Starting /dee2/code/volunteer_pipeline.sh SRR4237583 current disk space = 3051046281216 free memory = 1424275468 SRR4237583 SRAfilesize b06ef49134d1b7c0b5685138f6d0e60c SRR4237583.sra SRR4237583.sra file validated SRR4237583 is paired end SRR4237583 is conventional basespace SRR4237583 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237583_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0445 33.0 33.0 34.0 18.0 34.0 2 31.89425 33.0 32.0 34.0 27.0 34.0 3 32.47275 34.0 33.0 34.0 28.0 34.0 4 32.854 34.0 33.0 34.0 32.0 34.0 5 32.87025 34.0 33.0 34.0 32.0 34.0 6 35.82525 38.0 37.0 38.0 31.0 38.0 7 36.8445 38.0 38.0 38.0 35.0 38.0 8 37.07525 38.0 38.0 38.0 36.0 38.0 9 37.233 38.0 38.0 38.0 36.0 38.0 10-14 37.25019999999999 38.0 38.0 38.0 36.4 38.0 15-19 37.21215 38.0 38.0 38.0 36.4 38.0 20-24 36.8043 38.0 37.8 38.0 34.4 38.0 25-29 37.02775 38.0 38.0 38.0 36.0 38.0 30-34 37.086349999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.96035 38.0 38.0 38.0 35.8 38.0 40-44 37.025150000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.9502 38.0 38.0 38.0 35.8 38.0 50-54 36.856899999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.83705 38.0 38.0 38.0 35.2 38.0 60-64 36.9037 38.0 38.0 38.0 35.8 38.0 65-69 36.7747 38.0 38.0 38.0 35.0 38.0 70-74 36.82254999999999 38.0 38.0 38.0 35.0 38.0 75-79 36.21825 38.0 37.6 38.0 32.6 38.0 80-84 33.5034 37.0 30.0 38.0 24.0 38.0 85-89 36.4471 38.0 37.6 38.0 33.8 38.0 90-94 36.252599999999994 38.0 37.6 38.0 32.8 38.0 95-99 36.471450000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.3482 38.0 38.0 38.0 34.0 38.0 105-109 36.0616 38.0 37.2 38.0 32.6 38.0 110-114 36.09405 38.0 37.2 38.0 33.2 38.0 115-119 35.87695 38.0 37.0 38.0 32.2 38.0 120-124 35.644600000000004 38.0 36.6 38.0 31.0 38.0 125-129 35.51305 38.0 36.6 38.0 30.2 38.0 130-134 35.37565 38.0 36.0 38.0 29.6 38.0 135-139 34.98625 38.0 35.4 38.0 27.4 38.0 140-144 33.092349999999996 37.2 31.4 38.0 21.6 38.0 145-149 34.4462 38.0 35.4 38.0 26.8 38.0 150 29.64625 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 0.0 14 1.0 15 0.0 16 3.0 17 1.0 18 1.0 19 4.0 20 5.0 21 4.0 22 3.0 23 10.0 24 5.0 25 16.0 26 17.0 27 24.0 28 35.0 29 51.0 30 73.0 31 83.0 32 92.0 33 136.0 34 196.0 35 337.0 36 747.0 37 2151.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.056013179571664 12.053816584294344 8.40197693574959 41.4881933003844 2 22.375 15.425 36.375 25.825 3 19.6 19.175 26.275 34.949999999999996 4 22.6 29.15 23.825 24.425 5 22.925 32.95 25.0 19.125 6 17.150000000000002 36.7 25.1 21.05 7 13.350000000000001 26.75 42.15 17.75 8 16.225 26.924999999999997 32.125 24.725 9 15.475 24.875 35.675000000000004 23.974999999999998 10-14 19.075 30.819999999999997 27.925 22.18 15-19 18.765 29.09 28.389999999999997 23.755000000000003 20-24 18.81 29.625 28.299999999999997 23.265 25-29 18.795 30.869999999999997 27.515 22.82 30-34 18.19 30.669999999999998 27.565 23.575 35-39 18.805 30.44 27.860000000000003 22.895 40-44 18.95 29.945 28.475 22.63 45-49 19.064999999999998 29.709999999999997 27.96 23.265 50-54 18.87 29.805 27.875 23.45 55-59 19.189999999999998 29.04 28.389999999999997 23.380000000000003 60-64 18.925 29.575000000000003 27.555000000000003 23.945 65-69 18.88 29.175 28.17 23.775 70-74 19.42 29.635 27.755000000000003 23.189999999999998 75-79 18.995 29.5 27.650000000000002 23.855 80-84 19.009999999999998 30.064999999999998 27.560000000000002 23.365 85-89 19.13 29.575000000000003 28.055000000000003 23.24 90-94 18.970000000000002 29.25 28.355000000000004 23.425 95-99 18.875 29.304999999999996 28.1 23.72 100-104 18.87 28.82 28.315 23.995 105-109 18.955 29.59 28.165000000000003 23.29 110-114 18.975 29.535 28.095 23.395 115-119 19.515 29.310000000000002 28.139999999999997 23.035 120-124 19.235 29.054999999999996 28.42 23.29 125-129 19.6 29.425 27.534999999999997 23.44 130-134 19.37 29.599999999999998 27.445000000000004 23.585 135-139 19.295 29.32 27.87 23.515 140-144 19.865 29.28 27.389999999999997 23.465 145-149 19.63 29.385 27.74 23.244999999999997 150 19.35 27.700000000000003 28.675 24.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.5 24 5.0 25 6.5 26 9.5 27 10.5 28 20.0 29 26.0 30 30.5 31 46.5 32 56.0 33 65.5 34 86.0 35 105.5 36 118.5 37 143.5 38 166.0 39 197.0 40 232.0 41 244.0 42 248.0 43 252.5 44 258.5 45 249.0 46 238.0 47 212.5 48 180.0 49 167.0 50 150.5 51 116.0 52 80.0 53 77.5 54 64.5 55 37.5 56 27.5 57 20.0 58 14.5 59 12.0 60 8.5 61 4.5 62 3.0 63 1.5 64 0.5 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0125 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.5125000000000002 0.0 0.0 0.0 0.0 120-121 1.7375 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.8375 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.2249999999999996 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237583 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237583_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.079 33.0 32.0 34.0 30.0 34.0 2 30.474 33.0 31.0 34.0 18.0 34.0 3 31.85975 33.0 32.0 34.0 27.0 34.0 4 32.129 33.0 33.0 34.0 31.0 34.0 5 32.37125 33.0 33.0 34.0 31.0 34.0 6 36.24375 38.0 38.0 38.0 33.0 38.0 7 36.49025 38.0 38.0 38.0 34.0 38.0 8 36.608 38.0 38.0 38.0 34.0 38.0 9 36.52575 38.0 38.0 38.0 34.0 38.0 10-14 36.4722 38.0 38.0 38.0 33.8 38.0 15-19 36.56885 38.0 38.0 38.0 34.2 38.0 20-24 35.73255 38.0 36.6 38.0 29.4 38.0 25-29 35.5113 38.0 36.2 38.0 29.2 38.0 30-34 35.8904 38.0 37.4 38.0 31.2 38.0 35-39 36.376 38.0 38.0 38.0 33.8 38.0 40-44 36.4399 38.0 38.0 38.0 34.0 38.0 45-49 36.2906 38.0 38.0 38.0 33.6 38.0 50-54 36.46325 38.0 38.0 38.0 34.0 38.0 55-59 36.4496 38.0 38.0 38.0 34.0 38.0 60-64 36.402300000000004 38.0 38.0 38.0 33.8 38.0 65-69 35.709900000000005 38.0 37.2 38.0 30.0 38.0 70-74 36.14725 38.0 37.8 38.0 33.0 38.0 75-79 34.08845 37.8 33.4 38.0 22.6 38.0 80-84 35.07765 38.0 35.8 38.0 27.8 38.0 85-89 35.74805 38.0 37.0 38.0 30.2 38.0 90-94 35.789 38.0 37.2 38.0 31.0 38.0 95-99 35.70115 38.0 37.0 38.0 31.0 38.0 100-104 35.57905000000001 38.0 37.0 38.0 29.8 38.0 105-109 35.2485 38.0 36.8 38.0 28.4 38.0 110-114 35.3958 38.0 37.0 38.0 29.2 38.0 115-119 35.34435 38.0 37.0 38.0 29.6 38.0 120-124 35.084 38.0 36.2 38.0 28.0 38.0 125-129 35.007999999999996 38.0 36.0 38.0 28.0 38.0 130-134 34.77115 38.0 36.0 38.0 27.2 38.0 135-139 34.52105 38.0 35.8 38.0 25.2 38.0 140-144 33.947050000000004 38.0 34.6 38.0 22.2 38.0 145-149 33.070100000000004 38.0 33.8 38.0 13.4 38.0 150 26.23625 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 4.0 5 0.0 6 2.0 7 0.0 8 0.0 9 2.0 10 3.0 11 0.0 12 1.0 13 4.0 14 3.0 15 4.0 16 4.0 17 8.0 18 5.0 19 7.0 20 8.0 21 13.0 22 13.0 23 13.0 24 33.0 25 32.0 26 39.0 27 35.0 28 47.0 29 64.0 30 81.0 31 99.0 32 121.0 33 137.0 34 186.0 35 279.0 36 643.0 37 2102.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.074999999999996 21.275 13.350000000000001 26.3 2 27.650000000000002 24.375 35.225 12.75 3 21.6 28.449999999999996 33.324999999999996 16.625 4 24.9 33.925 23.375 17.8 5 24.925 37.9 21.975 15.2 6 19.975 39.4 24.85 15.775 7 19.25 22.325 41.325 17.1 8 21.224999999999998 23.875 31.3 23.599999999999998 9 23.075000000000003 25.424999999999997 30.3 21.2 10-14 24.165 28.305000000000003 27.905 19.625 15-19 23.549999999999997 28.515 28.685 19.25 20-24 23.355 28.860000000000003 28.854999999999997 18.93 25-29 23.385 28.475 29.080000000000002 19.06 30-34 23.31 28.705000000000002 28.720000000000002 19.265 35-39 22.645 28.9 28.92 19.535 40-44 23.400000000000002 28.189999999999998 28.77 19.64 45-49 23.585 28.549999999999997 28.515 19.35 50-54 23.580000000000002 28.595 28.57 19.255 55-59 23.535 28.355000000000004 28.610000000000003 19.5 60-64 23.05 28.110000000000003 29.755 19.085 65-69 23.78 28.215 28.549999999999997 19.455 70-74 23.51 27.950000000000003 29.195 19.345000000000002 75-79 23.07 27.675 29.87 19.384999999999998 80-84 23.32 27.875 29.154999999999998 19.650000000000002 85-89 23.27 28.265 29.165000000000003 19.3 90-94 23.369999999999997 28.065 28.87 19.695 95-99 23.035 28.615000000000002 29.235 19.115 100-104 23.44 28.265 28.810000000000002 19.485 105-109 23.515 28.22 29.815 18.45 110-114 23.895 27.810000000000002 29.115000000000002 19.18 115-119 23.474999999999998 27.92 28.794999999999998 19.81 120-124 23.385 28.27 29.080000000000002 19.265 125-129 24.37 27.955000000000002 29.005 18.67 130-134 23.985 28.384999999999998 28.645 18.985 135-139 24.15 28.775000000000002 28.305000000000003 18.77 140-144 24.529999999999998 28.23 28.494999999999997 18.745 145-149 24.29 28.694999999999997 28.26 18.755 150 24.349999999999998 28.025 28.475 19.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 2.0 22 1.5 23 3.5 24 6.5 25 8.0 26 5.5 27 9.5 28 18.5 29 18.5 30 28.0 31 41.0 32 46.0 33 58.5 34 73.5 35 84.5 36 116.0 37 152.5 38 167.0 39 194.0 40 225.0 41 242.5 42 254.0 43 267.5 44 270.5 45 255.5 46 246.5 47 228.0 48 186.0 49 163.5 50 148.5 51 126.5 52 95.5 53 61.5 54 49.5 55 38.0 56 30.5 57 22.5 58 15.5 59 10.0 60 6.5 61 6.0 62 3.0 63 2.5 64 2.0 65 1.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.23750000000000002 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8374999999999999 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.4874999999999998 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.4 0.0 0.0 0.0 0.0 128-129 2.8375 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.2750000000000004 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.9749999999999996 0.0 0.0 0.0 0.0 138 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506359 spots for SRR4237583.sra Written 3506359 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra Read 3506358 spots for SRR4237583.sra Written 3506358 spots for SRR4237583.sra SRR ids: ['SRR4237583.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q16z_nml SRR4237583.sra spots: 70127161 blocks: [[1, 3506358], [3506359, 7012716], [7012717, 10519074], [10519075, 14025432], [14025433, 17531790], [17531791, 21038148], [21038149, 24544506], [24544507, 28050864], [28050865, 31557222], [31557223, 35063580], [35063581, 38569938], [38569939, 42076296], [42076297, 45582654], [45582655, 49089012], [49089013, 52595370], [52595371, 56101728], [56101729, 59608086], [59608087, 63114444], [63114445, 66620802], [66620803, 70127161]] SRR4237583 file size 23605126 SRR4237583 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237583 SRR4237583_1.fastq SRR4237583_2.fastq Input file: SRR4237583_1.fastq Paired file: SRR4237583_2.fastq trimmed: SRR4237583-trimmed-pair1.fastq, SRR4237583-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:22:21 2025 >> started Wed Feb 12 11:23:34 2025 >> done (73.073s) 70127161 read pairs processed; of these: 50556 ( 0.07%) short read pairs filtered out after trimming by size control 35204 ( 0.05%) empty read pairs filtered out after trimming by size control 70041401 (99.88%) read pairs available; of these: 24371450 (34.80%) trimmed read pairs available after processing 45669951 (65.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 13 0.00% 21 13 0.00% 22 10 0.00% 23 10 0.00% 24 8 0.00% 25 11 0.00% 26 20 0.00% 27 22 0.00% 28 15 0.00% 29 20 0.00% 30 32 0.00% 31 26 0.00% 32 22 0.00% 33 32 0.00% 34 22 0.00% 35 37 0.00% 36 39 0.00% 37 46 0.00% 38 48 0.00% 39 61 0.00% 40 63 0.00% 41 65 0.00% 42 62 0.00% 43 82 0.00% 44 95 0.00% 45 105 0.00% 46 100 0.00% 47 109 0.00% 48 141 0.00% 49 152 0.00% 50 169 0.00% 51 199 0.00% 52 228 0.00% 53 227 0.00% 54 247 0.00% 55 312 0.00% 56 300 0.00% 57 327 0.00% 58 373 0.00% 59 403 0.00% 60 436 0.00% 61 565 0.00% 62 619 0.00% 63 683 0.00% 64 811 0.00% 65 860 0.00% 66 998 0.00% 67 1071 0.00% 68 1387 0.00% 69 2313 0.00% 70 2324 0.00% 71 1945 0.00% 72 2123 0.00% 73 2270 0.00% 74 2595 0.00% 75 2985 0.00% 76 3293 0.00% 77 3700 0.01% 78 4033 0.01% 79 4742 0.01% 80 5225 0.01% 81 6095 0.01% 82 6739 0.01% 83 8325 0.01% 84 12467 0.02% 85 13494 0.02% 86 14744 0.02% 87 16372 0.02% 88 17064 0.02% 89 18421 0.03% 90 19797 0.03% 91 21400 0.03% 92 22984 0.03% 93 24949 0.04% 94 27091 0.04% 95 29016 0.04% 96 31219 0.04% 97 33517 0.05% 98 35194 0.05% 99 37515 0.05% 100 40041 0.06% 101 42756 0.06% 102 46061 0.07% 103 48876 0.07% 104 52216 0.07% 105 55845 0.08% 106 59762 0.09% 107 63127 0.09% 108 65751 0.09% 109 69087 0.10% 110 72545 0.10% 111 76584 0.11% 112 80690 0.12% 113 85416 0.12% 114 90472 0.13% 115 96177 0.14% 116 100832 0.14% 117 106385 0.15% 118 111605 0.16% 119 114666 0.16% 120 118736 0.17% 121 124378 0.18% 122 128979 0.18% 123 136990 0.20% 124 140380 0.20% 125 150340 0.21% 126 155024 0.22% 127 161893 0.23% 128 168790 0.24% 129 176383 0.25% 130 183867 0.26% 131 191423 0.27% 132 200766 0.29% 133 211209 0.30% 134 220888 0.32% 135 234365 0.33% 136 249318 0.36% 137 264897 0.38% 138 283356 0.40% 139 304127 0.43% 140 326081 0.47% 141 356820 0.51% 142 394142 0.56% 143 441772 0.63% 144 513428 0.73% 145 621981 0.89% 146 800962 1.14% 147 1157905 1.65% 148 2120935 3.03% 149 11906754 17.00% 150 45669951 65.20% 70041401 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=2.1 sequence=TATCCCATCATGGAAGTGTATAACCTCCACACTTGTATCCCACTGGACGGTTGGCAATGTTGCAACGTTTGGGGATGGTAATGGCAGTTTCAATCTTGACTCCAGATGCCTTAGCAGTGTCTGAAAGCATTACAGCACAAAGACA criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=244.70 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=30.1 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=2.0 sequence=GCGGGGGAATGTGGAAAATCTTCCCCAGACAATGAAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=85.07 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.5 sequence=GAAAAATGGCGACTCCAATGAAGTACATTTGCTTGTTTATGTTTCTTGCAATTCTCAGCATTGCTGGGCTCAATCAAGTTGACGGGGCTGGTGAATGTGGGAAAAACACCACTCCTGACATGGAGGCTTTCAAGATGGCTCCTTGT SRR4237583 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:24:19 Started mapping on | Feb 12 11:24:19 Finished on | Feb 12 11:32:30 Mapping speed, Million of reads per hour | 513.54 Number of input reads | 70041401 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 66251412 Uniquely mapped reads % | 94.59% Average mapped length | 293.57 Number of splices: Total | 56443341 Number of splices: Annotated (sjdb) | 54586494 Number of splices: GT/AG | 55354106 Number of splices: GC/AG | 824024 Number of splices: AT/AC | 62358 Number of splices: Non-canonical | 202853 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.59 Insertion rate per base | 0.03% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1509508 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 207933 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2336594 2336594 2336594 N_multimapping 1509508 1509508 1509508 N_noFeature 4044037 65281193 4588516 N_ambiguous 824190 6473 394696 UnstrandedReadsAssigned:61383185 PositiveStrandReadsAssigned:963746 NegativeStrandReadsAssigned:61268200 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237583 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237583-trimmed-pair1.fastq SRR4237583-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 70,041,401 reads, 61,019,314 reads pseudoaligned [quant] estimated average fragment length: 239.792 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52401 SRR4237583.ke.tsv 34699 SRR4237583.se.tsv 87100 total ==> SRR4237583.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.21 3931 33.6863 Potri.005G024800.1.v4.1 1035 796.208 2385 45.6709 Potri.004G059700.1.v4.1 961 722.249 30 0.633304 Potri.007G009000.2.v4.1 1416 1177.21 0 0 Potri.003G141000.2.v4.1 2943 2704.21 2483.72 14.0036 Potri.016G087400.1.v4.1 270 76.8634 4914.46 974.841 Potri.015G069301.1.v4.1 564 328.514 0 0 Potri.010G195200.1.v4.1 1773 1534.21 690.992 6.86699 Potri.012G127500.1.v4.1 977 738.228 39746 820.881 ==> SRR4237583.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3256 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 1749 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 117 SRR4237583 completed mapping pipeline successfully