Starting /dee2/code/volunteer_pipeline.sh SRR4237579 current disk space = 3051119198208 free memory = 1579931684 SRR4237579 SRAfilesize e3a7f81be0e4c26a4fec6d0e472074f4 SRR4237579.sra SRR4237579.sra file validated SRR4237579 is paired end SRR4237579 is conventional basespace SRR4237579 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237579_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3705 34.0 33.0 34.0 32.0 34.0 2 32.99025 34.0 33.0 34.0 31.0 34.0 3 33.1665 34.0 33.0 34.0 32.0 34.0 4 33.26725 34.0 33.0 34.0 32.0 34.0 5 33.187 34.0 33.0 34.0 33.0 34.0 6 37.10925 38.0 37.0 38.0 36.0 38.0 7 37.36225 38.0 38.0 38.0 37.0 38.0 8 37.5225 38.0 38.0 38.0 37.0 38.0 9 37.6075 38.0 38.0 38.0 38.0 38.0 10-14 37.59165 38.0 38.0 38.0 38.0 38.0 15-19 37.48355 38.0 38.0 38.0 37.8 38.0 20-24 37.444399999999995 38.0 38.0 38.0 37.4 38.0 25-29 37.509249999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.4967 38.0 38.0 38.0 38.0 38.0 35-39 37.48235 38.0 38.0 38.0 37.8 38.0 40-44 37.283950000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.3831 38.0 38.0 38.0 37.0 38.0 50-54 37.34125 38.0 38.0 38.0 37.0 38.0 55-59 37.3187 38.0 38.0 38.0 37.0 38.0 60-64 37.26995000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.19005 38.0 38.0 38.0 36.6 38.0 70-74 36.8154 38.0 37.8 38.0 34.8 38.0 75-79 37.1967 38.0 38.0 38.0 36.6 38.0 80-84 37.0801 38.0 38.0 38.0 36.6 38.0 85-89 37.130199999999995 38.0 38.0 38.0 36.4 38.0 90-94 37.04705 38.0 38.0 38.0 36.0 38.0 95-99 36.95605 38.0 38.0 38.0 35.8 38.0 100-104 36.8866 38.0 38.0 38.0 35.8 38.0 105-109 36.787 38.0 38.0 38.0 35.2 38.0 110-114 36.695800000000006 38.0 38.0 38.0 35.0 38.0 115-119 36.624449999999996 38.0 38.0 38.0 34.8 38.0 120-124 36.5429 38.0 38.0 38.0 34.6 38.0 125-129 36.28104999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.38725000000001 38.0 38.0 38.0 34.0 38.0 135-139 35.799400000000006 38.0 37.2 38.0 32.0 38.0 140-144 35.9091 38.0 37.6 38.0 33.4 38.0 145-149 34.579449999999994 38.0 35.8 38.0 27.4 38.0 150 30.644 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 2.0 17 2.0 18 2.0 19 4.0 20 3.0 21 4.0 22 1.0 23 9.0 24 6.0 25 6.0 26 10.0 27 19.0 28 11.0 29 25.0 30 30.0 31 38.0 32 68.0 33 75.0 34 98.0 35 169.0 36 459.0 37 2956.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.15154749199573 11.606189967982925 9.471718249733192 44.77054429028816 2 21.46073036518259 15.132566283141571 36.743371685842924 26.663331665832917 3 19.6 18.224999999999998 25.324999999999996 36.85 4 22.575 27.150000000000002 22.95 27.325 5 21.801304565980935 33.81836427496237 23.858504766683392 20.521826392373306 6 17.549999999999997 37.724999999999994 23.425 21.3 7 13.350000000000001 29.099999999999998 40.675 16.875 8 16.6 25.8 32.725 24.875 9 16.8 24.7 34.925 23.575 10-14 19.115 31.335 26.61 22.939999999999998 15-19 19.16 30.455 27.38 23.005 20-24 19.675 29.385 27.295 23.645 25-29 19.1 29.895 27.644999999999996 23.36 30-34 19.615 29.175 27.485 23.724999999999998 35-39 19.175 29.665000000000003 27.305 23.855 40-44 19.2009600480024 30.551527576378817 26.806340317015852 23.44117205860293 45-49 19.215 29.81 26.915 24.060000000000002 50-54 19.62 29.475 27.644999999999996 23.26 55-59 19.36 29.354999999999997 27.405 23.880000000000003 60-64 19.869999999999997 29.5 26.529999999999998 24.099999999999998 65-69 19.18 29.904999999999998 27.155 23.76 70-74 19.685 29.575000000000003 27.145000000000003 23.595 75-79 19.225 28.98 27.450000000000003 24.345 80-84 19.2407722316695 29.663899169750923 27.34320296088827 23.752125637691307 85-89 19.59 28.71 27.83 23.87 90-94 19.6 29.315 27.505000000000003 23.580000000000002 95-99 20.1 28.605000000000004 27.775 23.52 100-104 19.36 29.07 27.805000000000003 23.765 105-109 19.89 28.375 27.744999999999997 23.990000000000002 110-114 19.345000000000002 28.68 28.044999999999998 23.93 115-119 20.035 29.215000000000003 27.66 23.09 120-124 20.025000000000002 29.145 26.86 23.97 125-129 19.671967196719674 28.67286728672867 27.632763276327633 24.02240224022402 130-134 20.055 28.26 27.915 23.77 135-139 20.555 29.13 26.640000000000004 23.674999999999997 140-144 20.235 28.27 27.175 24.32 145-149 20.43 29.104999999999997 26.965 23.5 150 19.737837156541467 29.241240231913284 26.392740105873457 24.62818250567179 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 2.0 21 3.0 22 1.5 23 1.0 24 2.0 25 6.5 26 11.0 27 11.5 28 15.0 29 16.5 30 23.5 31 37.0 32 46.0 33 55.0 34 75.0 35 91.5 36 104.5 37 124.0 38 146.5 39 165.0 40 185.0 41 207.0 42 237.5 43 248.5 44 257.5 45 276.5 46 270.0 47 244.0 48 213.0 49 200.5 50 161.0 51 119.5 52 96.5 53 84.5 54 76.0 55 50.5 56 38.0 57 31.5 58 22.0 59 14.0 60 8.0 61 5.5 62 4.5 63 5.5 64 2.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.3 2 0.05 3 0.0 4 0.0 5 0.35000000000000003 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 1.0499999999999998 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.8624999999999998 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138 2.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTAGTTT 10 0.0048695677 162.11269 1 ACCACCC 10 0.006991776 143.875 9 TTTTTCC 10 0.006991776 143.875 6 AAAAAAA 110 1.3988597E-4 11.771591 115-119 >>END_MODULE SRR4237579 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237579_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.862 33.0 33.0 34.0 32.0 34.0 2 33.0335 34.0 33.0 34.0 32.0 34.0 3 33.09175 34.0 33.0 34.0 33.0 34.0 4 33.1105 34.0 33.0 34.0 32.0 34.0 5 33.132 34.0 33.0 34.0 33.0 34.0 6 37.3585 38.0 38.0 38.0 37.0 38.0 7 37.30375 38.0 38.0 38.0 37.0 38.0 8 37.28875 38.0 38.0 38.0 37.0 38.0 9 37.24275 38.0 38.0 38.0 37.0 38.0 10-14 37.24315 38.0 38.0 38.0 37.0 38.0 15-19 36.981399999999994 38.0 38.0 38.0 36.0 38.0 20-24 37.1537 38.0 38.0 38.0 37.0 38.0 25-29 37.2017 38.0 38.0 38.0 37.0 38.0 30-34 37.1971 38.0 38.0 38.0 37.0 38.0 35-39 37.1704 38.0 38.0 38.0 37.0 38.0 40-44 37.071450000000006 38.0 38.0 38.0 36.8 38.0 45-49 37.09010000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.15005 38.0 38.0 38.0 37.0 38.0 55-59 36.22285 38.0 37.0 38.0 31.2 38.0 60-64 37.05885 38.0 38.0 38.0 36.8 38.0 65-69 36.99015 38.0 38.0 38.0 36.8 38.0 70-74 37.0148 38.0 38.0 38.0 36.4 38.0 75-79 37.016600000000004 38.0 38.0 38.0 36.4 38.0 80-84 37.016749999999995 38.0 38.0 38.0 36.8 38.0 85-89 36.959149999999994 38.0 38.0 38.0 36.8 38.0 90-94 36.860400000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.849599999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.8172 38.0 38.0 38.0 36.0 38.0 105-109 36.75895 38.0 38.0 38.0 35.8 38.0 110-114 36.65644999999999 38.0 38.0 38.0 35.2 38.0 115-119 36.2905 38.0 37.8 38.0 33.6 38.0 120-124 36.38215 38.0 38.0 38.0 34.6 38.0 125-129 36.404849999999996 38.0 38.0 38.0 34.8 38.0 130-134 35.8805 38.0 37.6 38.0 32.6 38.0 135-139 36.0605 38.0 38.0 38.0 34.0 38.0 140-144 35.74640000000001 38.0 38.0 38.0 33.0 38.0 145-149 35.2783 38.0 38.0 38.0 32.4 38.0 150 29.746 35.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 3.0 5 0.0 6 2.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 3.0 14 1.0 15 1.0 16 3.0 17 2.0 18 6.0 19 6.0 20 3.0 21 6.0 22 9.0 23 7.0 24 10.0 25 16.0 26 19.0 27 23.0 28 24.0 29 22.0 30 38.0 31 38.0 32 52.0 33 69.0 34 81.0 35 147.0 36 359.0 37 3046.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.85 18.475 14.524999999999999 31.15 2 26.474999999999998 25.474999999999998 32.85 15.2 3 21.425 28.275 31.025000000000002 19.275000000000002 4 23.599999999999998 33.900000000000006 25.074999999999996 17.424999999999997 5 25.825 35.55 23.65 14.975 6 20.3 38.7 24.175 16.825000000000003 7 19.400000000000002 20.95 40.575 19.075 8 21.525 24.3 29.375 24.8 9 22.0 24.65 31.275 22.075 10-14 23.53117806025423 28.710839755780203 26.699029126213592 21.058953057751978 15-19 23.714643304130163 27.574468085106385 27.914893617021274 20.795994993742177 20-24 23.646010611672843 28.346180798878766 27.370107117829612 20.63770147161878 25-29 23.089634451677515 28.11717576364547 28.392588883324986 20.40060090135203 30-34 23.39137396177324 28.349844891424 27.48423896727709 20.774542179525668 35-39 23.53765323992995 28.391293470102575 27.795846885163872 20.275206404803605 40-44 22.942118966553174 27.80392549569397 28.840376527137995 20.41357901061486 45-49 23.184049694419397 27.607454162909526 28.053301272417592 21.15519487025348 50-54 23.326653306613228 27.84569138276553 28.266533066132265 20.561122244488978 55-59 23.242295164119266 27.762465547481835 28.704585316963165 20.29065397143573 60-64 23.58684223701998 27.757472587993792 28.37330396034647 20.282381214639763 65-69 23.9191353082466 27.73218574859888 28.30264211369095 20.04603682946357 70-74 23.523819055244196 27.702161729383505 28.067453963170536 20.706565252201763 75-79 23.04458789971476 28.113896812290445 28.77445828954611 20.06705699844868 80-84 23.97376852222667 27.943532238686426 27.48798558269924 20.594713656387665 85-89 23.787112602012716 27.812546938366793 28.30320933259901 20.097131127021477 90-94 23.737474949899802 27.650300601202403 28.37675350701403 20.23547094188377 95-99 23.62216549031386 27.882064374030136 28.377634279421333 20.11813585623467 100-104 23.595 27.68 28.595 20.13 105-109 23.62736273627363 28.06280628062806 28.28282828282828 20.027002700270028 110-114 24.259851970394077 27.865573114622926 28.390678135627123 19.483896779355874 115-119 23.778077942868578 27.640202111161138 28.58071939566762 20.001000550302667 120-124 24.485 27.48 28.54 19.495 125-129 23.788325914069926 28.014805181813635 28.264892712449356 19.931976191667083 130-134 24.60361126394238 27.51463012054219 28.229880458160356 19.651878157355075 135-139 24.252425242524254 27.522752275227525 28.57285728572857 19.65196519651965 140-144 24.476295479603085 28.16979051819184 27.969329457752835 19.38458454445224 145-149 24.458126845872755 27.73189167542674 28.91325023777344 18.896731240927068 150 24.233983286908078 29.197265130412763 27.72853887060015 18.84021271207901 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 1.0 24 2.5 25 3.0 26 4.0 27 5.5 28 7.5 29 12.0 30 19.0 31 22.0 32 31.0 33 45.5 34 47.5 35 56.5 36 80.5 37 106.5 38 129.5 39 156.5 40 200.0 41 233.0 42 248.5 43 285.0 44 306.5 45 284.0 46 272.5 47 247.5 48 245.0 49 227.5 50 166.0 51 138.0 52 104.5 53 75.5 54 63.5 55 43.5 56 35.0 57 28.5 58 15.5 59 10.5 60 6.0 61 7.0 62 6.0 63 4.0 64 3.0 65 2.5 66 1.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.09 15-19 0.125 20-24 0.11 25-29 0.15 30-34 0.06999999999999999 35-39 0.075 40-44 0.13999999999999999 45-49 0.19 50-54 0.2 55-59 0.22499999999999998 60-64 0.135 65-69 0.08 70-74 0.08 75-79 0.08499999999999999 80-84 0.12 85-89 0.135 90-94 0.2 95-99 0.11499999999999999 100-104 0.0 105-109 0.01 110-114 0.02 115-119 0.055 120-124 0.0 125-129 0.034999999999999996 130-134 0.034999999999999996 135-139 0.01 140-144 0.22999999999999998 145-149 0.11499999999999999 150 1.275 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.4500000000000002 0.0 0.0 0.0 0.0 128-129 1.55 0.0 0.0 0.0 0.0 130-131 1.825 0.0 0.0 0.0 0.0 132-133 2.0250000000000004 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.4000000000000004 0.0 0.0 0.0 0.0 138 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATTG 10 0.0069881454 143.9 3 >>END_MODULE Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398992 spots for SRR4237579.sra Written 2398992 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra Read 2398988 spots for SRR4237579.sra Written 2398988 spots for SRR4237579.sra SRR ids: ['SRR4237579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hh_day3q SRR4237579.sra spots: 47979764 blocks: [[1, 2398988], [2398989, 4797976], [4797977, 7196964], [7196965, 9595952], [9595953, 11994940], [11994941, 14393928], [14393929, 16792916], [16792917, 19191904], [19191905, 21590892], [21590893, 23989880], [23989881, 26388868], [26388869, 28787856], [28787857, 31186844], [31186845, 33585832], [33585833, 35984820], [35984821, 38383808], [38383809, 40782796], [40782797, 43181784], [43181785, 45580772], [45580773, 47979764]] SRR4237579 file size 16143356 SRR4237579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237579 SRR4237579_1.fastq SRR4237579_2.fastq Input file: SRR4237579_1.fastq Paired file: SRR4237579_2.fastq trimmed: SRR4237579-trimmed-pair1.fastq, SRR4237579-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:10:45 2025 >> started Wed Feb 12 11:11:37 2025 >> done (52.618s) 47979764 read pairs processed; of these: 27141 ( 0.06%) short read pairs filtered out after trimming by size control 37648 ( 0.08%) empty read pairs filtered out after trimming by size control 47914975 (99.86%) read pairs available; of these: 12926819 (26.98%) trimmed read pairs available after processing 34988156 (73.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 7 0.00% 21 2 0.00% 22 6 0.00% 23 3 0.00% 24 6 0.00% 25 7 0.00% 26 8 0.00% 27 11 0.00% 28 14 0.00% 29 16 0.00% 30 22 0.00% 31 16 0.00% 32 22 0.00% 33 19 0.00% 34 16 0.00% 35 13 0.00% 36 20 0.00% 37 32 0.00% 38 28 0.00% 39 35 0.00% 40 40 0.00% 41 36 0.00% 42 29 0.00% 43 31 0.00% 44 48 0.00% 45 46 0.00% 46 60 0.00% 47 49 0.00% 48 73 0.00% 49 67 0.00% 50 74 0.00% 51 80 0.00% 52 114 0.00% 53 112 0.00% 54 129 0.00% 55 151 0.00% 56 159 0.00% 57 182 0.00% 58 162 0.00% 59 215 0.00% 60 234 0.00% 61 252 0.00% 62 285 0.00% 63 309 0.00% 64 331 0.00% 65 398 0.00% 66 464 0.00% 67 618 0.00% 68 681 0.00% 69 1106 0.00% 70 1353 0.00% 71 815 0.00% 72 819 0.00% 73 856 0.00% 74 965 0.00% 75 1109 0.00% 76 1203 0.00% 77 1331 0.00% 78 1408 0.00% 79 1664 0.00% 80 1798 0.00% 81 1986 0.00% 82 2435 0.01% 83 2890 0.01% 84 4664 0.01% 85 4851 0.01% 86 5448 0.01% 87 5858 0.01% 88 6511 0.01% 89 6918 0.01% 90 7264 0.02% 91 8194 0.02% 92 10295 0.02% 93 9261 0.02% 94 9566 0.02% 95 10819 0.02% 96 12031 0.03% 97 12343 0.03% 98 13238 0.03% 99 13773 0.03% 100 14777 0.03% 101 15727 0.03% 102 16886 0.04% 103 18005 0.04% 104 19339 0.04% 105 20836 0.04% 106 22624 0.05% 107 23644 0.05% 108 25314 0.05% 109 26310 0.05% 110 27896 0.06% 111 29353 0.06% 112 31300 0.07% 113 33249 0.07% 114 35078 0.07% 115 37432 0.08% 116 39689 0.08% 117 43046 0.09% 118 44317 0.09% 119 46316 0.10% 120 48017 0.10% 121 50969 0.11% 122 52688 0.11% 123 55350 0.12% 124 58348 0.12% 125 61621 0.13% 126 65046 0.14% 127 68362 0.14% 128 71804 0.15% 129 75534 0.16% 130 79692 0.17% 131 83158 0.17% 132 87093 0.18% 133 92518 0.19% 134 97149 0.20% 135 103335 0.22% 136 110736 0.23% 137 118057 0.25% 138 127586 0.27% 139 139389 0.29% 140 150885 0.31% 141 165953 0.35% 142 185158 0.39% 143 211220 0.44% 144 256631 0.54% 145 329640 0.69% 146 385297 0.80% 147 614348 1.28% 148 1122052 2.34% 149 7119532 14.86% 150 34988156 73.02% 47914975 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=32 prefix-density=0.20 prefix-fanout=2.6 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=279.61 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=21.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=37 prefix-density=0.15 prefix-fanout=2.4 sequence=CTTGCCACCAAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=223.81 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=25.2 sequence=GAAGAAGAAGAAA SRR4237579 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:13:17 Started mapping on | Feb 12 11:13:18 Finished on | Feb 12 11:16:57 Mapping speed, Million of reads per hour | 787.64 Number of input reads | 47914975 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 46476049 Uniquely mapped reads % | 97.00% Average mapped length | 295.86 Number of splices: Total | 40297804 Number of splices: Annotated (sjdb) | 39548013 Number of splices: GT/AG | 39695341 Number of splices: GC/AG | 467663 Number of splices: AT/AC | 38370 Number of splices: Non-canonical | 96430 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 887580 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 91270 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 578132 578132 578132 N_multimapping 887580 887580 887580 N_noFeature 1325098 45884527 1589702 N_ambiguous 536790 3167 207858 UnstrandedReadsAssigned:44614161 PositiveStrandReadsAssigned:588355 NegativeStrandReadsAssigned:44678489 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237579 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237579-trimmed-pair1.fastq SRR4237579-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,914,975 reads, 44,401,052 reads pseudoaligned [quant] estimated average fragment length: 254.165 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52401 SRR4237579.ke.tsv 34699 SRR4237579.se.tsv 87100 total ==> SRR4237579.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.83 830 9.64784 Potri.005G024800.1.v4.1 1035 781.835 139 3.64717 Potri.004G059700.1.v4.1 961 707.857 4 0.115923 Potri.007G009000.2.v4.1 1416 1162.83 0 0 Potri.003G141000.2.v4.1 2943 2689.83 687.037 5.23975 Potri.016G087400.1.v4.1 270 69.0991 5670.2 1683.38 Potri.015G069301.1.v4.1 564 315.71 0 0 Potri.010G195200.1.v4.1 1773 1519.83 175.782 2.37265 Potri.012G127500.1.v4.1 977 723.846 15527 440.045 ==> SRR4237579.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8215 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 756 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 45 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 41 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237579 completed mapping pipeline successfully