Starting /dee2/code/volunteer_pipeline.sh SRR4237582 current disk space = 3051381280768 free memory = 1578493600 SRR4237582 SRAfilesize ad4388af4f89564c70ca6379e820868b SRR4237582.sra SRR4237582.sra file validated SRR4237582 is paired end SRR4237582 is conventional basespace SRR4237582 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237582_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.38875 34.0 33.0 34.0 33.0 34.0 2 33.457 34.0 34.0 34.0 33.0 34.0 3 33.453 34.0 34.0 34.0 33.0 34.0 4 33.42725 34.0 34.0 34.0 33.0 34.0 5 33.44925 34.0 34.0 34.0 33.0 34.0 6 36.224 38.0 37.0 38.0 35.0 38.0 7 37.20475 38.0 38.0 38.0 36.0 38.0 8 37.326 38.0 38.0 38.0 37.0 38.0 9 37.477 38.0 38.0 38.0 37.0 38.0 10-14 37.515600000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.5378 38.0 38.0 38.0 38.0 38.0 20-24 37.5038 38.0 38.0 38.0 38.0 38.0 25-29 37.5346 38.0 38.0 38.0 38.0 38.0 30-34 36.68725 38.0 38.0 38.0 34.2 38.0 35-39 37.4335 38.0 38.0 38.0 37.4 38.0 40-44 37.4129 38.0 38.0 38.0 37.4 38.0 45-49 37.192150000000005 38.0 38.0 38.0 36.4 38.0 50-54 37.25300000000001 38.0 38.0 38.0 36.8 38.0 55-59 37.285900000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.33315 38.0 38.0 38.0 37.0 38.0 65-69 37.280199999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.244899999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.183949999999996 38.0 38.0 38.0 36.8 38.0 80-84 37.14585 38.0 38.0 38.0 36.8 38.0 85-89 37.0329 38.0 38.0 38.0 36.4 38.0 90-94 35.737100000000005 38.0 35.6 38.0 30.2 38.0 95-99 36.546949999999995 38.0 37.6 38.0 34.4 38.0 100-104 36.99985 38.0 38.0 38.0 36.0 38.0 105-109 37.0184 38.0 38.0 38.0 36.0 38.0 110-114 36.8908 38.0 38.0 38.0 35.8 38.0 115-119 36.814949999999996 38.0 38.0 38.0 35.4 38.0 120-124 36.73605 38.0 38.0 38.0 35.0 38.0 125-129 36.5715 38.0 38.0 38.0 34.8 38.0 130-134 36.5131 38.0 38.0 38.0 35.0 38.0 135-139 34.7467 38.0 34.6 38.0 27.8 38.0 140-144 36.11285 38.0 37.8 38.0 33.8 38.0 145-149 36.00260000000001 38.0 38.0 38.0 34.2 38.0 150 31.45525 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 4.0 17 3.0 18 2.0 19 2.0 20 0.0 21 2.0 22 5.0 23 4.0 24 6.0 25 7.0 26 7.0 27 14.0 28 15.0 29 30.0 30 31.0 31 37.0 32 53.0 33 88.0 34 100.0 35 151.0 36 410.0 37 3024.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.75 11.825 8.825 33.6 2 24.681170292573142 14.303575893973495 32.98324581145287 28.032008002000502 3 19.625 20.349999999999998 26.924999999999997 33.1 4 22.125 29.175 23.35 25.35 5 21.75 33.275 23.625 21.349999999999998 6 18.32353692818809 36.3915154612829 23.332481472016354 21.952466138512648 7 13.4 27.950000000000003 40.925 17.724999999999998 8 16.175 27.125 31.3 25.4 9 15.6 27.325 33.7 23.375 10-14 19.744999999999997 30.740000000000002 27.02 22.495 15-19 19.525000000000002 30.330000000000002 26.924999999999997 23.22 20-24 20.150000000000002 30.725 27.27 21.855 25-29 19.71 29.885 27.529999999999998 22.875 30-34 19.564999999999998 29.765000000000004 27.05 23.62 35-39 19.36 29.09 27.889999999999997 23.66 40-44 19.455 29.854999999999997 26.884999999999998 23.805 45-49 19.49 29.65 27.779999999999998 23.080000000000002 50-54 19.35 30.635 26.66 23.355 55-59 19.56 29.81 27.04 23.59 60-64 20.185 30.09 26.924999999999997 22.8 65-69 19.585 29.49 27.43 23.494999999999997 70-74 19.81 29.585 27.115000000000002 23.49 75-79 19.645000000000003 29.365000000000002 27.389999999999997 23.599999999999998 80-84 19.78 29.970000000000002 26.674999999999997 23.575 85-89 19.605 29.89 27.224999999999998 23.28 90-94 19.99 28.9 27.935 23.175 95-99 19.57 29.044999999999998 27.26 24.125 100-104 19.93 29.505 27.150000000000002 23.415 105-109 19.265 29.26 27.99 23.485 110-114 19.755 29.065 27.0 24.18 115-119 20.095 29.244999999999997 26.945000000000004 23.715 120-124 19.865 29.555 27.11 23.47 125-129 20.150000000000002 29.360000000000003 26.82 23.669999999999998 130-134 20.5 28.95 26.945000000000004 23.605 135-139 20.36 29.270000000000003 26.645000000000003 23.724999999999998 140-144 20.064999999999998 28.685 27.425 23.825 145-149 20.7 28.79 26.700000000000003 23.810000000000002 150 19.200804222166372 29.354109072631314 26.765518974616736 24.679567730585575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 3.5 23 4.5 24 4.5 25 5.5 26 10.0 27 15.5 28 17.5 29 17.5 30 31.0 31 39.5 32 40.0 33 54.5 34 70.5 35 91.5 36 113.5 37 125.5 38 145.0 39 167.5 40 184.0 41 203.0 42 243.0 43 264.5 44 256.0 45 248.0 46 241.0 47 249.0 48 227.5 49 189.5 50 157.0 51 122.0 52 109.0 53 87.5 54 61.5 55 54.0 56 40.5 57 28.0 58 22.5 59 17.0 60 10.0 61 4.0 62 2.5 63 2.0 64 4.5 65 4.0 66 1.0 67 1.0 68 2.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 2.175 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.4625 0.0 0.0 0.0 0.0 134-135 4.8625 0.0 0.0 0.0 0.0 136-137 5.45 0.0 0.0 0.0 0.0 138 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCGAT 10 0.006973645 144.0 1 TATTACA 10 0.006973645 144.0 7 >>END_MODULE SRR4237582 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237582_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63475 33.0 33.0 34.0 32.0 34.0 2 31.27525 33.0 32.0 34.0 25.0 34.0 3 32.449 33.0 33.0 34.0 31.0 34.0 4 32.6385 33.0 33.0 34.0 32.0 34.0 5 32.79175 34.0 33.0 34.0 32.0 34.0 6 37.00775 38.0 38.0 38.0 36.0 38.0 7 37.09175 38.0 38.0 38.0 37.0 38.0 8 37.04475 38.0 38.0 38.0 37.0 38.0 9 37.089 38.0 38.0 38.0 37.0 38.0 10-14 37.0274 38.0 38.0 38.0 36.6 38.0 15-19 37.105450000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.0576 38.0 38.0 38.0 37.0 38.0 25-29 37.07349999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.0139 38.0 38.0 38.0 36.4 38.0 35-39 37.0407 38.0 38.0 38.0 37.0 38.0 40-44 36.974199999999996 38.0 38.0 38.0 36.4 38.0 45-49 37.033249999999995 38.0 38.0 38.0 37.0 38.0 50-54 36.91085 38.0 38.0 38.0 36.2 38.0 55-59 36.926100000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.90845 38.0 38.0 38.0 36.0 38.0 65-69 36.832100000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.49655 38.0 37.8 38.0 34.2 38.0 75-79 36.640649999999994 38.0 38.0 38.0 35.2 38.0 80-84 36.61005 38.0 38.0 38.0 35.2 38.0 85-89 35.70635 38.0 37.0 38.0 29.4 38.0 90-94 35.8544 38.0 37.4 38.0 31.2 38.0 95-99 36.413 38.0 38.0 38.0 34.4 38.0 100-104 36.5037 38.0 38.0 38.0 35.0 38.0 105-109 36.39399999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.317 38.0 38.0 38.0 34.2 38.0 115-119 36.37175 38.0 38.0 38.0 34.4 38.0 120-124 36.330400000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.035799999999995 38.0 38.0 38.0 33.8 38.0 130-134 35.958999999999996 38.0 38.0 38.0 33.4 38.0 135-139 35.6658 38.0 38.0 38.0 31.8 38.0 140-144 35.32725 38.0 38.0 38.0 31.0 38.0 145-149 34.88969999999999 38.0 37.4 38.0 31.0 38.0 150 28.12 33.0 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 3.0 12 1.0 13 1.0 14 0.0 15 0.0 16 5.0 17 4.0 18 6.0 19 5.0 20 8.0 21 9.0 22 7.0 23 7.0 24 14.0 25 17.0 26 18.0 27 32.0 28 44.0 29 23.0 30 40.0 31 53.0 32 64.0 33 74.0 34 105.0 35 187.0 36 366.0 37 2894.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.375 22.95 10.625 22.05 2 29.425 24.5 31.275 14.799999999999999 3 22.25 26.674999999999997 32.824999999999996 18.25 4 24.925 34.4 22.75 17.925 5 26.05 35.699999999999996 21.425 16.825000000000003 6 20.7 38.2 23.425 17.675 7 21.099999999999998 20.325 40.35 18.224999999999998 8 21.875 25.174999999999997 29.15 23.799999999999997 9 23.474999999999998 24.6 30.7 21.224999999999998 10-14 24.05 28.24 27.47 20.24 15-19 24.09 27.41 28.225 20.275000000000002 20-24 23.32 28.03 28.335 20.315 25-29 23.73 28.000000000000004 28.189999999999998 20.080000000000002 30-34 23.385 27.889999999999997 28.175 20.549999999999997 35-39 23.724999999999998 27.82 28.565 19.89 40-44 23.885 28.01 28.17 19.935 45-49 23.215 27.46 28.73 20.595 50-54 23.195 27.694999999999997 28.955 20.155 55-59 23.825 27.72 28.705000000000002 19.75 60-64 23.705000000000002 27.310000000000002 29.225 19.759999999999998 65-69 23.86 26.865 29.03 20.244999999999997 70-74 23.59 27.915 28.615000000000002 19.88 75-79 23.580000000000002 27.325 28.675 20.419999999999998 80-84 23.835 27.005000000000003 28.915000000000003 20.244999999999997 85-89 23.665 28.015 28.57 19.75 90-94 23.74 28.055000000000003 28.895 19.31 95-99 23.990000000000002 27.555000000000003 28.975 19.48 100-104 23.77 27.72 28.425 20.085 105-109 23.87 27.534999999999997 28.51 20.085 110-114 23.945 27.055 29.255 19.744999999999997 115-119 24.2 28.04 28.610000000000003 19.15 120-124 24.060000000000002 28.060000000000002 28.015 19.865 125-129 24.025 27.275 28.895 19.805 130-134 24.42 27.685 28.57 19.325 135-139 24.745 27.245 28.439999999999998 19.57 140-144 25.025 27.384999999999998 28.4 19.189999999999998 145-149 24.645 27.43 28.24 19.685 150 25.5 27.1 28.1 19.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 1.5 20 1.0 21 0.0 22 1.0 23 1.0 24 2.0 25 4.5 26 4.0 27 4.0 28 10.0 29 14.5 30 16.5 31 18.0 32 28.0 33 42.5 34 50.5 35 73.0 36 91.0 37 112.5 38 144.0 39 169.5 40 196.5 41 226.5 42 238.0 43 261.5 44 282.0 45 279.5 46 280.5 47 273.0 48 242.5 49 206.0 50 177.5 51 133.0 52 105.5 53 76.5 54 50.0 55 40.5 56 29.5 57 27.0 58 23.5 59 16.5 60 8.5 61 3.5 62 4.5 63 7.5 64 5.5 65 1.0 66 2.0 67 1.5 68 1.0 69 1.5 70 0.5 71 1.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.4125 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.4875 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.487500000000001 0.0 0.0 0.0 0.0 138 6.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTAC 10 0.006973645 144.0 8 AAAAAAA 65 0.007995365 13.292308 135-139 >>END_MODULE Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680505 spots for SRR4237582.sra Written 1680505 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra Read 1680487 spots for SRR4237582.sra Written 1680487 spots for SRR4237582.sra SRR ids: ['SRR4237582.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sfjvyl87 SRR4237582.sra spots: 33609758 blocks: [[1, 1680487], [1680488, 3360974], [3360975, 5041461], [5041462, 6721948], [6721949, 8402435], [8402436, 10082922], [10082923, 11763409], [11763410, 13443896], [13443897, 15124383], [15124384, 16804870], [16804871, 18485357], [18485358, 20165844], [20165845, 21846331], [21846332, 23526818], [23526819, 25207305], [25207306, 26887792], [26887793, 28568279], [28568280, 30248766], [30248767, 31929253], [31929254, 33609758]] SRR4237582 file size 11301899 SRR4237582 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237582 SRR4237582_1.fastq SRR4237582_2.fastq Input file: SRR4237582_1.fastq Paired file: SRR4237582_2.fastq trimmed: SRR4237582-trimmed-pair1.fastq, SRR4237582-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:37:53 2025 >> started Wed Feb 12 11:38:32 2025 >> done (38.218s) 33609758 read pairs processed; of these: 56773 ( 0.17%) short read pairs filtered out after trimming by size control 28365 ( 0.08%) empty read pairs filtered out after trimming by size control 33524620 (99.75%) read pairs available; of these: 10356727 (30.89%) trimmed read pairs available after processing 23167893 (69.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 7 0.00% 21 11 0.00% 22 9 0.00% 23 8 0.00% 24 16 0.00% 25 12 0.00% 26 10 0.00% 27 4 0.00% 28 16 0.00% 29 12 0.00% 30 17 0.00% 31 19 0.00% 32 14 0.00% 33 15 0.00% 34 18 0.00% 35 16 0.00% 36 22 0.00% 37 24 0.00% 38 29 0.00% 39 24 0.00% 40 46 0.00% 41 41 0.00% 42 36 0.00% 43 39 0.00% 44 40 0.00% 45 55 0.00% 46 65 0.00% 47 67 0.00% 48 78 0.00% 49 100 0.00% 50 94 0.00% 51 143 0.00% 52 132 0.00% 53 128 0.00% 54 122 0.00% 55 160 0.00% 56 162 0.00% 57 189 0.00% 58 253 0.00% 59 263 0.00% 60 281 0.00% 61 341 0.00% 62 355 0.00% 63 402 0.00% 64 500 0.00% 65 541 0.00% 66 615 0.00% 67 717 0.00% 68 988 0.00% 69 2950 0.01% 70 3254 0.01% 71 1348 0.00% 72 1354 0.00% 73 1528 0.00% 74 1637 0.00% 75 1752 0.01% 76 1971 0.01% 77 2288 0.01% 78 2399 0.01% 79 2735 0.01% 80 3201 0.01% 81 3607 0.01% 82 4219 0.01% 83 5089 0.02% 84 13027 0.04% 85 10494 0.03% 86 8960 0.03% 87 9443 0.03% 88 11429 0.03% 89 11641 0.03% 90 11084 0.03% 91 15708 0.05% 92 13626 0.04% 93 14651 0.04% 94 16882 0.05% 95 17166 0.05% 96 18617 0.06% 97 19448 0.06% 98 20115 0.06% 99 21937 0.07% 100 22974 0.07% 101 24903 0.07% 102 26736 0.08% 103 28555 0.09% 104 30759 0.09% 105 32646 0.10% 106 34753 0.10% 107 36518 0.11% 108 38847 0.12% 109 39308 0.12% 110 41389 0.12% 111 44180 0.13% 112 46703 0.14% 113 48827 0.15% 114 52225 0.16% 115 54681 0.16% 116 56827 0.17% 117 58910 0.18% 118 61569 0.18% 119 63169 0.19% 120 66694 0.20% 121 67607 0.20% 122 69725 0.21% 123 74642 0.22% 124 77990 0.23% 125 80109 0.24% 126 83464 0.25% 127 85665 0.26% 128 89686 0.27% 129 91945 0.27% 130 94400 0.28% 131 96964 0.29% 132 100724 0.30% 133 105581 0.31% 134 109363 0.33% 135 115145 0.34% 136 119597 0.36% 137 124073 0.37% 138 130917 0.39% 139 136369 0.41% 140 144646 0.43% 141 154212 0.46% 142 164812 0.49% 143 177759 0.53% 144 201564 0.60% 145 233909 0.70% 146 288671 0.86% 147 377819 1.13% 148 665236 1.98% 149 4902133 14.62% 150 23167893 69.11% 33524620 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.37 fanout-score-rank=24 prefix-density=0.32 prefix-fanout=2.5 sequence=TGCAAGATTCAACCTACACACAAGAACCCACTAGATAGACTTCCACTGGAACCATGCAGCATTCTCCCGTGATGACCTCATTACTCAGTCTTTTCTACTGGGGTTTCTGTTTCAACCTTCTCCTCTGTTTCAACAGGCTTCTGTTCTTCCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=369.50 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=19.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=24.42 fanout-score-rank=9 prefix-density=0.42 prefix-fanout=9.3 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=245.37 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=26.1 sequence=GAAGAAGAAGAAA SRR4237582 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:39:14 Started mapping on | Feb 12 11:39:15 Finished on | Feb 12 11:41:59 Mapping speed, Million of reads per hour | 735.91 Number of input reads | 33524620 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 32041008 Uniquely mapped reads % | 95.57% Average mapped length | 293.13 Number of splices: Total | 25545182 Number of splices: Annotated (sjdb) | 25025595 Number of splices: GT/AG | 25145238 Number of splices: GC/AG | 301937 Number of splices: AT/AC | 25778 Number of splices: Non-canonical | 72229 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 743019 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 84055 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.89% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 774412 774412 774412 N_multimapping 743019 743019 743019 N_noFeature 1062102 31563000 1309039 N_ambiguous 369163 2493 136373 UnstrandedReadsAssigned:30609743 PositiveStrandReadsAssigned:475515 NegativeStrandReadsAssigned:30595596 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237582 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237582-trimmed-pair1.fastq SRR4237582-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,524,620 reads, 30,533,608 reads pseudoaligned [quant] estimated average fragment length: 233.047 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR4237582.ke.tsv 34699 SRR4237582.se.tsv 87100 total ==> SRR4237582.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.95 673.458 12.3176 Potri.005G024800.1.v4.1 1035 802.953 110 4.47495 Potri.004G059700.1.v4.1 961 729 48 2.1508 Potri.007G009000.2.v4.1 1416 1183.95 0 0 Potri.003G141000.2.v4.1 2943 2710.95 373.094 4.49554 Potri.016G087400.1.v4.1 270 82.1592 4335.7 1723.81 Potri.015G069301.1.v4.1 564 336.206 0 0 Potri.010G195200.1.v4.1 1773 1540.95 224 4.74837 Potri.012G127500.1.v4.1 977 744.98 9256 405.85 ==> SRR4237582.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5629 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 555 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR4237582 completed mapping pipeline successfully