Starting /dee2/code/volunteer_pipeline.sh SRR4237584 current disk space = 3051295457280 free memory = 1578828172 SRR4237584 SRAfilesize a711ec79c3ecc488e0ca34eba92db5dc SRR4237584.sra SRR4237584.sra file validated SRR4237584 is paired end SRR4237584 is conventional basespace SRR4237584 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237584_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.659 33.0 33.0 34.0 27.0 34.0 2 32.7005 34.0 33.0 34.0 28.0 34.0 3 32.84575 34.0 33.0 34.0 31.0 34.0 4 33.08275 34.0 33.0 34.0 32.0 34.0 5 32.336 34.0 33.0 34.0 31.0 34.0 6 36.47025 38.0 37.0 38.0 34.0 38.0 7 37.05975 38.0 38.0 38.0 36.0 38.0 8 37.204 38.0 38.0 38.0 36.0 38.0 9 37.33 38.0 38.0 38.0 37.0 38.0 10-14 37.34505 38.0 38.0 38.0 37.0 38.0 15-19 37.3246 38.0 38.0 38.0 36.8 38.0 20-24 37.22965 38.0 38.0 38.0 36.4 38.0 25-29 36.6161 38.0 37.4 38.0 33.4 38.0 30-34 37.24855 38.0 38.0 38.0 37.0 38.0 35-39 36.9101 38.0 38.0 38.0 35.6 38.0 40-44 37.1036 38.0 38.0 38.0 36.0 38.0 45-49 37.11295 38.0 38.0 38.0 36.0 38.0 50-54 36.345299999999995 38.0 37.4 38.0 32.4 38.0 55-59 34.33115 37.6 33.2 38.0 24.8 38.0 60-64 34.32625 36.2 31.2 38.0 28.4 38.0 65-69 36.904250000000005 38.0 38.0 38.0 35.4 38.0 70-74 35.172000000000004 37.6 34.6 38.0 29.4 38.0 75-79 36.15965 38.0 37.4 38.0 31.8 38.0 80-84 35.705799999999996 38.0 36.2 38.0 29.4 38.0 85-89 36.162299999999995 38.0 37.4 38.0 32.6 38.0 90-94 35.79855 38.0 36.8 38.0 29.0 38.0 95-99 36.564350000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.399950000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.38784999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.3814 38.0 38.0 38.0 34.0 38.0 115-119 36.16045 38.0 37.8 38.0 33.6 38.0 120-124 35.982350000000004 38.0 37.0 38.0 32.8 38.0 125-129 34.82424999999999 38.0 35.4 38.0 25.8 38.0 130-134 35.581399999999995 38.0 36.6 38.0 31.0 38.0 135-139 32.339600000000004 36.4 30.0 38.0 21.0 38.0 140-144 31.305200000000003 36.0 27.2 38.0 17.2 38.0 145-149 33.6816 37.6 34.2 38.0 24.6 38.0 150 29.39725 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 3.0 16 0.0 17 2.0 18 2.0 19 4.0 20 2.0 21 7.0 22 9.0 23 9.0 24 15.0 25 17.0 26 19.0 27 26.0 28 50.0 29 37.0 30 48.0 31 77.0 32 106.0 33 172.0 34 253.0 35 468.0 36 1097.0 37 1573.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.72801082543978 12.016238159675236 9.391069012178619 39.86468200270636 2 22.925 15.024999999999999 35.625 26.424999999999997 3 21.5 20.424999999999997 25.45 32.625 4 23.25 27.525 24.275 24.95 5 21.85 33.85 24.5 19.8 6 17.25 37.175000000000004 25.2 20.375 7 13.15 27.450000000000003 42.25 17.150000000000002 8 16.0 25.15 33.275 25.575 9 17.5 25.324999999999996 32.625 24.55 10-14 19.41 31.019999999999996 27.36 22.21 15-19 19.755 29.720000000000002 27.015 23.51 20-24 19.055 29.625 27.884999999999998 23.435 25-29 19.555 29.685 27.43 23.330000000000002 30-34 19.265 29.99 27.3 23.445 35-39 19.555 30.335 26.69 23.419999999999998 40-44 19.665 29.904999999999998 27.279999999999998 23.150000000000002 45-49 19.615 29.404999999999998 27.084999999999997 23.895 50-54 19.465 29.604999999999997 27.47 23.46 55-59 20.075000000000003 29.84 27.250000000000004 22.835 60-64 19.955000000000002 29.315 27.235 23.494999999999997 65-69 19.96 29.165000000000003 27.505000000000003 23.369999999999997 70-74 20.225 29.154999999999998 27.644999999999996 22.975 75-79 19.615 29.125 27.62 23.64 80-84 19.634999999999998 29.065 27.55 23.75 85-89 19.905 28.82 27.115000000000002 24.16 90-94 19.81 29.21 27.275 23.705000000000002 95-99 19.96 29.53 27.175 23.335 100-104 19.975 29.049999999999997 27.73 23.244999999999997 105-109 20.044999999999998 29.28 27.11 23.565 110-114 20.195 28.52 27.46 23.825 115-119 19.830000000000002 29.575000000000003 26.784999999999997 23.810000000000002 120-124 21.02 28.95 26.57 23.46 125-129 20.244999999999997 28.59 27.32 23.845 130-134 20.18 28.494999999999997 27.155 24.169999999999998 135-139 20.36 28.74 27.24 23.66 140-144 20.06 28.875 27.310000000000002 23.755000000000003 145-149 20.1 28.975 26.840000000000003 24.085 150 21.475 27.450000000000003 27.075 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 2.5 24 5.5 25 4.0 26 3.5 27 6.5 28 11.5 29 19.0 30 23.0 31 37.5 32 47.5 33 56.0 34 72.5 35 88.5 36 106.0 37 132.5 38 163.5 39 182.0 40 190.0 41 214.0 42 242.0 43 246.0 44 251.5 45 256.5 46 259.0 47 236.0 48 216.0 49 201.0 50 153.5 51 125.0 52 104.5 53 80.5 54 69.0 55 49.5 56 35.0 57 28.5 58 22.5 59 17.0 60 8.0 61 4.0 62 4.5 63 4.0 64 2.5 65 3.0 66 2.0 67 1.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.2999999999999998 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.2875 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 2.9000000000000004 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.65 0.0 0.0 0.0 0.0 118-119 4.0875 0.0 0.0 0.0 0.0 120-121 4.575 0.0 0.0 0.0 0.0 122-123 4.8625 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.8 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.074999999999999 0.0 0.0 0.0 0.0 134-135 7.525 0.0 0.0 0.0 0.0 136-137 8.0125 0.0 0.0 0.0 0.0 138 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237584 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237584_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50625 33.0 33.0 34.0 31.0 34.0 2 32.633 33.0 33.0 34.0 32.0 34.0 3 32.66525 33.0 33.0 34.0 32.0 34.0 4 32.59925 33.0 33.0 34.0 32.0 34.0 5 32.6605 33.0 33.0 34.0 32.0 34.0 6 36.86175 38.0 38.0 38.0 36.0 38.0 7 36.80725 38.0 38.0 38.0 36.0 38.0 8 36.82025 38.0 38.0 38.0 36.0 38.0 9 36.8635 38.0 38.0 38.0 36.0 38.0 10-14 36.58794999999999 38.0 38.0 38.0 34.6 38.0 15-19 36.42184999999999 38.0 38.0 38.0 33.8 38.0 20-24 34.5939 38.0 34.4 38.0 23.6 38.0 25-29 36.267700000000005 38.0 37.6 38.0 33.4 38.0 30-34 36.601150000000004 38.0 38.0 38.0 35.2 38.0 35-39 36.58885 38.0 38.0 38.0 34.8 38.0 40-44 36.44785 38.0 38.0 38.0 34.2 38.0 45-49 36.07340000000001 38.0 37.4 38.0 30.4 38.0 50-54 35.182849999999995 38.0 35.4 38.0 28.6 38.0 55-59 36.37095 38.0 38.0 38.0 34.0 38.0 60-64 36.3147 38.0 38.0 38.0 34.0 38.0 65-69 36.35850000000001 38.0 38.0 38.0 34.0 38.0 70-74 35.41365 38.0 36.4 38.0 29.2 38.0 75-79 34.616749999999996 38.0 35.2 38.0 23.4 38.0 80-84 36.1404 38.0 37.8 38.0 33.2 38.0 85-89 36.18175 38.0 38.0 38.0 33.8 38.0 90-94 35.9208 38.0 37.6 38.0 32.8 38.0 95-99 35.95395 38.0 38.0 38.0 33.2 38.0 100-104 35.661150000000006 38.0 37.6 38.0 30.8 38.0 105-109 35.476699999999994 38.0 37.0 38.0 30.0 38.0 110-114 34.1507 37.8 34.2 38.0 25.4 38.0 115-119 33.33265 37.4 31.8 38.0 22.8 38.0 120-124 34.93715000000001 38.0 36.0 38.0 27.2 38.0 125-129 34.72705 38.0 36.0 38.0 26.4 38.0 130-134 34.383750000000006 38.0 35.2 38.0 23.8 38.0 135-139 34.3304 38.0 35.6 38.0 23.6 38.0 140-144 33.40815 38.0 34.0 38.0 20.0 38.0 145-149 32.263099999999994 38.0 33.0 38.0 8.6 38.0 150 26.071 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 10.0 4 6.0 5 2.0 6 0.0 7 2.0 8 2.0 9 2.0 10 1.0 11 4.0 12 2.0 13 2.0 14 1.0 15 4.0 16 2.0 17 5.0 18 6.0 19 8.0 20 7.0 21 12.0 22 10.0 23 23.0 24 19.0 25 17.0 26 23.0 27 49.0 28 48.0 29 57.0 30 61.0 31 94.0 32 114.0 33 164.0 34 209.0 35 352.0 36 793.0 37 1880.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.6 19.45 13.950000000000001 27.0 2 28.65 24.675 31.6 15.075 3 21.475 27.800000000000004 32.475 18.25 4 25.85 34.825 22.225 17.1 5 25.05 35.75 22.475 16.725 6 20.150000000000002 38.4 24.125 17.325 7 21.55 20.875 38.800000000000004 18.775 8 21.4 25.0 28.749999999999996 24.85 9 23.0 23.799999999999997 30.55 22.650000000000002 10-14 23.7 29.520000000000003 26.665 20.115 15-19 23.79 27.33 28.050000000000004 20.830000000000002 20-24 23.185 27.97 28.405 20.44 25-29 23.955000000000002 28.48 27.66 19.905 30-34 23.165 28.04 28.199999999999996 20.595 35-39 23.16 27.700000000000003 28.345 20.794999999999998 40-44 23.46 27.29 28.599999999999998 20.65 45-49 23.05 27.589999999999996 28.615000000000002 20.745 50-54 23.145 28.144999999999996 28.494999999999997 20.215 55-59 23.57 27.99 28.34 20.1 60-64 23.325000000000003 27.860000000000003 28.42 20.395 65-69 23.435 27.839999999999996 28.499999999999996 20.225 70-74 23.919999999999998 28.15 28.18 19.75 75-79 23.57 27.639999999999997 28.599999999999998 20.19 80-84 23.48 27.985 28.67 19.865 85-89 23.265 27.665 28.76 20.31 90-94 23.895 27.089999999999996 28.98 20.035 95-99 23.275000000000002 27.67 28.82 20.235 100-104 23.945 27.694999999999997 28.744999999999997 19.615 105-109 23.615 28.055000000000003 28.375 19.955000000000002 110-114 24.18 27.88 28.110000000000003 19.830000000000002 115-119 23.815 27.889999999999997 28.749999999999996 19.545 120-124 24.01 27.889999999999997 28.255000000000003 19.845 125-129 24.525 27.6 27.815 20.06 130-134 25.290000000000003 27.715 27.694999999999997 19.3 135-139 24.995 27.74 28.055000000000003 19.21 140-144 25.330000000000002 28.07 27.87 18.73 145-149 25.69 27.994999999999997 27.29 19.025 150 26.724999999999998 26.400000000000002 28.175 18.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.0 24 3.5 25 3.5 26 5.0 27 7.5 28 8.0 29 8.5 30 15.0 31 21.0 32 32.5 33 44.0 34 50.0 35 68.5 36 93.0 37 115.0 38 138.5 39 152.5 40 186.0 41 231.5 42 266.0 43 278.0 44 282.0 45 292.5 46 277.5 47 239.0 48 209.0 49 205.5 50 178.5 51 144.5 52 117.0 53 87.0 54 59.0 55 43.5 56 36.5 57 22.5 58 18.5 59 13.0 60 6.5 61 6.0 62 5.5 63 5.0 64 5.5 65 4.0 66 1.0 67 1.0 68 1.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 1.0125000000000002 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.3125 0.0 0.0 0.0 0.0 112-113 2.6500000000000004 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.3625 0.0 0.0 0.0 0.0 118-119 3.7874999999999996 0.0 0.0 0.0 0.0 120-121 4.3 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 4.9875 0.0 0.0 0.0 0.0 126-127 5.45 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.362500000000001 0.0 0.0 0.0 0.0 132-133 6.949999999999999 0.0 0.0 0.0 0.0 134-135 7.4625 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138 8.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTAAT 10 0.006973645 144.0 1 >>END_MODULE Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817999 spots for SRR4237584.sra Written 2817999 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra Read 2817993 spots for SRR4237584.sra Written 2817993 spots for SRR4237584.sra SRR ids: ['SRR4237584.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lv9mbgan SRR4237584.sra spots: 56359866 blocks: [[1, 2817993], [2817994, 5635986], [5635987, 8453979], [8453980, 11271972], [11271973, 14089965], [14089966, 16907958], [16907959, 19725951], [19725952, 22543944], [22543945, 25361937], [25361938, 28179930], [28179931, 30997923], [30997924, 33815916], [33815917, 36633909], [36633910, 39451902], [39451903, 42269895], [42269896, 45087888], [45087889, 47905881], [47905882, 50723874], [50723875, 53541867], [53541868, 56359866]] SRR4237584 file size 18966731 SRR4237584 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237584 SRR4237584_1.fastq SRR4237584_2.fastq Input file: SRR4237584_1.fastq Paired file: SRR4237584_2.fastq trimmed: SRR4237584-trimmed-pair1.fastq, SRR4237584-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:17:55 2025 >> started Wed Feb 12 12:19:00 2025 >> done (64.903s) 56359866 read pairs processed; of these: 75982 ( 0.13%) short read pairs filtered out after trimming by size control 66790 ( 0.12%) empty read pairs filtered out after trimming by size control 56217094 (99.75%) read pairs available; of these: 21637126 (38.49%) trimmed read pairs available after processing 34579968 (61.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 10 0.00% 21 13 0.00% 22 13 0.00% 23 16 0.00% 24 14 0.00% 25 11 0.00% 26 14 0.00% 27 12 0.00% 28 25 0.00% 29 23 0.00% 30 44 0.00% 31 23 0.00% 32 46 0.00% 33 39 0.00% 34 35 0.00% 35 53 0.00% 36 64 0.00% 37 77 0.00% 38 67 0.00% 39 91 0.00% 40 97 0.00% 41 114 0.00% 42 109 0.00% 43 120 0.00% 44 134 0.00% 45 167 0.00% 46 210 0.00% 47 224 0.00% 48 252 0.00% 49 281 0.00% 50 304 0.00% 51 330 0.00% 52 344 0.00% 53 390 0.00% 54 436 0.00% 55 480 0.00% 56 564 0.00% 57 621 0.00% 58 717 0.00% 59 802 0.00% 60 836 0.00% 61 1017 0.00% 62 1140 0.00% 63 1298 0.00% 64 1451 0.00% 65 1574 0.00% 66 1938 0.00% 67 2405 0.00% 68 3055 0.01% 69 6764 0.01% 70 5083 0.01% 71 3629 0.01% 72 3926 0.01% 73 4355 0.01% 74 4782 0.01% 75 5411 0.01% 76 5892 0.01% 77 6657 0.01% 78 7336 0.01% 79 8434 0.02% 80 9084 0.02% 81 10344 0.02% 82 11999 0.02% 83 13950 0.02% 84 20564 0.04% 85 21903 0.04% 86 23324 0.04% 87 25237 0.04% 88 26937 0.05% 89 28344 0.05% 90 30705 0.05% 91 32843 0.06% 92 35448 0.06% 93 38117 0.07% 94 41395 0.07% 95 44061 0.08% 96 47632 0.08% 97 50770 0.09% 98 52780 0.09% 99 56470 0.10% 100 59401 0.11% 101 62256 0.11% 102 66294 0.12% 103 71106 0.13% 104 75188 0.13% 105 79885 0.14% 106 84088 0.15% 107 88326 0.16% 108 91650 0.16% 109 96066 0.17% 110 98256 0.17% 111 102214 0.18% 112 106625 0.19% 113 111118 0.20% 114 116075 0.21% 115 122255 0.22% 116 125586 0.22% 117 130718 0.23% 118 135262 0.24% 119 138124 0.25% 120 141683 0.25% 121 146297 0.26% 122 150460 0.27% 123 155039 0.28% 124 161935 0.29% 125 167889 0.30% 126 172367 0.31% 127 179152 0.32% 128 183577 0.33% 129 189312 0.34% 130 195579 0.35% 131 200075 0.36% 132 207563 0.37% 133 215780 0.38% 134 220624 0.39% 135 230667 0.41% 136 242178 0.43% 137 254622 0.45% 138 268215 0.48% 139 283469 0.50% 140 300872 0.54% 141 321625 0.57% 142 347779 0.62% 143 383123 0.68% 144 435309 0.77% 145 517763 0.92% 146 655825 1.17% 147 935479 1.66% 148 1661370 2.96% 149 9444714 16.80% 150 34579968 61.51% 56217094 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=51.65 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=13.1 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=17.15 fanout-score-rank=15 prefix-density=0.41 prefix-fanout=7.7 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=92.74 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.2 sequence=CTCTTCCTCTTCACAATTAGCAAACAGTAAGTTTGAACACACTCAAGATTTGAAATATCCTACAACGATGAGAAAGCAACTCCTCTCCCCATTCGTTCCTTTCTTGATGTTCTTCCTCTACAGCTCCACCACTTTTGCTCAAACCCCATCTCCAGCACCTTCAGGTCCAACCAACAT SRR4237584 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:19:43 Started mapping on | Feb 12 12:19:43 Finished on | Feb 12 12:25:02 Mapping speed, Million of reads per hour | 634.42 Number of input reads | 56217094 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 53811284 Uniquely mapped reads % | 95.72% Average mapped length | 291.22 Number of splices: Total | 46102506 Number of splices: Annotated (sjdb) | 45194469 Number of splices: GT/AG | 45402681 Number of splices: GC/AG | 538148 Number of splices: AT/AC | 43624 Number of splices: Non-canonical | 118053 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1086563 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 81296 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1396753 1396753 1396753 N_multimapping 1086563 1086563 1086563 N_noFeature 1553681 53017157 1962164 N_ambiguous 604474 3850 215917 UnstrandedReadsAssigned:51653129 PositiveStrandReadsAssigned:790277 NegativeStrandReadsAssigned:51633203 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237584 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237584-trimmed-pair1.fastq SRR4237584-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,217,094 reads, 51,470,052 reads pseudoaligned [quant] estimated average fragment length: 226.108 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR4237584.ke.tsv 34699 SRR4237584.se.tsv 87100 total ==> SRR4237584.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.89 1227 12.9372 Potri.005G024800.1.v4.1 1035 809.892 154 3.59453 Potri.004G059700.1.v4.1 961 735.904 39 1.00183 Potri.007G009000.2.v4.1 1416 1190.89 0 0 Potri.003G141000.2.v4.1 2943 2717.89 800.098 5.56494 Potri.016G087400.1.v4.1 270 85.6054 7161.82 1581.51 Potri.015G069301.1.v4.1 564 341.748 0 0 Potri.010G195200.1.v4.1 1773 1547.89 157 1.91738 Potri.012G127500.1.v4.1 977 751.892 15509 389.922 ==> SRR4237584.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7336 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1117 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR4237584 completed mapping pipeline successfully