Starting /dee2/code/volunteer_pipeline.sh SRR4237581 current disk space = 3051179585536 free memory = 1579829512 SRR4237581 SRAfilesize 2912cbb9385e839ced65f6c62b8b4d32 SRR4237581.sra SRR4237581.sra file validated SRR4237581 is paired end SRR4237581 is conventional basespace SRR4237581 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237581_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.40475 34.0 33.0 34.0 33.0 34.0 2 33.326 34.0 33.0 34.0 33.0 34.0 3 33.42675 34.0 34.0 34.0 33.0 34.0 4 33.38225 34.0 34.0 34.0 33.0 34.0 5 32.90425 34.0 33.0 34.0 33.0 34.0 6 36.889 38.0 37.0 38.0 35.0 38.0 7 37.25825 38.0 38.0 38.0 36.0 38.0 8 37.4275 38.0 38.0 38.0 37.0 38.0 9 37.51825 38.0 38.0 38.0 38.0 38.0 10-14 37.503 38.0 38.0 38.0 37.8 38.0 15-19 37.5224 38.0 38.0 38.0 37.8 38.0 20-24 37.4565 38.0 38.0 38.0 37.4 38.0 25-29 37.4283 38.0 38.0 38.0 37.4 38.0 30-34 37.3106 38.0 38.0 38.0 36.8 38.0 35-39 37.3577 38.0 38.0 38.0 37.0 38.0 40-44 37.258449999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.25505 38.0 38.0 38.0 37.0 38.0 50-54 37.1724 38.0 38.0 38.0 36.4 38.0 55-59 37.0713 38.0 38.0 38.0 36.0 38.0 60-64 37.0372 38.0 38.0 38.0 36.0 38.0 65-69 36.324749999999995 38.0 37.2 38.0 30.8 38.0 70-74 36.82365 38.0 38.0 38.0 35.2 38.0 75-79 36.8714 38.0 38.0 38.0 35.4 38.0 80-84 36.8418 38.0 38.0 38.0 35.4 38.0 85-89 36.644349999999996 38.0 38.0 38.0 34.4 38.0 90-94 36.81 38.0 38.0 38.0 35.0 38.0 95-99 36.72085 38.0 38.0 38.0 34.8 38.0 100-104 35.2608 38.0 36.0 38.0 26.0 38.0 105-109 36.14865 38.0 37.2 38.0 32.6 38.0 110-114 36.41485 38.0 38.0 38.0 33.8 38.0 115-119 36.3871 38.0 38.0 38.0 34.0 38.0 120-124 36.3744 38.0 38.0 38.0 34.0 38.0 125-129 35.552 38.0 36.6 38.0 30.0 38.0 130-134 35.805 38.0 36.8 38.0 32.0 38.0 135-139 35.63205000000001 38.0 36.2 38.0 31.4 38.0 140-144 35.45985 38.0 36.0 38.0 31.4 38.0 145-149 34.585249999999995 38.0 35.6 38.0 27.0 38.0 150 29.21625 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 1.0 19 2.0 20 5.0 21 7.0 22 4.0 23 6.0 24 5.0 25 15.0 26 13.0 27 16.0 28 31.0 29 30.0 30 39.0 31 56.0 32 83.0 33 90.0 34 145.0 35 243.0 36 570.0 37 2637.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.425000000000004 12.25 8.799999999999999 35.525 2 23.12703583061889 15.259333500375845 34.878476572287646 26.73515409671762 3 20.125 21.475 26.700000000000003 31.7 4 24.875 28.15 23.125 23.849999999999998 5 21.818643637287273 34.213868427736855 23.444246888493776 20.523241046482095 6 18.0 35.8 24.8 21.4 7 14.799999999999999 26.125 40.8 18.275 8 17.424999999999997 24.825 33.074999999999996 24.675 9 16.950000000000003 23.35 35.375 24.325 10-14 19.67 30.65 26.619999999999997 23.06 15-19 19.91 28.225 27.860000000000003 24.005000000000003 20-24 19.755 28.77 27.815 23.66 25-29 19.595000000000002 28.785 27.950000000000003 23.669999999999998 30-34 19.99 28.82 27.725 23.465 35-39 19.689999999999998 28.299999999999997 27.445000000000004 24.565 40-44 20.724999999999998 28.775000000000002 27.04 23.46 45-49 20.244999999999997 28.599999999999998 27.24 23.915 50-54 20.16 28.95 27.084999999999997 23.805 55-59 20.285 28.74 27.700000000000003 23.275000000000002 60-64 19.705000000000002 29.03 27.63 23.635 65-69 19.85 29.404999999999998 26.974999999999998 23.77 70-74 20.225 28.549999999999997 27.694999999999997 23.53 75-79 19.975 28.854999999999997 27.250000000000004 23.919999999999998 80-84 19.945 28.775000000000002 27.16 24.12 85-89 20.11 29.115000000000002 27.11 23.665 90-94 20.0 28.27 27.575 24.154999999999998 95-99 19.950000000000003 29.18 27.51 23.36 100-104 20.69 27.99 27.775 23.544999999999998 105-109 19.99 28.965000000000003 27.125 23.919999999999998 110-114 20.175 28.725 27.400000000000002 23.7 115-119 20.735 28.275 27.26 23.73 120-124 20.43 28.799999999999997 27.52 23.25 125-129 20.369999999999997 28.599999999999998 27.61 23.419999999999998 130-134 20.544999999999998 28.13 27.575 23.75 135-139 20.419999999999998 28.49 27.139999999999997 23.95 140-144 20.3 28.215 27.97 23.515 145-149 20.580000000000002 28.475 26.955000000000002 23.990000000000002 150 20.30075187969925 28.496240601503757 27.04260651629073 24.160401002506266 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 1.5 24 3.0 25 3.0 26 5.0 27 7.5 28 13.5 29 19.0 30 22.0 31 29.5 32 35.0 33 41.0 34 60.5 35 75.0 36 83.5 37 104.0 38 119.0 39 156.5 40 187.0 41 206.0 42 235.0 43 246.0 44 259.5 45 283.5 46 283.0 47 264.5 48 238.0 49 201.5 50 175.5 51 156.0 52 121.0 53 83.5 54 69.5 55 51.5 56 34.5 57 31.5 58 28.5 59 20.0 60 11.5 61 5.0 62 4.0 63 4.0 64 4.0 65 3.5 66 1.0 67 1.5 68 2.5 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 1.575 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.0750000000000002 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3875 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.5875000000000004 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138 3.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCACA 10 0.0064706737 147.60255 2 >>END_MODULE SRR4237581 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237581_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.817 33.0 33.0 34.0 32.0 34.0 2 32.99475 34.0 33.0 34.0 32.0 34.0 3 32.956 34.0 33.0 34.0 32.0 34.0 4 32.9845 34.0 33.0 34.0 32.0 34.0 5 32.863 34.0 33.0 34.0 32.0 34.0 6 37.05825 38.0 38.0 38.0 36.0 38.0 7 37.06925 38.0 38.0 38.0 37.0 38.0 8 36.98825 38.0 38.0 38.0 36.0 38.0 9 36.8675 38.0 38.0 38.0 36.0 38.0 10-14 36.8113 38.0 38.0 38.0 36.0 38.0 15-19 36.9673 38.0 38.0 38.0 36.2 38.0 20-24 36.58575 38.0 37.8 38.0 34.2 38.0 25-29 35.187650000000005 37.8 34.8 38.0 26.6 38.0 30-34 36.78805 38.0 37.8 38.0 35.8 38.0 35-39 36.30875 38.0 37.6 38.0 32.0 38.0 40-44 36.69295 38.0 37.8 38.0 34.4 38.0 45-49 36.7224 38.0 38.0 38.0 35.6 38.0 50-54 36.802800000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.84929999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.330949999999994 38.0 37.6 38.0 33.6 38.0 65-69 35.942150000000005 38.0 37.4 38.0 31.4 38.0 70-74 36.2654 38.0 37.8 38.0 33.4 38.0 75-79 35.6434 38.0 36.0 38.0 30.0 38.0 80-84 36.6323 38.0 38.0 38.0 35.6 38.0 85-89 36.084 38.0 37.4 38.0 32.4 38.0 90-94 36.491699999999994 38.0 38.0 38.0 34.8 38.0 95-99 36.48465 38.0 38.0 38.0 34.8 38.0 100-104 36.4262 38.0 38.0 38.0 34.6 38.0 105-109 35.084649999999996 38.0 35.6 38.0 28.4 38.0 110-114 36.24470000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.0741 38.0 38.0 38.0 33.8 38.0 120-124 36.06415 38.0 38.0 38.0 33.8 38.0 125-129 36.00115 38.0 38.0 38.0 33.8 38.0 130-134 35.87735 38.0 38.0 38.0 33.2 38.0 135-139 35.5777 38.0 37.6 38.0 32.6 38.0 140-144 35.30575 38.0 36.6 38.0 31.4 38.0 145-149 34.96665 38.0 36.2 38.0 31.2 38.0 150 29.30625 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 1.0 5 2.0 6 0.0 7 3.0 8 2.0 9 0.0 10 6.0 11 3.0 12 4.0 13 1.0 14 2.0 15 4.0 16 1.0 17 4.0 18 4.0 19 5.0 20 2.0 21 4.0 22 11.0 23 13.0 24 14.0 25 21.0 26 21.0 27 22.0 28 30.0 29 34.0 30 35.0 31 64.0 32 65.0 33 99.0 34 144.0 35 232.0 36 614.0 37 2525.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.625 21.4 11.774999999999999 25.2 2 28.999999999999996 24.3 30.575000000000003 16.125 3 21.775 27.525 31.974999999999998 18.725 4 24.224999999999998 35.775 22.45 17.549999999999997 5 25.775 36.525 21.725 15.975 6 19.749687108886107 39.17396745932415 23.178973717146434 17.897371714643302 7 20.505126281570394 20.155038759689923 40.11002750687672 19.229807451862964 8 22.54190642982237 23.91793845384038 27.595696772579437 25.94445834375782 9 21.782674011016525 25.237856785177765 30.47070605908863 22.508763144717076 10-14 23.606311044327573 28.4748309541698 26.922113698973206 20.99674430252943 15-19 23.551196076468823 28.180362326093483 27.26453808427585 21.003903513161845 20-24 23.321660830415208 28.7743871935968 27.318659329664836 20.58529264632316 25-29 23.619171502901743 28.572143285971585 27.396437862717633 20.412247348409046 30-34 24.088248536695183 27.25999299614788 28.150482765521033 20.501275701635898 35-39 23.180498548403243 27.885674241665832 28.075883471819 20.857943738111924 40-44 23.686317685917327 27.619857872084875 28.100290261235113 20.59353418076269 45-49 23.52086568809178 28.114823906617904 28.084765292320025 20.279545112970293 50-54 23.51202404809619 27.975951903807616 28.14128256513026 20.370741482965933 55-59 23.868250864791698 28.049330726425026 27.79866646613526 20.283751942648017 60-64 23.40617481956696 28.733961507618282 27.75661587810746 20.103247794707297 65-69 23.078078830069614 28.29168127410227 27.941102819652425 20.68913707617569 70-74 23.484924371431433 28.08774917359511 27.83732344986477 20.590003005108684 75-79 23.812863153676616 27.349228611500703 27.960328591464634 20.877579643358043 80-84 23.389236545682103 28.065081351689614 28.07008760951189 20.475594493116393 85-89 23.578905193569387 27.7808383833325 27.941102819652425 20.699153603445687 90-94 23.57894736842105 27.087719298245617 28.591478696741856 20.741854636591476 95-99 24.10750100280786 27.9632972322503 27.672482952266346 20.25671881267549 100-104 23.329994992488736 27.926890335503256 28.187280921382076 20.555833750625936 105-109 23.792119361137537 27.53216842737696 27.72242527412006 20.95328693736544 110-114 23.73866426173656 27.837065985269803 28.333082819780554 20.091186933213088 115-119 23.93483709273183 27.834586466165412 27.74436090225564 20.48621553884712 120-124 23.785678517776667 27.1807711567351 28.5628442663996 20.470706059088634 125-129 23.812625250501 27.925851703406813 27.62024048096192 20.64128256513026 130-134 24.20251389653964 27.001852871951527 28.18368471130252 20.61194852020632 135-139 24.085029579865637 27.855209064474078 28.125940038102875 19.933821317557403 140-144 24.664825508410747 27.81822746673362 27.351242781822748 20.165704243032888 145-149 24.773171587548248 27.97132688355306 27.434959145821846 19.820542383076845 150 24.08482706387276 28.023226457965162 27.493057308760417 20.398889169401667 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.5 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.5 25 1.5 26 2.5 27 5.0 28 7.0 29 9.5 30 14.0 31 17.0 32 27.5 33 34.5 34 39.0 35 60.0 36 80.0 37 82.0 38 115.5 39 177.5 40 205.5 41 235.0 42 268.5 43 286.5 44 287.0 45 288.5 46 285.0 47 257.5 48 225.5 49 194.0 50 166.0 51 139.5 52 123.5 53 101.0 54 66.0 55 50.0 56 40.5 57 27.0 58 23.0 59 13.0 60 7.5 61 8.0 62 4.0 63 3.0 64 4.5 65 4.0 66 1.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.025 8 0.075 9 0.15 10-14 0.17500000000000002 15-19 0.09 20-24 0.05 25-29 0.06 30-34 0.055 35-39 0.11 40-44 0.09 45-49 0.19499999999999998 50-54 0.2 55-59 0.265 60-64 0.24 65-69 0.165 70-74 0.16999999999999998 75-79 0.18 80-84 0.125 85-89 0.165 90-94 0.25 95-99 0.27999999999999997 100-104 0.15 105-109 0.135 110-114 0.20500000000000002 115-119 0.25 120-124 0.15 125-129 0.2 130-134 0.155 135-139 0.27 140-144 0.42500000000000004 145-149 0.255 150 0.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.1875 0.0 0.0 0.0 0.0 118-119 1.3875 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.5374999999999996 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.2375 0.0 0.0 0.0 0.0 136-137 3.5625 0.0 0.0 0.0 0.0 138 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAACT 10 0.007002685 143.8 6 >>END_MODULE Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2449001 spots for SRR4237581.sra Written 2449001 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra Read 2448995 spots for SRR4237581.sra Written 2448995 spots for SRR4237581.sra SRR ids: ['SRR4237581.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_armlggzg SRR4237581.sra spots: 48979906 blocks: [[1, 2448995], [2448996, 4897990], [4897991, 7346985], [7346986, 9795980], [9795981, 12244975], [12244976, 14693970], [14693971, 17142965], [17142966, 19591960], [19591961, 22040955], [22040956, 24489950], [24489951, 26938945], [26938946, 29387940], [29387941, 31836935], [31836936, 34285930], [34285931, 36734925], [36734926, 39183920], [39183921, 41632915], [41632916, 44081910], [44081911, 46530905], [46530906, 48979906]] SRR4237581 file size 16480318 SRR4237581 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237581 SRR4237581_1.fastq SRR4237581_2.fastq Input file: SRR4237581_1.fastq Paired file: SRR4237581_2.fastq trimmed: SRR4237581-trimmed-pair1.fastq, SRR4237581-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:10:46 2025 >> started Wed Feb 12 11:11:37 2025 >> done (50.467s) 48979906 read pairs processed; of these: 43114 ( 0.09%) short read pairs filtered out after trimming by size control 32015 ( 0.07%) empty read pairs filtered out after trimming by size control 48904777 (99.85%) read pairs available; of these: 15413482 (31.52%) trimmed read pairs available after processing 33491295 (68.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 21 0.00% 20 14 0.00% 21 11 0.00% 22 12 0.00% 23 12 0.00% 24 14 0.00% 25 12 0.00% 26 8 0.00% 27 22 0.00% 28 18 0.00% 29 12 0.00% 30 20 0.00% 31 14 0.00% 32 19 0.00% 33 26 0.00% 34 31 0.00% 35 26 0.00% 36 33 0.00% 37 39 0.00% 38 26 0.00% 39 32 0.00% 40 50 0.00% 41 41 0.00% 42 47 0.00% 43 44 0.00% 44 56 0.00% 45 52 0.00% 46 67 0.00% 47 83 0.00% 48 74 0.00% 49 110 0.00% 50 93 0.00% 51 129 0.00% 52 146 0.00% 53 148 0.00% 54 137 0.00% 55 167 0.00% 56 192 0.00% 57 229 0.00% 58 228 0.00% 59 258 0.00% 60 318 0.00% 61 335 0.00% 62 388 0.00% 63 401 0.00% 64 446 0.00% 65 501 0.00% 66 617 0.00% 67 676 0.00% 68 909 0.00% 69 1960 0.00% 70 1691 0.00% 71 1163 0.00% 72 1162 0.00% 73 1351 0.00% 74 1486 0.00% 75 1761 0.00% 76 1880 0.00% 77 2111 0.00% 78 2369 0.00% 79 2673 0.01% 80 2993 0.01% 81 3442 0.01% 82 4019 0.01% 83 4744 0.01% 84 7173 0.01% 85 7784 0.02% 86 8746 0.02% 87 9732 0.02% 88 9975 0.02% 89 10941 0.02% 90 12532 0.03% 91 12628 0.03% 92 13407 0.03% 93 14343 0.03% 94 16176 0.03% 95 19605 0.04% 96 19526 0.04% 97 21877 0.04% 98 20177 0.04% 99 21629 0.04% 100 23410 0.05% 101 24778 0.05% 102 26853 0.05% 103 28835 0.06% 104 31017 0.06% 105 33153 0.07% 106 35101 0.07% 107 37021 0.08% 108 39389 0.08% 109 41043 0.08% 110 43307 0.09% 111 45864 0.09% 112 48402 0.10% 113 51167 0.10% 114 54513 0.11% 115 57890 0.12% 116 61288 0.13% 117 65799 0.13% 118 66276 0.14% 119 68568 0.14% 120 71018 0.15% 121 74792 0.15% 122 78097 0.16% 123 81659 0.17% 124 86103 0.18% 125 89953 0.18% 126 94685 0.19% 127 98164 0.20% 128 101642 0.21% 129 106725 0.22% 130 110852 0.23% 131 115950 0.24% 132 120955 0.25% 133 126697 0.26% 134 133647 0.27% 135 140879 0.29% 136 149069 0.30% 137 157924 0.32% 138 168083 0.34% 139 177846 0.36% 140 190829 0.39% 141 210716 0.43% 142 234105 0.48% 143 256903 0.53% 144 299564 0.61% 145 363186 0.74% 146 450513 0.92% 147 654634 1.34% 148 1416043 2.90% 149 7900149 16.15% 150 33491295 68.48% 48904777 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=38 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=128.07 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=18.5 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=262.11 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=30.5 sequence=AAGAAGAAGAAA SRR4237581 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:12:22 Started mapping on | Feb 12 11:12:22 Finished on | Feb 12 11:16:32 Mapping speed, Million of reads per hour | 704.23 Number of input reads | 48904777 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 46921084 Uniquely mapped reads % | 95.94% Average mapped length | 294.54 Number of splices: Total | 43918247 Number of splices: Annotated (sjdb) | 43223005 Number of splices: GT/AG | 43269059 Number of splices: GC/AG | 514786 Number of splices: AT/AC | 41122 Number of splices: Non-canonical | 93280 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 855046 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 46296 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1172605 1172605 1172605 N_multimapping 855046 855046 855046 N_noFeature 1112453 46361912 1414173 N_ambiguous 461438 2896 201868 UnstrandedReadsAssigned:45347193 PositiveStrandReadsAssigned:556276 NegativeStrandReadsAssigned:45305043 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237581 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237581-trimmed-pair1.fastq SRR4237581-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,904,777 reads, 44,953,732 reads pseudoaligned [quant] estimated average fragment length: 250.423 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,303 rounds 52401 SRR4237581.ke.tsv 34699 SRR4237581.se.tsv 87100 total ==> SRR4237581.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.58 1095 13.7497 Potri.005G024800.1.v4.1 1035 785.577 157 4.43827 Potri.004G059700.1.v4.1 961 711.666 22 0.686514 Potri.007G009000.2.v4.1 1416 1166.58 0 0 Potri.003G141000.2.v4.1 2943 2693.58 745.126 6.14331 Potri.016G087400.1.v4.1 270 76.7317 4317.57 1249.59 Potri.015G069301.1.v4.1 564 320.985 0 0 Potri.010G195200.1.v4.1 1773 1523.58 147 2.14267 Potri.012G127500.1.v4.1 977 727.617 20996 640.821 ==> SRR4237581.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5320 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 635 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 34 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR4237581 completed mapping pipeline successfully