Starting /dee2/code/volunteer_pipeline.sh SRR4237585 current disk space = 3051266297856 free memory = 1581936500 SRR4237585 SRAfilesize 99614d950039eeb909e30185d89495ec SRR4237585.sra SRR4237585.sra file validated SRR4237585 is paired end SRR4237585 is conventional basespace SRR4237585 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237585_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.4 33.0 32.0 34.0 2.0 34.0 2 32.2615 34.0 33.0 34.0 28.0 34.0 3 32.4845 34.0 33.0 34.0 28.0 34.0 4 32.75875 34.0 33.0 34.0 32.0 34.0 5 32.7805 34.0 33.0 34.0 32.0 34.0 6 36.6865 38.0 37.0 38.0 34.0 38.0 7 37.0155 38.0 38.0 38.0 35.0 38.0 8 36.95525 38.0 38.0 38.0 36.0 38.0 9 37.13825 38.0 38.0 38.0 36.0 38.0 10-14 37.18755 38.0 38.0 38.0 36.0 38.0 15-19 37.17305 38.0 38.0 38.0 36.0 38.0 20-24 37.257400000000004 38.0 38.0 38.0 36.4 38.0 25-29 36.59689999999999 38.0 37.8 38.0 34.2 38.0 30-34 36.6736 38.0 37.8 38.0 34.2 38.0 35-39 36.948699999999995 38.0 38.0 38.0 35.6 38.0 40-44 37.02455 38.0 38.0 38.0 36.0 38.0 45-49 37.05745 38.0 38.0 38.0 36.0 38.0 50-54 36.705850000000005 38.0 37.8 38.0 34.6 38.0 55-59 36.45125 38.0 37.8 38.0 33.4 38.0 60-64 36.68925 38.0 38.0 38.0 34.6 38.0 65-69 36.826449999999994 38.0 38.0 38.0 35.2 38.0 70-74 34.7291 37.2 32.0 38.0 29.2 38.0 75-79 36.38645 38.0 37.4 38.0 33.4 38.0 80-84 34.676249999999996 37.4 32.2 38.0 28.2 38.0 85-89 36.1984 38.0 37.4 38.0 32.8 38.0 90-94 36.269549999999995 38.0 37.4 38.0 33.8 38.0 95-99 36.39735 38.0 38.0 38.0 34.0 38.0 100-104 36.35625 38.0 37.8 38.0 34.0 38.0 105-109 36.10905 38.0 37.6 38.0 33.2 38.0 110-114 35.61835 38.0 36.4 38.0 30.2 38.0 115-119 35.82525 38.0 36.8 38.0 31.6 38.0 120-124 35.31385 38.0 36.0 38.0 29.0 38.0 125-129 34.61615 38.0 34.8 38.0 25.2 38.0 130-134 34.698299999999996 38.0 35.2 38.0 26.2 38.0 135-139 34.69165 38.0 35.2 38.0 25.0 38.0 140-144 34.0803 38.0 34.6 38.0 23.8 38.0 145-149 33.54425 38.0 34.2 38.0 20.6 38.0 150 26.3485 34.0 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 2.0 15 5.0 16 1.0 17 2.0 18 2.0 19 2.0 20 4.0 21 4.0 22 3.0 23 7.0 24 10.0 25 16.0 26 20.0 27 34.0 28 33.0 29 59.0 30 72.0 31 97.0 32 111.0 33 137.0 34 240.0 35 371.0 36 791.0 37 1974.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.71781899943789 10.93310848791456 9.218662169758291 42.13041034288926 2 22.6 15.25 35.4 26.75 3 19.125 19.025 25.825 36.025 4 23.025000000000002 27.650000000000002 21.675 27.650000000000002 5 23.075000000000003 33.85 24.05 19.025 6 18.575 36.575 24.25 20.599999999999998 7 14.274999999999999 27.224999999999998 41.625 16.875 8 16.5 27.425 31.35 24.725 9 16.725 24.125 34.975 24.175 10-14 19.345000000000002 31.014999999999997 26.645000000000003 22.994999999999997 15-19 19.515 29.515 27.72 23.25 20-24 19.735 29.160000000000004 27.71 23.395 25-29 19.475 29.785 27.455000000000002 23.285 30-34 19.634999999999998 29.354999999999997 26.815 24.195 35-39 19.785 29.93 27.045 23.24 40-44 19.195 29.744999999999997 27.894999999999996 23.165 45-49 19.545 29.57 27.24 23.645 50-54 19.5 28.854999999999997 27.705000000000002 23.94 55-59 19.81 29.354999999999997 26.895000000000003 23.94 60-64 20.265 28.910000000000004 27.175 23.65 65-69 19.645000000000003 29.425 27.474999999999998 23.455000000000002 70-74 19.595000000000002 29.294999999999998 27.26 23.849999999999998 75-79 19.825 28.92 27.6 23.655 80-84 19.755 29.225 27.425 23.595 85-89 19.759999999999998 29.225 27.515 23.5 90-94 20.28 29.515 26.83 23.375 95-99 19.82 29.365000000000002 27.05 23.765 100-104 20.544999999999998 29.38 26.825 23.25 105-109 20.294999999999998 29.470000000000002 27.29 22.945 110-114 20.64 29.13 26.96 23.27 115-119 20.565 28.655 27.205000000000002 23.575 120-124 20.51 28.68 26.825 23.985 125-129 20.355 29.349999999999998 26.384999999999998 23.91 130-134 20.815 29.205 25.814999999999998 24.165 135-139 21.165 28.625 25.979999999999997 24.23 140-144 21.23 28.38 26.39 24.0 145-149 21.475 28.804999999999996 25.290000000000003 24.43 150 21.15 27.55 27.35 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 4.5 26 7.5 27 8.0 28 8.0 29 16.0 30 23.5 31 27.5 32 46.5 33 61.0 34 67.0 35 85.5 36 100.5 37 114.5 38 144.5 39 166.5 40 193.5 41 230.5 42 249.0 43 255.5 44 273.5 45 276.0 46 254.5 47 236.0 48 221.0 49 190.0 50 154.5 51 128.0 52 106.0 53 89.5 54 70.5 55 56.0 56 40.5 57 24.5 58 16.0 59 14.0 60 9.5 61 6.0 62 3.5 63 1.5 64 2.0 65 1.5 66 1.0 67 2.0 68 3.0 69 2.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 3.1 0.0 0.0 0.0 0.0 116-117 3.5374999999999996 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.85 0.0 0.0 0.0 0.0 122-123 5.3875 0.0 0.0 0.0 0.0 124-125 5.9125 0.0 0.0 0.0 0.0 126-127 6.6625 0.0 0.0 0.0 0.0 128-129 7.25 0.0 0.0 0.0 0.0 130-131 8.1125 0.0 0.0 0.0 0.0 132-133 8.925 0.0 0.0 0.0 0.0 134-135 9.75 0.0 0.0 0.0 0.0 136-137 10.5125 0.0 0.0 0.0 0.0 138 11.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237585 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237585_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2655 33.0 33.0 34.0 31.0 34.0 2 32.07875 33.0 33.0 34.0 30.0 34.0 3 32.218 33.0 33.0 34.0 31.0 34.0 4 32.2855 33.0 33.0 34.0 31.0 34.0 5 32.39825 33.0 33.0 34.0 31.0 34.0 6 36.33625 38.0 38.0 38.0 33.0 38.0 7 36.1895 38.0 38.0 38.0 33.0 38.0 8 36.0745 38.0 38.0 38.0 31.0 38.0 9 36.27225 38.0 38.0 38.0 33.0 38.0 10-14 36.31955 38.0 38.0 38.0 33.2 38.0 15-19 36.3408 38.0 38.0 38.0 33.4 38.0 20-24 36.3215 38.0 38.0 38.0 33.8 38.0 25-29 36.228300000000004 38.0 37.8 38.0 32.6 38.0 30-34 36.36815 38.0 38.0 38.0 34.0 38.0 35-39 36.29475 38.0 38.0 38.0 33.6 38.0 40-44 36.142700000000005 38.0 37.8 38.0 32.0 38.0 45-49 34.8067 38.0 35.0 38.0 24.6 38.0 50-54 35.9996 38.0 37.6 38.0 31.8 38.0 55-59 36.28235 38.0 38.0 38.0 33.4 38.0 60-64 36.235800000000005 38.0 38.0 38.0 33.2 38.0 65-69 36.09785 38.0 37.8 38.0 32.6 38.0 70-74 35.19885 38.0 36.2 38.0 25.8 38.0 75-79 33.67095 37.6 32.0 38.0 23.2 38.0 80-84 35.73555 38.0 36.8 38.0 30.6 38.0 85-89 35.25905 38.0 36.8 38.0 27.8 38.0 90-94 35.3241 38.0 36.8 38.0 28.6 38.0 95-99 35.547599999999996 38.0 37.0 38.0 30.0 38.0 100-104 35.47425 38.0 36.8 38.0 30.2 38.0 105-109 35.23855 38.0 36.6 38.0 28.2 38.0 110-114 34.09349999999999 37.8 33.8 38.0 23.8 38.0 115-119 34.716 38.0 35.6 38.0 25.2 38.0 120-124 34.7473 38.0 35.6 38.0 25.8 38.0 125-129 34.5397 38.0 35.4 38.0 24.8 38.0 130-134 34.00475 38.0 34.8 38.0 21.6 38.0 135-139 33.838350000000005 38.0 34.4 38.0 22.2 38.0 140-144 32.268299999999996 37.6 31.0 38.0 13.4 38.0 145-149 30.8313 37.6 31.2 38.0 4.2 38.0 150 23.388 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 3.0 5 1.0 6 0.0 7 0.0 8 2.0 9 2.0 10 1.0 11 2.0 12 1.0 13 6.0 14 5.0 15 5.0 16 3.0 17 9.0 18 10.0 19 10.0 20 11.0 21 10.0 22 18.0 23 29.0 24 25.0 25 31.0 26 40.0 27 51.0 28 59.0 29 75.0 30 119.0 31 104.0 32 130.0 33 151.0 34 241.0 35 356.0 36 697.0 37 1790.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.625 19.8 12.55 28.025 2 27.750000000000004 25.424999999999997 32.4 14.424999999999999 3 20.9 27.55 32.45 19.1 4 24.45 33.725 23.425 18.4 5 25.35 36.925000000000004 22.325 15.4 6 20.95 38.1 23.549999999999997 17.4 7 20.5 21.325 40.1 18.075 8 22.25 24.15 29.849999999999998 23.75 9 23.125 23.7 31.2 21.975 10-14 24.04 28.595 26.795 20.57 15-19 23.465 27.865000000000002 28.21 20.46 20-24 23.565 27.72 28.07 20.645 25-29 23.74 27.68 28.115000000000002 20.465 30-34 23.39 27.955000000000002 28.155 20.5 35-39 23.36 27.96 28.655 20.025000000000002 40-44 23.995 27.894999999999996 28.325 19.785 45-49 23.7 27.689999999999998 28.199999999999996 20.41 50-54 22.91 28.485 28.09 20.515 55-59 23.27 27.66 28.79 20.28 60-64 24.085 28.15 27.894999999999996 19.869999999999997 65-69 23.45 27.589999999999996 28.9 20.06 70-74 23.815 26.915 29.01 20.26 75-79 23.345 27.625 28.945 20.085 80-84 23.494999999999997 27.950000000000003 28.244999999999997 20.31 85-89 23.515 27.694999999999997 28.349999999999998 20.44 90-94 23.505000000000003 27.639999999999997 28.799999999999997 20.055 95-99 24.05 27.375 28.83 19.744999999999997 100-104 23.974999999999998 26.945000000000004 29.125 19.955000000000002 105-109 23.849999999999998 27.800000000000004 28.875 19.475 110-114 24.385 27.250000000000004 28.29 20.075000000000003 115-119 23.635 27.744999999999997 28.57 20.05 120-124 24.654999999999998 27.87 28.235 19.24 125-129 24.755 28.044999999999998 27.62 19.580000000000002 130-134 25.535000000000004 27.54 27.52 19.405 135-139 25.729999999999997 27.589999999999996 27.38 19.3 140-144 25.765 27.944999999999997 26.91 19.38 145-149 26.455000000000002 27.525 27.155 18.865000000000002 150 26.075 27.575 28.1 18.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 3.5 23 2.5 24 1.0 25 3.0 26 5.5 27 4.0 28 6.5 29 14.5 30 18.5 31 21.0 32 23.0 33 38.5 34 59.0 35 70.5 36 89.5 37 108.5 38 134.0 39 172.5 40 194.5 41 213.0 42 245.5 43 261.0 44 275.5 45 309.0 46 288.0 47 253.0 48 233.0 49 205.0 50 174.0 51 145.5 52 107.5 53 73.0 54 70.0 55 54.5 56 33.5 57 22.5 58 17.5 59 9.5 60 7.5 61 7.5 62 5.5 63 3.5 64 3.0 65 2.5 66 1.0 67 1.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 3.025 0.0 0.0 0.0 0.0 116-117 3.4625000000000004 0.0 0.0 0.0 0.0 118-119 4.1875 0.0 0.0 0.0 0.0 120-121 4.800000000000001 0.0 0.0 0.0 0.0 122-123 5.4 0.0 0.0 0.0 0.0 124-125 6.075 0.0 0.0 0.0 0.0 126-127 6.875 0.0 0.0 0.0 0.0 128-129 7.5 0.0 0.0 0.0 0.0 130-131 8.325 0.0 0.0 0.0 0.0 132-133 9.125 0.0 0.0 0.0 0.0 134-135 9.925 0.0 0.0 0.0 0.0 136-137 10.675 0.0 0.0 0.0 0.0 138 11.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCAAG 10 0.006973645 144.0 9 TGGGAAT 10 0.006973645 144.0 6 >>END_MODULE Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991987 spots for SRR4237585.sra Written 2991987 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra Read 2991978 spots for SRR4237585.sra Written 2991978 spots for SRR4237585.sra SRR ids: ['SRR4237585.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_msl7rfs9 SRR4237585.sra spots: 59839569 blocks: [[1, 2991978], [2991979, 5983956], [5983957, 8975934], [8975935, 11967912], [11967913, 14959890], [14959891, 17951868], [17951869, 20943846], [20943847, 23935824], [23935825, 26927802], [26927803, 29919780], [29919781, 32911758], [32911759, 35903736], [35903737, 38895714], [38895715, 41887692], [41887693, 44879670], [44879671, 47871648], [47871649, 50863626], [50863627, 53855604], [53855605, 56847582], [56847583, 59839569]] SRR4237585 file size 20139091 SRR4237585 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237585 SRR4237585_1.fastq SRR4237585_2.fastq Input file: SRR4237585_1.fastq Paired file: SRR4237585_2.fastq trimmed: SRR4237585-trimmed-pair1.fastq, SRR4237585-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:33:34 2025 >> started Wed Feb 12 12:34:43 2025 >> done (69.075s) 59839569 read pairs processed; of these: 54643 ( 0.09%) short read pairs filtered out after trimming by size control 49831 ( 0.08%) empty read pairs filtered out after trimming by size control 59735095 (99.83%) read pairs available; of these: 26180553 (43.83%) trimmed read pairs available after processing 33554542 (56.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 9 0.00% 21 7 0.00% 22 8 0.00% 23 10 0.00% 24 7 0.00% 25 10 0.00% 26 11 0.00% 27 14 0.00% 28 13 0.00% 29 14 0.00% 30 22 0.00% 31 19 0.00% 32 18 0.00% 33 20 0.00% 34 28 0.00% 35 39 0.00% 36 38 0.00% 37 39 0.00% 38 44 0.00% 39 64 0.00% 40 71 0.00% 41 82 0.00% 42 59 0.00% 43 101 0.00% 44 102 0.00% 45 127 0.00% 46 130 0.00% 47 163 0.00% 48 173 0.00% 49 190 0.00% 50 253 0.00% 51 235 0.00% 52 300 0.00% 53 336 0.00% 54 322 0.00% 55 428 0.00% 56 457 0.00% 57 476 0.00% 58 549 0.00% 59 682 0.00% 60 749 0.00% 61 901 0.00% 62 1066 0.00% 63 1200 0.00% 64 1355 0.00% 65 1532 0.00% 66 1670 0.00% 67 1872 0.00% 68 2334 0.00% 69 3453 0.01% 70 3588 0.01% 71 3336 0.01% 72 3770 0.01% 73 4215 0.01% 74 4823 0.01% 75 5509 0.01% 76 6194 0.01% 77 6838 0.01% 78 7722 0.01% 79 8851 0.01% 80 9706 0.02% 81 11353 0.02% 82 12906 0.02% 83 14933 0.02% 84 20042 0.03% 85 22101 0.04% 86 23907 0.04% 87 25894 0.04% 88 28011 0.05% 89 30636 0.05% 90 33492 0.06% 91 36995 0.06% 92 40391 0.07% 93 44294 0.07% 94 48879 0.08% 95 53061 0.09% 96 57720 0.10% 97 62265 0.10% 98 66234 0.11% 99 70186 0.12% 100 75780 0.13% 101 79648 0.13% 102 85594 0.14% 103 91924 0.15% 104 98427 0.16% 105 105899 0.18% 106 113108 0.19% 107 119122 0.20% 108 124164 0.21% 109 130302 0.22% 110 133898 0.22% 111 140410 0.24% 112 148349 0.25% 113 153430 0.26% 114 162273 0.27% 115 171329 0.29% 116 177374 0.30% 117 185477 0.31% 118 194461 0.33% 119 198146 0.33% 120 203246 0.34% 121 210439 0.35% 122 214852 0.36% 123 220675 0.37% 124 230178 0.39% 125 240006 0.40% 126 248108 0.42% 127 255678 0.43% 128 264456 0.44% 129 272572 0.46% 130 280350 0.47% 131 286476 0.48% 132 294498 0.49% 133 303068 0.51% 134 311585 0.52% 135 322703 0.54% 136 339944 0.57% 137 353905 0.59% 138 373671 0.63% 139 389936 0.65% 140 410215 0.69% 141 432094 0.72% 142 463858 0.78% 143 504680 0.84% 144 564685 0.95% 145 659127 1.10% 146 811293 1.36% 147 1119029 1.87% 148 1957822 3.28% 149 10162620 17.01% 150 33554542 56.17% 59735095 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=8.83 fanout-score-rank=13 prefix-density=0.28 prefix-fanout=5.2 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=109.60 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=18.0 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=23.10 fanout-score-rank=9 prefix-density=0.40 prefix-fanout=9.6 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=2564.15 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=29.7 sequence=AAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGT SRR4237585 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:35:27 Started mapping on | Feb 12 12:35:28 Finished on | Feb 12 12:39:38 Mapping speed, Million of reads per hour | 860.19 Number of input reads | 59735095 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 57887431 Uniquely mapped reads % | 96.91% Average mapped length | 289.24 Number of splices: Total | 46453683 Number of splices: Annotated (sjdb) | 45541022 Number of splices: GT/AG | 45740408 Number of splices: GC/AG | 543858 Number of splices: AT/AC | 40474 Number of splices: Non-canonical | 128943 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.35 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1154323 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 109338 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 746732 746732 746732 N_multimapping 1154323 1154323 1154323 N_noFeature 1844563 57023369 2324591 N_ambiguous 616084 4519 228489 UnstrandedReadsAssigned:55426784 PositiveStrandReadsAssigned:859543 NegativeStrandReadsAssigned:55334351 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR4237585 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237585-trimmed-pair1.fastq SRR4237585-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 59,735,095 reads, 55,179,183 reads pseudoaligned [quant] estimated average fragment length: 210.435 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR4237585.ke.tsv 34699 SRR4237585.se.tsv 87100 total ==> SRR4237585.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.57 1294 14.0482 Potri.005G024800.1.v4.1 1035 825.565 120 2.85398 Potri.004G059700.1.v4.1 961 751.579 44 1.14947 Potri.007G009000.2.v4.1 1416 1206.57 0 0 Potri.003G141000.2.v4.1 2943 2733.57 835.386 6.00038 Potri.016G087400.1.v4.1 270 92.5399 7086.04 1503.47 Potri.015G069301.1.v4.1 564 356.454 0 0 Potri.010G195200.1.v4.1 1773 1563.57 253 3.17706 Potri.012G127500.1.v4.1 977 767.565 13362 341.804 ==> SRR4237585.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8292 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 921 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR4237585 completed mapping pipeline successfully