Starting /dee2/code/volunteer_pipeline.sh SRR4237578 current disk space = 3051092221952 free memory = 1574817704 SRR4237578 SRAfilesize bcde0f18b01068fb8d2d838d71bd6e81 SRR4237578.sra SRR4237578.sra file validated SRR4237578 is paired end SRR4237578 is conventional basespace SRR4237578 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237578_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5995 34.0 33.0 34.0 25.0 34.0 2 32.9225 34.0 33.0 34.0 28.0 34.0 3 33.10025 34.0 33.0 34.0 32.0 34.0 4 33.373 34.0 33.0 34.0 33.0 34.0 5 33.424 34.0 33.0 34.0 33.0 34.0 6 37.142 38.0 37.0 38.0 36.0 38.0 7 37.4335 38.0 38.0 38.0 37.0 38.0 8 37.57875 38.0 38.0 38.0 38.0 38.0 9 37.66275 38.0 38.0 38.0 38.0 38.0 10-14 37.29165 38.0 38.0 38.0 37.0 38.0 15-19 37.541250000000005 38.0 38.0 38.0 37.6 38.0 20-24 37.549 38.0 38.0 38.0 38.0 38.0 25-29 37.54305 38.0 38.0 38.0 38.0 38.0 30-34 37.56385 38.0 38.0 38.0 38.0 38.0 35-39 37.554649999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.4259 38.0 38.0 38.0 37.2 38.0 45-49 37.387 38.0 38.0 38.0 37.0 38.0 50-54 37.33579999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.294599999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.27645 38.0 38.0 38.0 37.0 38.0 65-69 37.2246 38.0 38.0 38.0 36.6 38.0 70-74 37.2245 38.0 38.0 38.0 36.8 38.0 75-79 37.196600000000004 38.0 38.0 38.0 36.8 38.0 80-84 37.19705 38.0 38.0 38.0 36.6 38.0 85-89 36.0314 38.0 36.4 38.0 30.4 38.0 90-94 37.088499999999996 38.0 38.0 38.0 36.0 38.0 95-99 37.0674 38.0 38.0 38.0 36.4 38.0 100-104 36.92529999999999 38.0 38.0 38.0 35.8 38.0 105-109 36.686099999999996 38.0 38.0 38.0 35.0 38.0 110-114 36.718 38.0 38.0 38.0 35.2 38.0 115-119 36.66285 38.0 38.0 38.0 35.0 38.0 120-124 36.53525 38.0 38.0 38.0 34.8 38.0 125-129 36.491949999999996 38.0 38.0 38.0 34.4 38.0 130-134 36.322199999999995 38.0 38.0 38.0 34.0 38.0 135-139 36.1256 38.0 37.8 38.0 33.4 38.0 140-144 36.04324999999999 38.0 38.0 38.0 33.0 38.0 145-149 35.771 38.0 37.8 38.0 33.2 38.0 150 31.02375 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 1.0 18 6.0 19 2.0 20 3.0 21 5.0 22 1.0 23 3.0 24 5.0 25 7.0 26 8.0 27 10.0 28 16.0 29 20.0 30 24.0 31 34.0 32 54.0 33 70.0 34 100.0 35 181.0 36 442.0 37 3003.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.55436278557666 12.248830167905313 7.844756399669695 37.35205064684833 2 22.95573893473368 15.028757189297323 34.55863965991498 27.45686421605401 3 19.525000000000002 20.25 25.874999999999996 34.35 4 22.925 28.15 23.150000000000002 25.775 5 22.163786626596544 33.65890308039069 23.741547708489858 20.435762584522916 6 18.525 36.05 23.875 21.55 7 14.149999999999999 28.875 40.35 16.625 8 16.8 26.125 31.474999999999998 25.6 9 16.650000000000002 25.2 33.5 24.65 10-14 19.725 30.825000000000003 26.75 22.7 15-19 19.005 29.195 27.865000000000002 23.935000000000002 20-24 19.16 29.45 27.935 23.455000000000002 25-29 18.8 30.055 27.605 23.54 30-34 18.93 29.044999999999998 28.075 23.95 35-39 19.415 29.265 27.779999999999998 23.54 40-44 19.994999999999997 30.335 26.555 23.115 45-49 19.425 29.255 27.6 23.72 50-54 19.939999999999998 29.23 27.275 23.555 55-59 19.63 29.275000000000002 26.93 24.165 60-64 19.220000000000002 29.29 27.775 23.715 65-69 19.415 29.24 27.345000000000002 24.0 70-74 19.439999999999998 29.604999999999997 27.42 23.535 75-79 20.085 29.154999999999998 27.229999999999997 23.53 80-84 20.1 28.33 27.77 23.799999999999997 85-89 20.055 28.735 27.57 23.64 90-94 19.55 29.080000000000002 27.195000000000004 24.175 95-99 19.235 28.78 28.084999999999997 23.9 100-104 19.675 29.360000000000003 27.305 23.66 105-109 19.955000000000002 28.860000000000003 27.36 23.825 110-114 20.4 28.53 27.71 23.36 115-119 19.939999999999998 28.48 27.450000000000003 24.13 120-124 20.27 28.83 27.11 23.79 125-129 19.905 28.615000000000002 27.435 24.044999999999998 130-134 19.805 29.054999999999996 27.515 23.625 135-139 20.24 28.689999999999998 27.339999999999996 23.73 140-144 20.575 27.994999999999997 27.61 23.82 145-149 20.52 28.57 27.389999999999997 23.52 150 20.216515609264853 27.744209466263847 28.172205438066467 23.867069486404834 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 2.5 22 3.0 23 3.0 24 3.5 25 4.0 26 3.5 27 11.0 28 14.5 29 12.5 30 21.5 31 37.0 32 49.5 33 57.5 34 63.5 35 75.0 36 105.0 37 127.0 38 138.0 39 169.5 40 203.0 41 222.5 42 223.5 43 249.5 44 275.0 45 266.0 46 254.0 47 240.0 48 220.5 49 193.5 50 154.5 51 126.0 52 120.5 53 96.5 54 66.0 55 49.5 56 38.0 57 28.5 58 21.0 59 15.0 60 8.5 61 5.5 62 5.0 63 3.0 64 1.5 65 1.5 66 1.5 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.175 2 0.025 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.11249999999999999 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.7625000000000002 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.325 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.25 0.0 0.0 0.0 0.0 138 3.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237578 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237578_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9235 33.0 33.0 34.0 32.0 34.0 2 33.018 34.0 33.0 34.0 32.0 34.0 3 32.99825 34.0 33.0 34.0 32.0 34.0 4 33.0225 34.0 33.0 34.0 32.0 34.0 5 33.025 34.0 33.0 34.0 33.0 34.0 6 37.16125 38.0 38.0 38.0 37.0 38.0 7 37.18775 38.0 38.0 38.0 37.0 38.0 8 37.15925 38.0 38.0 38.0 37.0 38.0 9 37.167 38.0 38.0 38.0 37.0 38.0 10-14 37.165949999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.1281 38.0 38.0 38.0 37.0 38.0 20-24 37.0945 38.0 38.0 38.0 37.0 38.0 25-29 37.079499999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.08215 38.0 38.0 38.0 37.0 38.0 35-39 37.0901 38.0 38.0 38.0 37.0 38.0 40-44 37.0809 38.0 38.0 38.0 37.0 38.0 45-49 37.06845 38.0 38.0 38.0 37.0 38.0 50-54 37.0344 38.0 38.0 38.0 37.0 38.0 55-59 37.04535 38.0 38.0 38.0 37.0 38.0 60-64 36.9467 38.0 38.0 38.0 36.4 38.0 65-69 36.98460000000001 38.0 38.0 38.0 36.8 38.0 70-74 36.933949999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.88965 38.0 38.0 38.0 36.2 38.0 80-84 36.81615 38.0 38.0 38.0 36.0 38.0 85-89 36.829899999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.731100000000005 38.0 38.0 38.0 36.0 38.0 95-99 36.65995 38.0 38.0 38.0 35.6 38.0 100-104 36.50975 38.0 38.0 38.0 34.6 38.0 105-109 36.48285 38.0 38.0 38.0 34.6 38.0 110-114 36.484 38.0 38.0 38.0 35.0 38.0 115-119 36.4579 38.0 38.0 38.0 34.8 38.0 120-124 36.30425 38.0 38.0 38.0 34.2 38.0 125-129 36.2384 38.0 38.0 38.0 34.0 38.0 130-134 36.097699999999996 38.0 38.0 38.0 33.8 38.0 135-139 35.8689 38.0 38.0 38.0 33.2 38.0 140-144 35.5566 38.0 38.0 38.0 32.4 38.0 145-149 35.229 38.0 37.6 38.0 32.0 38.0 150 29.9485 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 0.0 5 0.0 6 1.0 7 1.0 8 2.0 9 1.0 10 1.0 11 0.0 12 3.0 13 0.0 14 1.0 15 1.0 16 3.0 17 5.0 18 6.0 19 1.0 20 7.0 21 8.0 22 8.0 23 14.0 24 6.0 25 13.0 26 10.0 27 18.0 28 22.0 29 36.0 30 37.0 31 32.0 32 61.0 33 63.0 34 99.0 35 156.0 36 339.0 37 3035.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.65 22.5 11.799999999999999 25.05 2 28.875 25.224999999999998 31.35 14.549999999999999 3 20.474999999999998 28.825 32.550000000000004 18.15 4 25.224999999999998 34.55 22.400000000000002 17.825 5 25.2 38.1 21.175 15.525 6 20.325 39.875 22.25 17.549999999999997 7 20.974999999999998 20.4 39.175 19.45 8 21.275 26.150000000000002 28.675 23.9 9 21.925 25.174999999999997 30.65 22.25 10-14 24.025 28.610000000000003 26.705000000000002 20.66 15-19 23.940985246311577 28.262065516379092 27.46686671667917 20.330082520630157 20-24 24.02 27.689999999999998 27.855 20.435 25-29 24.10602650662666 28.667166791697923 27.636909227306827 19.58989747436859 30-34 23.435858964741186 28.392098024506122 27.666916729182294 20.505126281570394 35-39 24.07 27.63 28.449999999999996 19.85 40-44 23.22 28.110000000000003 28.075 20.595 45-49 23.827382738273826 27.672767276727672 27.807780778077806 20.692069206920692 50-54 23.446723361680842 27.078539269634817 28.659329664832416 20.815407703851925 55-59 23.8247649529906 28.255651130226045 28.315663132626522 19.60392078415683 60-64 23.169999999999998 28.134999999999998 28.74 19.955000000000002 65-69 23.623543531529727 26.849027354103118 28.869330399559935 20.65809871480722 70-74 23.286164308215408 27.86639331966598 28.66143307165358 20.186009300465024 75-79 23.705000000000002 26.900000000000002 29.675 19.72 80-84 24.06120306015301 27.586379318965946 28.146407320366016 20.206010300515025 85-89 23.585896474118528 27.97199299824956 28.532133033258315 19.909977494373592 90-94 23.970786854084338 27.592416587464356 28.722925316392377 19.713871242058925 95-99 24.155870141563703 27.86754039317693 28.04762142964334 19.928968035616027 100-104 24.4 27.400000000000002 28.27 19.93 105-109 23.909781956391278 27.590518103620727 28.425685137027408 20.07401480296059 110-114 23.84 28.265 28.53 19.365 115-119 23.93478695739148 27.870574114822965 27.91058211642328 20.284056811362273 120-124 24.843726558983846 27.56913537030555 27.794169125368807 19.7929689453418 125-129 23.425 27.700000000000003 28.599999999999998 20.275000000000002 130-134 24.211210560528027 27.236361818090906 28.691434571728585 19.860993049652485 135-139 24.005000000000003 28.18 27.794999999999998 20.02 140-144 24.30238965983668 27.608837232603577 28.255097440008015 19.833675667551727 145-149 24.423663549532428 28.039205880882136 28.15422313347002 19.382907436115417 150 24.451173353520062 27.605349482715113 28.00908402725208 19.934393136512742 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 1.5 21 0.0 22 0.5 23 1.5 24 3.0 25 3.0 26 4.0 27 6.0 28 5.0 29 9.0 30 17.5 31 23.5 32 27.5 33 37.0 34 50.0 35 59.0 36 76.5 37 100.0 38 132.5 39 167.5 40 210.5 41 250.0 42 259.5 43 269.5 44 288.5 45 289.5 46 269.5 47 251.0 48 234.0 49 205.5 50 179.5 51 136.0 52 103.5 53 92.0 54 65.0 55 43.5 56 33.5 57 27.5 58 16.5 59 13.5 60 11.5 61 9.0 62 7.0 63 2.0 64 1.0 65 2.0 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.025 20-24 0.0 25-29 0.025 30-34 0.025 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.05 55-59 0.02 60-64 0.0 65-69 0.015 70-74 0.005 75-79 0.0 80-84 0.005 85-89 0.025 90-94 0.045 95-99 0.045 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.02 120-124 0.015 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.19499999999999998 145-149 0.015 150 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 1.05 0.0 0.0 0.0 0.0 120-121 1.175 0.0 0.0 0.0 0.0 122-123 1.2625000000000002 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.725 0.0 0.0 0.0 0.0 128-129 1.9749999999999999 0.0 0.0 0.0 0.0 130-131 2.275 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 2.9125 0.0 0.0 0.0 0.0 136-137 3.2 0.0 0.0 0.0 0.0 138 3.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042087 spots for SRR4237578.sra Written 2042087 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra Read 2042068 spots for SRR4237578.sra Written 2042068 spots for SRR4237578.sra SRR ids: ['SRR4237578.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_od_4umwf SRR4237578.sra spots: 40841379 blocks: [[1, 2042068], [2042069, 4084136], [4084137, 6126204], [6126205, 8168272], [8168273, 10210340], [10210341, 12252408], [12252409, 14294476], [14294477, 16336544], [16336545, 18378612], [18378613, 20420680], [20420681, 22462748], [22462749, 24504816], [24504817, 26546884], [26546885, 28588952], [28588953, 30631020], [30631021, 32673088], [32673089, 34715156], [34715157, 36757224], [36757225, 38799292], [38799293, 40841379]] SRR4237578 file size 13738334 SRR4237578 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237578 SRR4237578_1.fastq SRR4237578_2.fastq Input file: SRR4237578_1.fastq Paired file: SRR4237578_2.fastq trimmed: SRR4237578-trimmed-pair1.fastq, SRR4237578-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:48:44 2025 >> started Wed Feb 12 10:49:30 2025 >> done (46.305s) 40841379 read pairs processed; of these: 30716 ( 0.08%) short read pairs filtered out after trimming by size control 25330 ( 0.06%) empty read pairs filtered out after trimming by size control 40785333 (99.86%) read pairs available; of these: 13731515 (33.67%) trimmed read pairs available after processing 27053818 (66.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 6 0.00% 21 9 0.00% 22 9 0.00% 23 15 0.00% 24 7 0.00% 25 13 0.00% 26 9 0.00% 27 29 0.00% 28 13 0.00% 29 11 0.00% 30 32 0.00% 31 26 0.00% 32 19 0.00% 33 14 0.00% 34 26 0.00% 35 25 0.00% 36 19 0.00% 37 24 0.00% 38 36 0.00% 39 34 0.00% 40 39 0.00% 41 55 0.00% 42 54 0.00% 43 42 0.00% 44 56 0.00% 45 45 0.00% 46 56 0.00% 47 84 0.00% 48 65 0.00% 49 81 0.00% 50 86 0.00% 51 109 0.00% 52 109 0.00% 53 113 0.00% 54 134 0.00% 55 157 0.00% 56 195 0.00% 57 180 0.00% 58 200 0.00% 59 230 0.00% 60 263 0.00% 61 277 0.00% 62 320 0.00% 63 309 0.00% 64 396 0.00% 65 409 0.00% 66 546 0.00% 67 578 0.00% 68 736 0.00% 69 1459 0.00% 70 1678 0.00% 71 953 0.00% 72 972 0.00% 73 1070 0.00% 74 1229 0.00% 75 1380 0.00% 76 1556 0.00% 77 1592 0.00% 78 1828 0.00% 79 2002 0.00% 80 2424 0.01% 81 2626 0.01% 82 3037 0.01% 83 3647 0.01% 84 5765 0.01% 85 6341 0.02% 86 6754 0.02% 87 7571 0.02% 88 8300 0.02% 89 8586 0.02% 90 9221 0.02% 91 9659 0.02% 92 10404 0.03% 93 11267 0.03% 94 11935 0.03% 95 12928 0.03% 96 14336 0.04% 97 15214 0.04% 98 15543 0.04% 99 16421 0.04% 100 18008 0.04% 101 19210 0.05% 102 20384 0.05% 103 21880 0.05% 104 23357 0.06% 105 25280 0.06% 106 26790 0.07% 107 28130 0.07% 108 30122 0.07% 109 31294 0.08% 110 32521 0.08% 111 34716 0.09% 112 36676 0.09% 113 38462 0.09% 114 40796 0.10% 115 43274 0.11% 116 45540 0.11% 117 48362 0.12% 118 50320 0.12% 119 51693 0.13% 120 53757 0.13% 121 56284 0.14% 122 59270 0.15% 123 61802 0.15% 124 65330 0.16% 125 68630 0.17% 126 72489 0.18% 127 76137 0.19% 128 78913 0.19% 129 82832 0.20% 130 87220 0.21% 131 91186 0.22% 132 95543 0.23% 133 100674 0.25% 134 106768 0.26% 135 113299 0.28% 136 120616 0.30% 137 128041 0.31% 138 137144 0.34% 139 147036 0.36% 140 159326 0.39% 141 174021 0.43% 142 191716 0.47% 143 215769 0.53% 144 251097 0.62% 145 307532 0.75% 146 383043 0.94% 147 556407 1.36% 148 1095841 2.69% 149 7722961 18.94% 150 27053818 66.33% 40785333 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.66 fanout-score-rank=38 prefix-density=0.29 prefix-fanout=1.0 sequence=CACTAGCTAGACGTGCAAGATTCAACCTACACACAAGAACCCACTAGATAGACTTCCACTGGAACCATGCAGCATTCTCCCGTGATGACCTCATTACTCAGTCTTTTCTACTGGGGTTTCTGTTTCAACCTTCTCCTCTGTTTCAACAGGCTTCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=841.01 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=28.7 sequence=AAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.3 sequence=TCTAGCTAGTGGTTTAATAAAGGATTGTTATGCTAATGGGGGTGTAGGTATGGAAATGTTCCACTTGGATCAAACCAATGCGAACTCACCGCATGGATGCATTTGATCTTTGATTTGGAGCAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=9 fanout-score=265.10 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=30.7 sequence=AAGAAGAAGAAA SRR4237578 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:50:13 Started mapping on | Feb 12 10:50:13 Finished on | Feb 12 10:54:18 Mapping speed, Million of reads per hour | 599.29 Number of input reads | 40785333 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 39049574 Uniquely mapped reads % | 95.74% Average mapped length | 294.81 Number of splices: Total | 34947402 Number of splices: Annotated (sjdb) | 34320971 Number of splices: GT/AG | 34404458 Number of splices: GC/AG | 426303 Number of splices: AT/AC | 34935 Number of splices: Non-canonical | 81706 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 765209 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 59059 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1002139 1002139 1002139 N_multimapping 765209 765209 765209 N_noFeature 1082866 38557859 1330019 N_ambiguous 409221 2435 163123 UnstrandedReadsAssigned:37557487 PositiveStrandReadsAssigned:489280 NegativeStrandReadsAssigned:37556432 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237578 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237578-trimmed-pair1.fastq SRR4237578-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,785,333 reads, 37,309,479 reads pseudoaligned [quant] estimated average fragment length: 247.529 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR4237578.ke.tsv 34699 SRR4237578.se.tsv 87100 total ==> SRR4237578.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.47 958 13.5763 Potri.005G024800.1.v4.1 1035 788.471 114 3.62968 Potri.004G059700.1.v4.1 961 714.513 36 1.26486 Potri.007G009000.2.v4.1 1416 1169.47 0 0 Potri.003G141000.2.v4.1 2943 2696.47 519.229 4.83407 Potri.016G087400.1.v4.1 270 74.5496 6053.58 2038.53 Potri.015G069301.1.v4.1 564 322.647 0 0 Potri.010G195200.1.v4.1 1773 1526.47 237.781 3.91056 Potri.012G127500.1.v4.1 977 730.502 16807 577.588 ==> SRR4237578.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7131 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 795 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 41 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237578 completed mapping pipeline successfully