9 10-14 19.82 30.525000000000002 26.590000000000003 23.064999999999998 15-19 19.805 28.7 27.87 23.625 20-24 19.82 28.925 27.634999999999998 23.62 25-29 19.405 30.06 27.08 23.455000000000002 30-34 20.02 29.43 27.505000000000003 23.044999999999998 35-39 20.125 29.085 27.27 23.52 40-44 20.565 29.304999999999996 27.325 22.805 45-49 19.64 28.804999999999996 27.615000000000002 23.94 50-54 20.11 29.044999999999998 27.250000000000004 23.595 55-59 19.775000000000002 29.360000000000003 26.810000000000002 24.055 60-64 19.705000000000002 29.095 27.405 23.794999999999998 65-69 19.855 28.835 27.605 23.705000000000002 70-74 20.04 29.044999999999998 27.395000000000003 23.52 75-79 20.23 29.325000000000003 27.175 23.27 80-84 19.835 29.2 27.189999999999998 23.775 85-89 19.945 28.705000000000002 27.47 23.880000000000003 90-94 19.794999999999998 29.085 27.26 23.86 95-99 20.27 29.13 26.965 23.635 100-104 20.755000000000003 28.505000000000003 27.584999999999997 23.155 105-109 20.14 28.71 27.395000000000003 23.755000000000003 110-114 20.82 28.904999999999998 27.235 23.04 115-119 20.21 28.705000000000002 27.43 23.655 120-124 20.485 28.465 26.939999999999998 24.11 125-129 20.09 28.575 27.015 24.32 130-134 20.26 28.345 27.075 24.32 135-139 20.275000000000002 28.46 26.939999999999998 24.325 140-144 20.655 28.444999999999997 26.83 24.07 145-149 20.665 28.585 27.05 23.7 150 20.4 27.700000000000003 28.425 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 1.5 23 2.0 24 1.5 25 2.5 26 5.5 27 12.0 28 15.0 29 14.0 30 17.0 31 28.0 32 41.0 33 46.5 34 58.0 35 69.0 36 80.0 37 119.0 38 147.0 39 161.0 40 196.5 41 223.5 42 239.0 43 254.0 44 265.5 45 270.0 46 259.0 47 244.0 48 228.0 49 192.5 50 167.0 51 152.0 52 118.0 53 89.0 54 75.0 55 59.5 56 39.5 57 28.0 58 19.5 59 13.5 60 11.5 61 7.5 62 4.5 63 3.5 64 3.5 65 2.0 66 1.0 67 2.0 68 2.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.6 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.887499999999999 0.0 0.0 0.0 0.0 130-131 5.4 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.324999999999999 0.0 0.0 0.0 0.0 136-137 6.762499999999999 0.0 0.0 0.0 0.0 138 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAACA 10 0.006973645 144.0 4 >>END_MODULE SRR4237577 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237577_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84325 33.0 33.0 34.0 32.0 34.0 2 32.96025 34.0 33.0 34.0 32.0 34.0 3 33.055 34.0 33.0 34.0 32.0 34.0 4 32.5265 34.0 33.0 34.0 31.0 34.0 5 32.85575 34.0 33.0 34.0 32.0 34.0 6 36.98725 38.0 38.0 38.0 37.0 38.0 7 37.12775 38.0 38.0 38.0 37.0 38.0 8 37.12275 38.0 38.0 38.0 37.0 38.0 9 36.94375 38.0 38.0 38.0 37.0 38.0 10-14 37.083149999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.02255 38.0 38.0 38.0 36.8 38.0 20-24 37.00485 38.0 38.0 38.0 36.8 38.0 25-29 36.95225000000001 38.0 38.0 38.0 36.6 38.0 30-34 36.97165 38.0 38.0 38.0 36.8 38.0 35-39 36.619 38.0 38.0 38.0 34.8 38.0 40-44 36.5741 38.0 37.8 38.0 34.4 38.0 45-49 36.9865 38.0 38.0 38.0 37.0 38.0 50-54 36.85145 38.0 38.0 38.0 36.0 38.0 55-59 36.6554 38.0 38.0 38.0 34.8 38.0 60-64 36.84165 38.0 38.0 38.0 36.0 38.0 65-69 36.57234999999999 38.0 38.0 38.0 34.8 38.0 70-74 36.773849999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.7893 38.0 38.0 38.0 36.0 38.0 80-84 36.66890000000001 38.0 38.0 38.0 35.8 38.0 85-89 36.625600000000006 38.0 38.0 38.0 35.4 38.0 90-94 36.478750000000005 38.0 38.0 38.0 34.6 38.0 95-99 36.47175 38.0 38.0 38.0 34.8 38.0 100-104 36.47095 38.0 38.0 38.0 34.8 38.0 105-109 36.34145 38.0 38.0 38.0 34.0 38.0 110-114 36.29665 38.0 38.0 38.0 34.4 38.0 115-119 36.150800000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.1124 38.0 38.0 38.0 34.0 38.0 125-129 35.97105 38.0 38.0 38.0 33.8 38.0 130-134 35.80095 38.0 38.0 38.0 33.4 38.0 135-139 35.63225 38.0 38.0 38.0 33.0 38.0 140-144 35.31805000000001 38.0 37.8 38.0 31.2 38.0 145-149 35.08579999999999 38.0 37.8 38.0 31.6 38.0 150 29.80875 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 2.0 5 0.0 6 2.0 7 1.0 8 1.0 9 2.0 10 1.0 11 1.0 12 2.0 13 0.0 14 0.0 15 4.0 16 1.0 17 4.0 18 3.0 19 4.0 20 11.0 21 8.0 22 13.0 23 13.0 24 24.0 25 16.0 26 19.0 27 18.0 28 32.0 29 28.0 30 39.0 31 48.0 32 54.0 33 80.0 34 94.0 35 148.0 36 321.0 37 2994.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.0 20.95 12.950000000000001 24.099999999999998 2 29.425 24.45 30.599999999999998 15.525 3 21.45 27.525 31.4 19.625 4 23.974999999999998 34.300000000000004 23.65 18.075 5 25.1 36.725 21.9 16.275000000000002 6 18.95 39.975 23.799999999999997 17.275 7 21.8 18.675 40.5 19.025 8 22.225 24.5 27.725 25.55 9 21.975 24.775 29.675 23.575 10-14 23.810000000000002 28.265 27.029999999999998 20.895 15-19 23.244999999999997 27.71 28.255000000000003 20.79 20-24 23.205000000000002 27.975 28.1 20.72 25-29 23.51 28.025 27.815 20.65 30-34 22.715 27.98 28.325 20.979999999999997 35-39 23.155 27.855 28.435 20.555 40-44 23.655 27.68 28.144999999999996 20.52 45-49 23.28 28.24 27.815 20.665 50-54 23.305 27.465 28.555000000000003 20.674999999999997 55-59 23.875 27.565 28.035 20.525 60-64 23.1 27.735 29.235 19.93 65-69 23.425 27.725 28.335 20.515 70-74 23.655 27.275 28.435 20.635 75-79 23.465 27.415 29.115000000000002 20.005 80-84 23.605 27.455000000000002 28.51 20.43 85-89 23.285 27.915 28.499999999999996 20.3 90-94 24.055 27.11 28.689999999999998 20.145 95-99 23.7 27.965 28.18 20.155 100-104 23.75 28.139999999999997 27.779999999999998 20.330000000000002 105-109 24.43 27.529999999999998 28.249999999999996 19.79 110-114 24.005000000000003 27.985 28.244999999999997 19.765 115-119 24.02 28.005000000000003 27.675 20.3 120-124 24.47 28.050000000000004 27.529999999999998 19.950000000000003 125-129 24.515 28.115000000000002 27.529999999999998 19.84 130-134 24.855 27.965 27.445000000000004 19.735 135-139 24.884999999999998 27.52 27.800000000000004 19.794999999999998 140-144 24.725 27.985 27.71 19.580000000000002 145-149 25.25 27.93 27.084999999999997 19.735 150 24.575 27.325 27.275 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.5 24 3.5 25 4.5 26 5.5 27 5.5 28 9.5 29 12.5 30 12.0 31 18.0 32 25.5 33 33.5 34 44.0 35 63.0 36 86.5 37 105.5 38 123.5 39 162.5 40 217.0 41 239.5 42 246.5 43 272.0 44 278.5 45 273.0 46 287.5 47 279.5 48 239.5 49 198.5 50 158.0 51 125.5 52 107.0 53 84.5 54 68.5 55 56.5 56 38.0 57 28.5 58 23.5 59 18.0 60 12.5 61 6.5 62 4.0 63 3.0 64 2.5 65 4.0 66 3.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.27603513174404015 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.02509410288582183 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACTGCACGCAAAGAGCAGAGAGAGAGAGAGAGTATCAAAACTAGCCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 1.9875 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 4.2 0.0 0.0 0.0 0.0 126-127 4.5375 0.0 0.0 0.0 0.0 128-129 5.0375 0.0 0.0 0.0 0.0 130-131 5.55 0.0 0.0 0.0 0.0 132-133 5.987500000000001 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCAAC 10 0.006973645 144.0 9 >>END_MODULE Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309829 spots for SRR4237577.sra Written 2309829 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra Read 2309824 spots for SRR4237577.sra Written 2309824 spots for SRR4237577.sra SRR ids: ['SRR4237577.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_avcrz49g SRR4237577.sra spots: 46196485 blocks: [[1, 2309824], [2309825, 4619648], [4619649, 6929472], [6929473, 9239296], [9239297, 11549120], [11549121, 13858944], [13858945, 16168768], [16168769, 18478592], [18478593, 20788416], [20788417, 23098240], [23098241, 25408064], [25408065, 27717888], [27717889, 30027712], [30027713, 32337536], [32337537, 34647360], [34647361, 36957184], [36957185, 39267008], [39267009, 41576832], [41576833, 43886656], [43886657, 46196485]] SRR4237577 file size 15542545 SRR4237577 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237577 SRR4237577_1.fastq SRR4237577_2.fastq Input file: SRR4237577_1.fastq Paired file: SRR4237577_2.fastq trimmed: SRR4237577-trimmed-pair1.fastq, SRR4237577-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:35:54 2025 >> started Wed Feb 12 10:36:47 2025 >> done (53.739s) 46196485 read pairs processed; of these: 87636 ( 0.19%) short read pairs filtered out after trimming by size control 29592 ( 0.06%) empty read pairs filtered out after trimming by size control 46079257 (99.75%) read pairs available; of these: 14279182 (30.99%) trimmed read pairs available after processing 31800075 (69.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 13 0.00% 21 7 0.00% 22 16 0.00% 23 7 0.00% 24 8 0.00% 25 8 0.00% 26 17 0.00% 27 16 0.00% 28 20 0.00% 29 10 0.00% 30 17 0.00% 31 11 0.00% 32 18 0.00% 33 12 0.00% 34 26 0.00% 35 28 0.00% 36 33 0.00% 37 34 0.00% 38 28 0.00% 39 48 0.00% 40 44 0.00% 41 51 0.00% 42 50 0.00% 43 68 0.00% 44 54 0.00% 45 69 0.00% 46 99 0.00% 47 106 0.00% 48 97 0.00% 49 144 0.00% 50 153 0.00% 51 196 0.00% 52 175 0.00% 53 206 0.00% 54 230 0.00% 55 266 0.00% 56 296 0.00% 57 314 0.00% 58 347 0.00% 59 398 0.00% 60 480 0.00% 61 527 0.00% 62 614 0.00% 63 662 0.00% 64 776 0.00% 65 914 0.00% 66 996 0.00% 67 1224 0.00% 68 1413 0.00% 69 2547 0.01% 70 2529 0.01% 71 2115 0.00% 72 2260 0.00% 73 2572 0.01% 74 2753 0.01% 75 3151 0.01% 76 3400 0.01% 77 3906 0.01% 78 4547 0.01% 79 4884 0.01% 80 5525 0.01% 81 6367 0.01% 82 7228 0.02% 83 8724 0.02% 84 19314 0.04% 85 18970 0.04% 86 14212 0.03% 87 14822 0.03% 88 16125 0.03% 89 18245 0.04% 90 20345 0.04% 91 21081 0.05% 92 30780 0.07% 93 26117 0.06% 94 29323 0.06% 95 29267 0.06% 96 30142 0.07% 97 32141 0.07% 98 34044 0.07% 99 36509 0.08% 100 38515 0.08% 101 41553 0.09% 102 44404 0.10% 103 47975 0.10% 104 50538 0.11% 105 54235 0.12% 106 56764 0.12% 107 59418 0.13% 108 64853 0.14% 109 67522 0.15% 110 68866 0.15% 111 70983 0.15% 112 76727 0.17% 113 78440 0.17% 114 82742 0.18% 115 86776 0.19% 116 90526 0.20% 117 94096 0.20% 118 98533 0.21% 119 99644 0.22% 120 102991 0.22% 121 107984 0.23% 122 110841 0.24% 123 114821 0.25% 124 118228 0.26% 125 122530 0.27% 126 127176 0.28% 127 130867 0.28% 128 134861 0.29% 129 139404 0.30% 130 143781 0.31% 131 148568 0.32% 132 153025 0.33% 133 159913 0.35% 134 163543 0.35% 135 170718 0.37% 136 177581 0.39% 137 184682 0.40% 138 193233 0.42% 139 200867 0.44% 140 211003 0.46% 141 224659 0.49% 142 239955 0.52% 143 262275 0.57% 144 293788 0.64% 145 337122 0.73% 146 416097 0.90% 147 568421 1.23% 148 970008 2.11% 149 6011824 13.05% 150 31800075 69.01% 46079257 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=43 prefix-density=0.21 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=7 fanout-score=105.24 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=19.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=24.04 fanout-score-rank=7 prefix-density=0.44 prefix-fanout=9.8 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=269.79 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=29.2 sequence=AAGAAGAAGAAA SRR4237577 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:37:29 Started mapping on | Feb 12 10:37:30 Finished on | Feb 12 10:41:05 Mapping speed, Million of reads per hour | 771.56 Number of input reads | 46079257 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 44321928 Uniquely mapped reads % | 96.19% Average mapped length | 292.38 Number of splices: Total | 39618812 Number of splices: Annotated (sjdb) | 38901946 Number of splices: GT/AG | 39011749 Number of splices: GC/AG | 471191 Number of splices: AT/AC | 36563 Number of splices: Non-canonical | 99309 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 839313 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 80800 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.77% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 963740 963740 963740 N_multimapping 839313 839313 839313 N_noFeature 1246944 43781046 1523733 N_ambiguous 453031 3208 186390 UnstrandedReadsAssigned:42621953 PositiveStrandReadsAssigned:537674 NegativeStrandReadsAssigned:42611805 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237577 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237577-trimmed-pair1.fastq SRR4237577-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,079,257 reads, 42,357,105 reads pseudoaligned [quant] estimated average fragment length: 232.422 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR4237577.ke.tsv 34699 SRR4237577.se.tsv 87100 total ==> SRR4237577.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.58 1026 14.0883 Potri.005G024800.1.v4.1 1035 803.578 100 3.05285 Potri.004G059700.1.v4.1 961 729.585 21 0.706117 Potri.007G009000.2.v4.1 1416 1184.58 0 0 Potri.003G141000.2.v4.1 2943 2711.58 638.159 5.77351 Potri.016G087400.1.v4.1 270 84.8943 5630 1626.91 Potri.015G069301.1.v4.1 564 337.044 0 0 Potri.010G195200.1.v4.1 1773 1541.58 198.593 3.16032 Potri.012G127500.1.v4.1 977 745.578 10031 330.054 ==> SRR4237577.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4718 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 589 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237577 completed mapping pipeline successfully