Starting /dee2/code/volunteer_pipeline.sh SRR4237580 current disk space = 3051299643392 free memory = 1581429628 SRR4237580 SRAfilesize 473221c068ee0ba65cd604d2f4ab431a SRR4237580.sra SRR4237580.sra file validated SRR4237580 is paired end SRR4237580 is conventional basespace SRR4237580 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237580_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.21475 34.0 33.0 34.0 18.0 34.0 2 32.63775 34.0 33.0 34.0 28.0 34.0 3 32.814 34.0 33.0 34.0 31.0 34.0 4 33.112 34.0 33.0 34.0 32.0 34.0 5 33.15225 34.0 33.0 34.0 32.0 34.0 6 36.894 38.0 37.0 38.0 35.0 38.0 7 37.25325 38.0 38.0 38.0 36.0 38.0 8 37.3045 38.0 38.0 38.0 37.0 38.0 9 37.33325 38.0 38.0 38.0 37.0 38.0 10-14 37.4134 38.0 38.0 38.0 37.0 38.0 15-19 37.3913 38.0 38.0 38.0 37.0 38.0 20-24 36.593399999999995 38.0 37.0 38.0 32.2 38.0 25-29 35.51825 38.0 36.2 38.0 28.0 38.0 30-34 36.99365 38.0 38.0 38.0 35.6 38.0 35-39 37.174099999999996 38.0 38.0 38.0 36.6 38.0 40-44 37.172399999999996 38.0 38.0 38.0 36.4 38.0 45-49 37.22695 38.0 38.0 38.0 36.6 38.0 50-54 37.18910000000001 38.0 38.0 38.0 36.6 38.0 55-59 37.173199999999994 38.0 38.0 38.0 36.2 38.0 60-64 37.1378 38.0 38.0 38.0 36.0 38.0 65-69 37.10185 38.0 38.0 38.0 36.0 38.0 70-74 35.538 38.0 35.4 38.0 29.8 38.0 75-79 36.27885 38.0 37.4 38.0 32.4 38.0 80-84 36.9002 38.0 38.0 38.0 35.6 38.0 85-89 36.97265 38.0 38.0 38.0 36.0 38.0 90-94 36.92485 38.0 38.0 38.0 35.8 38.0 95-99 36.816449999999996 38.0 38.0 38.0 35.4 38.0 100-104 36.76129999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.714 38.0 38.0 38.0 35.0 38.0 110-114 36.7059 38.0 38.0 38.0 34.6 38.0 115-119 36.52755 38.0 38.0 38.0 34.0 38.0 120-124 36.4693 38.0 38.0 38.0 34.0 38.0 125-129 35.455349999999996 38.0 36.6 38.0 28.6 38.0 130-134 34.7965 38.0 34.6 38.0 27.2 38.0 135-139 35.526149999999994 38.0 36.6 38.0 30.2 38.0 140-144 35.273700000000005 38.0 35.8 38.0 29.8 38.0 145-149 35.310700000000004 38.0 36.0 38.0 31.8 38.0 150 29.98275 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 1.0 19 2.0 20 3.0 21 3.0 22 4.0 23 9.0 24 6.0 25 11.0 26 15.0 27 17.0 28 31.0 29 30.0 30 40.0 31 58.0 32 80.0 33 102.0 34 156.0 35 270.0 36 658.0 37 2497.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.618772364437106 12.33140655105973 8.31268923754473 34.737131846958434 2 25.025 14.149999999999999 33.85 26.974999999999998 3 20.424999999999997 20.599999999999998 25.35 33.625 4 22.975 28.475 22.925 25.624999999999996 5 22.925 31.65 24.25 21.175 6 18.05 36.199999999999996 23.7 22.05 7 13.475000000000001 26.174999999999997 43.15 17.2 8 17.025000000000002 25.2 31.7 26.075 9 16.0 25.900000000000002 33.875 24.224999999999998 10-14 19.48 30.245 27.66 22.615 15-19 19.275000000000002 29.439999999999998 27.92 23.365 20-24 19.869999999999997 29.185 27.400000000000002 23.544999999999998 25-29 19.86 29.225 27.750000000000004 23.165 30-34 19.744999999999997 29.5 27.474999999999998 23.28 35-39 19.56 29.395 27.32 23.724999999999998 40-44 19.235 29.275000000000002 27.88 23.61 45-49 19.79 29.49 27.275 23.445 50-54 20.044999999999998 29.575000000000003 26.86 23.52 55-59 19.945 29.315 27.205000000000002 23.535 60-64 19.29 29.439999999999998 27.355 23.915 65-69 19.445 29.26 27.860000000000003 23.435 70-74 20.385 29.104999999999997 26.884999999999998 23.625 75-79 20.1 29.15 27.105 23.645 80-84 19.830000000000002 29.255 27.42 23.494999999999997 85-89 19.975 29.165000000000003 27.794999999999998 23.064999999999998 90-94 20.14 28.754999999999995 26.905 24.2 95-99 19.555 28.835 27.595 24.015 100-104 19.805 28.999999999999996 27.515 23.68 105-109 20.07 28.42 27.189999999999998 24.32 110-114 19.98 28.605000000000004 27.825 23.59 115-119 20.14 28.599999999999998 27.26 24.0 120-124 19.645000000000003 28.384999999999998 28.015 23.955000000000002 125-129 20.39 28.415000000000003 27.165 24.03 130-134 20.150000000000002 28.799999999999997 26.96 24.09 135-139 20.195 29.235 26.855 23.715 140-144 20.34 28.475 27.685 23.5 145-149 20.1 28.754999999999995 26.889999999999997 24.255 150 19.55 28.625 27.625 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 5.0 26 6.0 27 7.5 28 16.0 29 21.0 30 25.0 31 31.0 32 39.0 33 52.5 34 67.0 35 80.5 36 95.0 37 111.5 38 136.0 39 176.0 40 199.0 41 204.0 42 246.0 43 287.0 44 284.5 45 270.5 46 248.0 47 232.0 48 208.5 49 185.5 50 159.5 51 124.5 52 114.0 53 92.0 54 62.5 55 57.0 56 44.5 57 29.5 58 22.0 59 12.5 60 10.5 61 8.0 62 6.5 63 6.0 64 4.5 65 3.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.65 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.1 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.8375000000000004 0.0 0.0 0.025 0.0 138 4.125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 10 0.0055150697 155.59459 1 >>END_MODULE SRR4237580 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237580_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67075 33.0 33.0 34.0 32.0 34.0 2 32.72975 33.0 33.0 34.0 32.0 34.0 3 32.8035 34.0 33.0 34.0 32.0 34.0 4 32.74225 33.0 33.0 34.0 32.0 34.0 5 32.74625 34.0 33.0 34.0 32.0 34.0 6 34.3585 38.0 35.0 38.0 16.0 38.0 7 36.125 38.0 37.0 38.0 31.0 38.0 8 36.48025 38.0 38.0 38.0 34.0 38.0 9 36.2405 38.0 38.0 38.0 33.0 38.0 10-14 36.736599999999996 38.0 38.0 38.0 35.8 38.0 15-19 35.58565 38.0 35.6 38.0 29.8 38.0 20-24 36.558949999999996 38.0 38.0 38.0 34.6 38.0 25-29 36.7265 38.0 38.0 38.0 35.2 38.0 30-34 36.68845 38.0 38.0 38.0 35.4 38.0 35-39 36.0179 38.0 37.2 38.0 30.2 38.0 40-44 36.73799999999999 38.0 38.0 38.0 35.8 38.0 45-49 36.613 38.0 38.0 38.0 35.0 38.0 50-54 36.7252 38.0 38.0 38.0 35.4 38.0 55-59 36.7324 38.0 38.0 38.0 35.6 38.0 60-64 36.7082 38.0 38.0 38.0 35.4 38.0 65-69 36.643 38.0 38.0 38.0 35.2 38.0 70-74 36.6092 38.0 38.0 38.0 35.0 38.0 75-79 35.858850000000004 38.0 37.2 38.0 29.8 38.0 80-84 36.362 38.0 38.0 38.0 34.2 38.0 85-89 36.3481 38.0 38.0 38.0 34.0 38.0 90-94 35.291399999999996 37.8 35.6 38.0 30.2 38.0 95-99 35.663050000000005 38.0 37.0 38.0 31.4 38.0 100-104 36.0909 38.0 38.0 38.0 33.4 38.0 105-109 35.9255 38.0 38.0 38.0 33.0 38.0 110-114 35.9827 38.0 38.0 38.0 33.8 38.0 115-119 35.8845 38.0 38.0 38.0 32.8 38.0 120-124 35.696099999999994 38.0 37.6 38.0 32.6 38.0 125-129 35.54135 38.0 37.4 38.0 31.0 38.0 130-134 35.26275 38.0 36.8 38.0 31.0 38.0 135-139 35.1261 38.0 36.2 38.0 29.8 38.0 140-144 34.75725 38.0 36.0 38.0 28.4 38.0 145-149 34.09715 38.0 36.0 38.0 24.6 38.0 150 27.5635 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 2.0 5 5.0 6 1.0 7 0.0 8 1.0 9 1.0 10 2.0 11 3.0 12 1.0 13 5.0 14 2.0 15 5.0 16 4.0 17 3.0 18 7.0 19 4.0 20 4.0 21 6.0 22 11.0 23 11.0 24 16.0 25 16.0 26 21.0 27 31.0 28 42.0 29 48.0 30 53.0 31 70.0 32 57.0 33 113.0 34 154.0 35 242.0 36 520.0 37 2525.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.05 21.6 12.325 23.025000000000002 2 28.7 24.75 30.15 16.400000000000002 3 20.849999999999998 28.975 32.35 17.825 4 24.95 34.5 23.775 16.775000000000002 5 25.6 35.775 23.0 15.625 6 20.8 38.475 24.224999999999998 16.5 7 20.9 21.55 39.75 17.8 8 21.3 25.650000000000002 29.325000000000003 23.724999999999998 9 23.375 25.525 28.95 22.15 10-14 23.765 28.904999999999998 26.52 20.810000000000002 15-19 24.0 27.700000000000003 27.345000000000002 20.955 20-24 23.385 28.544999999999998 27.810000000000002 20.26 25-29 23.45 27.884999999999998 28.315 20.349999999999998 30-34 23.119999999999997 27.985 28.360000000000003 20.535 35-39 23.52 29.005 27.145000000000003 20.330000000000002 40-44 23.41 27.839999999999996 28.26 20.49 45-49 23.48 28.17 28.435 19.915 50-54 23.375 27.97 28.22 20.435 55-59 23.705000000000002 27.615000000000002 28.435 20.244999999999997 60-64 23.435 28.110000000000003 28.494999999999997 19.96 65-69 23.535 27.765 28.854999999999997 19.845 70-74 23.76 27.66 28.09 20.49 75-79 23.21 27.939999999999998 28.78 20.07 80-84 23.47 27.32 28.860000000000003 20.349999999999998 85-89 23.855 27.744999999999997 28.455000000000002 19.945 90-94 23.815 27.685 28.58 19.919999999999998 95-99 24.08 27.87 27.83 20.22 100-104 23.68 27.79 28.610000000000003 19.919999999999998 105-109 23.580000000000002 27.57 28.475 20.375 110-114 24.065 27.665 28.29 19.98 115-119 24.05 27.63 28.384999999999998 19.935 120-124 23.735 27.505000000000003 28.53 20.23 125-129 24.39 27.735 28.360000000000003 19.515 130-134 24.349999999999998 28.194999999999997 27.68 19.775000000000002 135-139 23.76 27.13 28.785 20.325 140-144 23.905 28.03 28.325 19.74 145-149 24.82 27.265 27.85 20.064999999999998 150 25.900000000000002 26.55 27.625 19.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 2.5 25 2.0 26 3.0 27 5.5 28 8.0 29 11.5 30 16.0 31 21.0 32 32.0 33 38.5 34 48.5 35 68.0 36 76.0 37 101.5 38 129.5 39 144.5 40 202.0 41 249.0 42 261.0 43 288.0 44 303.0 45 290.0 46 290.0 47 265.5 48 220.5 49 199.0 50 166.0 51 132.0 52 110.0 53 86.0 54 61.0 55 43.0 56 31.0 57 25.5 58 19.0 59 10.5 60 7.5 61 6.5 62 4.5 63 4.0 64 2.5 65 1.5 66 1.0 67 1.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAGTT 10 0.006973645 144.0 9 >>END_MODULE Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra Read 2832776 spots for SRR4237580.sra Written 2832776 spots for SRR4237580.sra SRR ids: ['SRR4237580.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zwp9ok3_ SRR4237580.sra spots: 56655520 blocks: [[1, 2832776], [2832777, 5665552], [5665553, 8498328], [8498329, 11331104], [11331105, 14163880], [14163881, 16996656], [16996657, 19829432], [19829433, 22662208], [22662209, 25494984], [25494985, 28327760], [28327761, 31160536], [31160537, 33993312], [33993313, 36826088], [36826089, 39658864], [39658865, 42491640], [42491641, 45324416], [45324417, 48157192], [48157193, 50989968], [50989969, 53822744], [53822745, 56655520]] SRR4237580 file size 19066341 SRR4237580 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237580 SRR4237580_1.fastq SRR4237580_2.fastq Input file: SRR4237580_1.fastq Paired file: SRR4237580_2.fastq trimmed: SRR4237580-trimmed-pair1.fastq, SRR4237580-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:45:49 2025 >> started Wed Feb 12 11:46:47 2025 >> done (58.090s) 56655520 read pairs processed; of these: 49813 ( 0.09%) short read pairs filtered out after trimming by size control 35375 ( 0.06%) empty read pairs filtered out after trimming by size control 56570332 (99.85%) read pairs available; of these: 17919313 (31.68%) trimmed read pairs available after processing 38651019 (68.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 15 0.00% 21 9 0.00% 22 17 0.00% 23 17 0.00% 24 14 0.00% 25 7 0.00% 26 11 0.00% 27 20 0.00% 28 20 0.00% 29 12 0.00% 30 17 0.00% 31 27 0.00% 32 23 0.00% 33 15 0.00% 34 22 0.00% 35 31 0.00% 36 22 0.00% 37 27 0.00% 38 44 0.00% 39 42 0.00% 40 43 0.00% 41 62 0.00% 42 52 0.00% 43 55 0.00% 44 59 0.00% 45 65 0.00% 46 92 0.00% 47 88 0.00% 48 98 0.00% 49 89 0.00% 50 125 0.00% 51 135 0.00% 52 137 0.00% 53 151 0.00% 54 163 0.00% 55 176 0.00% 56 195 0.00% 57 232 0.00% 58 250 0.00% 59 275 0.00% 60 336 0.00% 61 350 0.00% 62 386 0.00% 63 441 0.00% 64 482 0.00% 65 532 0.00% 66 613 0.00% 67 687 0.00% 68 874 0.00% 69 1700 0.00% 70 1583 0.00% 71 1219 0.00% 72 1357 0.00% 73 1452 0.00% 74 1585 0.00% 75 1826 0.00% 76 2060 0.00% 77 2172 0.00% 78 2580 0.00% 79 2747 0.00% 80 3288 0.01% 81 3661 0.01% 82 4203 0.01% 83 5152 0.01% 84 9155 0.02% 85 9793 0.02% 86 10251 0.02% 87 11027 0.02% 88 11793 0.02% 89 12246 0.02% 90 13287 0.02% 91 14212 0.03% 92 15293 0.03% 93 16424 0.03% 94 18069 0.03% 95 19272 0.03% 96 20914 0.04% 97 22478 0.04% 98 23738 0.04% 99 25311 0.04% 100 26816 0.05% 101 28546 0.05% 102 31046 0.05% 103 33316 0.06% 104 35316 0.06% 105 37831 0.07% 106 40276 0.07% 107 42757 0.08% 108 44858 0.08% 109 47706 0.08% 110 49871 0.09% 111 53037 0.09% 112 56211 0.10% 113 59433 0.11% 114 62533 0.11% 115 66588 0.12% 116 69851 0.12% 117 72908 0.13% 118 76856 0.14% 119 78930 0.14% 120 82234 0.15% 121 86498 0.15% 122 89545 0.16% 123 94018 0.17% 124 99027 0.18% 125 103774 0.18% 126 108494 0.19% 127 113059 0.20% 128 118844 0.21% 129 124334 0.22% 130 130372 0.23% 131 135090 0.24% 132 141978 0.25% 133 148231 0.26% 134 155692 0.28% 135 164336 0.29% 136 174678 0.31% 137 184270 0.33% 138 197649 0.35% 139 211901 0.37% 140 229296 0.41% 141 249035 0.44% 142 272039 0.48% 143 305089 0.54% 144 352450 0.62% 145 425961 0.75% 146 546231 0.97% 147 783299 1.38% 148 1491175 2.64% 149 9288509 16.42% 150 38651019 68.32% 56570332 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.46 fanout-score-rank=25 prefix-density=0.17 prefix-fanout=3.9 sequence=GTTGCATCCTGGTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=145.54 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=23.6 sequence=CATCATCATCACC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=37.57 fanout-score-rank=8 prefix-density=0.40 prefix-fanout=12.0 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=316.29 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=32.9 sequence=AAGAAGAAGAAA SRR4237580 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:47:30 Started mapping on | Feb 12 11:47:30 Finished on | Feb 12 11:51:44 Mapping speed, Million of reads per hour | 801.78 Number of input reads | 56570332 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 54530130 Uniquely mapped reads % | 96.39% Average mapped length | 294.48 Number of splices: Total | 47782178 Number of splices: Annotated (sjdb) | 46765228 Number of splices: GT/AG | 46999106 Number of splices: GC/AG | 609706 Number of splices: AT/AC | 48756 Number of splices: Non-canonical | 124610 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1143786 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 141229 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.27% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 956273 956273 956273 N_multimapping 1143786 1143786 1143786 N_noFeature 1905874 53709933 2303532 N_ambiguous 691313 4369 265925 UnstrandedReadsAssigned:51932943 PositiveStrandReadsAssigned:815828 NegativeStrandReadsAssigned:51960673 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237580 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237580-trimmed-pair1.fastq SRR4237580-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,570,332 reads, 51,810,761 reads pseudoaligned [quant] estimated average fragment length: 243.446 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,271 rounds 52401 SRR4237580.ke.tsv 34699 SRR4237580.se.tsv 87100 total ==> SRR4237580.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.55 2164 22.1094 Potri.005G024800.1.v4.1 1035 792.554 244 5.58489 Potri.004G059700.1.v4.1 961 718.566 53 1.33802 Potri.007G009000.2.v4.1 1416 1173.55 0 0 Potri.003G141000.2.v4.1 2943 2700.55 749.28 5.03321 Potri.016G087400.1.v4.1 270 75.4001 5407.98 1301.12 Potri.015G069301.1.v4.1 564 325.473 0 0 Potri.010G195200.1.v4.1 1773 1530.55 332 3.93499 Potri.012G127500.1.v4.1 977 734.566 16023 395.701 ==> SRR4237580.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14688 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 1242 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 93 SRR4237580 completed mapping pipeline successfully