Starting /dee2/code/volunteer_pipeline.sh SRR4237586 current disk space = 3051214286848 free memory = 1580109444 SRR4237586 SRAfilesize 283ab2d2cb0a736fab402c87fac1cf40 SRR4237586.sra SRR4237586.sra file validated SRR4237586 is paired end SRR4237586 is conventional basespace SRR4237586 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237586_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.233 33.0 32.0 34.0 2.0 34.0 2 31.88275 33.0 32.0 34.0 27.0 34.0 3 32.2115 33.0 32.0 34.0 27.0 34.0 4 32.73525 34.0 33.0 34.0 32.0 34.0 5 32.90875 34.0 33.0 34.0 32.0 34.0 6 36.66575 38.0 37.0 38.0 34.0 38.0 7 36.9935 38.0 38.0 38.0 35.0 38.0 8 37.134 38.0 38.0 38.0 36.0 38.0 9 37.0305 38.0 38.0 38.0 36.0 38.0 10-14 37.173500000000004 38.0 38.0 38.0 36.2 38.0 15-19 37.00015 38.0 38.0 38.0 35.8 38.0 20-24 37.0833 38.0 38.0 38.0 36.2 38.0 25-29 37.09805 38.0 38.0 38.0 36.0 38.0 30-34 36.96805 38.0 38.0 38.0 35.8 38.0 35-39 36.8151 38.0 38.0 38.0 35.4 38.0 40-44 36.83175 38.0 38.0 38.0 35.2 38.0 45-49 36.857099999999996 38.0 38.0 38.0 35.4 38.0 50-54 36.603899999999996 38.0 38.0 38.0 34.6 38.0 55-59 35.003699999999995 37.8 34.6 38.0 28.2 38.0 60-64 35.299949999999995 37.8 35.4 38.0 29.2 38.0 65-69 36.568799999999996 38.0 38.0 38.0 34.2 38.0 70-74 36.1088 38.0 37.2 38.0 32.0 38.0 75-79 36.481750000000005 38.0 38.0 38.0 34.2 38.0 80-84 33.483349999999994 37.4 31.6 38.0 23.4 38.0 85-89 35.42685000000001 37.8 36.0 38.0 29.4 38.0 90-94 35.885000000000005 38.0 37.2 38.0 31.4 38.0 95-99 36.2175 38.0 38.0 38.0 34.0 38.0 100-104 36.180150000000005 38.0 37.6 38.0 33.6 38.0 105-109 36.0961 38.0 37.6 38.0 33.4 38.0 110-114 35.8083 38.0 37.0 38.0 31.8 38.0 115-119 35.77365 38.0 37.0 38.0 31.4 38.0 120-124 35.836349999999996 38.0 37.0 38.0 32.0 38.0 125-129 35.4865 38.0 36.4 38.0 31.0 38.0 130-134 34.29915 37.8 34.6 38.0 25.4 38.0 135-139 33.92035 38.0 34.2 38.0 21.8 38.0 140-144 34.637950000000004 38.0 35.4 38.0 27.0 38.0 145-149 32.9634 38.0 32.8 38.0 20.0 38.0 150 27.28525 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 5.0 16 4.0 17 1.0 18 3.0 19 3.0 20 4.0 21 7.0 22 12.0 23 11.0 24 24.0 25 16.0 26 24.0 27 34.0 28 40.0 29 45.0 30 70.0 31 91.0 32 118.0 33 147.0 34 231.0 35 354.0 36 839.0 37 1911.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.61467889908257 11.46788990825688 10.091743119266056 40.825688073394495 2 22.425 14.224999999999998 34.0 29.349999999999998 3 19.475 17.974999999999998 24.525 38.025 4 21.4 28.675 22.025 27.900000000000002 5 22.525000000000002 33.675 23.45 20.349999999999998 6 18.224999999999998 37.05 23.875 20.849999999999998 7 13.825000000000001 28.4 40.075 17.7 8 16.775000000000002 26.224999999999998 32.125 24.875 9 16.2 25.3 35.099999999999994 23.400000000000002 10-14 18.805 30.925000000000004 27.495000000000005 22.775000000000002 15-19 18.89 29.805 27.33 23.974999999999998 20-24 19.215 30.04 27.315 23.43 25-29 18.88 30.725 27.55 22.845 30-34 19.305 29.78 27.195000000000004 23.72 35-39 19.08 29.815 27.825 23.28 40-44 19.355 30.044999999999998 27.255000000000003 23.345 45-49 18.682802420363053 29.959493924088616 27.489123368505275 23.868580287043056 50-54 19.21 29.18 27.98 23.630000000000003 55-59 19.425 30.305 26.575 23.695 60-64 19.095000000000002 30.165 27.560000000000002 23.18 65-69 18.584999999999997 30.214999999999996 27.415 23.785 70-74 19.195 29.4 27.91 23.494999999999997 75-79 19.470000000000002 29.585 28.105000000000004 22.84 80-84 19.796979697969796 29.62296229622962 27.012701270127014 23.567356735673567 85-89 19.31 29.65 26.955000000000002 24.085 90-94 19.564999999999998 29.69 26.755000000000003 23.990000000000002 95-99 19.41 29.195 27.77 23.625 100-104 19.46 29.325000000000003 27.865000000000002 23.35 105-109 19.66 29.794999999999998 26.279999999999998 24.265 110-114 19.665 29.13 27.465 23.74 115-119 20.294999999999998 29.595 27.055 23.055 120-124 20.025000000000002 29.585 26.55 23.84 125-129 20.436021801090053 28.841442072103607 26.961348067403367 23.761188059402972 130-134 20.336016800840042 28.596429821491075 27.471373568678437 23.59617980899045 135-139 20.627062706270628 29.07790779077908 26.8026802680268 23.492349234923495 140-144 20.597059705970597 28.60786078607861 27.062706270627064 23.73237323732373 145-149 20.599999999999998 28.925 26.795 23.68 150 19.975 29.15 26.3 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 3.0 25 5.0 26 9.0 27 12.5 28 17.0 29 19.5 30 25.5 31 45.0 32 58.0 33 68.5 34 82.5 35 90.5 36 105.0 37 125.5 38 161.5 39 185.0 40 205.5 41 239.5 42 246.0 43 253.0 44 255.0 45 245.0 46 235.5 47 238.0 48 215.0 49 176.5 50 147.5 51 119.0 52 97.5 53 78.5 54 61.5 55 39.5 56 30.0 57 25.0 58 20.5 59 14.0 60 6.5 61 4.0 62 3.5 63 3.5 64 3.0 65 1.5 66 3.5 67 4.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.01 140-144 0.01 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.2000000000000002 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.275 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.362500000000001 0.0 0.0 0.0 0.0 132-133 4.949999999999999 0.0 0.0 0.0 0.0 134-135 5.425000000000001 0.0 0.0 0.0 0.0 136-137 6.2375 0.0 0.0 0.0 0.0 138 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTAG 10 0.0069990456 143.82501 4 GGGAGCA 10 0.0069990456 143.82501 2 AGATGAC 10 0.0069990456 143.82501 2 >>END_MODULE SRR4237586 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237586_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.47925 33.0 33.0 34.0 31.0 34.0 2 32.66625 33.0 33.0 34.0 32.0 34.0 3 32.647 33.0 33.0 34.0 32.0 34.0 4 32.5155 33.0 33.0 34.0 31.0 34.0 5 32.6075 33.0 33.0 34.0 32.0 34.0 6 36.59525 38.0 38.0 38.0 34.0 38.0 7 36.75075 38.0 38.0 38.0 35.0 38.0 8 36.64475 38.0 38.0 38.0 35.0 38.0 9 36.63 38.0 38.0 38.0 34.0 38.0 10-14 36.61115 38.0 38.0 38.0 34.6 38.0 15-19 36.63674999999999 38.0 38.0 38.0 34.6 38.0 20-24 36.579950000000004 38.0 38.0 38.0 34.6 38.0 25-29 35.97335 38.0 37.4 38.0 31.6 38.0 30-34 36.4455 38.0 38.0 38.0 33.8 38.0 35-39 35.872 38.0 37.2 38.0 30.8 38.0 40-44 36.2352 38.0 37.6 38.0 32.8 38.0 45-49 36.43525 38.0 38.0 38.0 34.2 38.0 50-54 36.41324999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.37225 38.0 38.0 38.0 34.2 38.0 60-64 36.38605 38.0 38.0 38.0 34.0 38.0 65-69 36.308800000000005 38.0 38.0 38.0 34.0 38.0 70-74 36.08024999999999 38.0 38.0 38.0 33.4 38.0 75-79 35.70845 38.0 37.2 38.0 30.8 38.0 80-84 35.87755 38.0 37.2 38.0 32.6 38.0 85-89 35.7749 38.0 37.2 38.0 31.8 38.0 90-94 35.7142 38.0 37.4 38.0 31.0 38.0 95-99 35.7348 38.0 37.0 38.0 31.0 38.0 100-104 35.406099999999995 38.0 37.0 38.0 30.0 38.0 105-109 32.872550000000004 37.2 30.6 38.0 21.0 38.0 110-114 35.10075 38.0 36.2 38.0 28.2 38.0 115-119 35.0999 38.0 36.2 38.0 28.2 38.0 120-124 34.7632 38.0 35.8 38.0 26.2 38.0 125-129 34.492850000000004 38.0 35.8 38.0 25.2 38.0 130-134 34.143150000000006 38.0 34.8 38.0 23.6 38.0 135-139 33.65595 38.0 33.6 38.0 21.4 38.0 140-144 32.78555 38.0 33.0 38.0 15.2 38.0 145-149 31.87255 38.0 33.0 38.0 6.4 38.0 150 23.27 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 2.0 5 2.0 6 4.0 7 2.0 8 2.0 9 2.0 10 1.0 11 3.0 12 2.0 13 5.0 14 4.0 15 5.0 16 3.0 17 10.0 18 6.0 19 8.0 20 8.0 21 10.0 22 13.0 23 20.0 24 16.0 25 37.0 26 28.0 27 35.0 28 44.0 29 61.0 30 81.0 31 87.0 32 115.0 33 148.0 34 201.0 35 311.0 36 672.0 37 2037.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.15 21.05 15.0 26.8 2 29.099999999999998 23.9 32.300000000000004 14.7 3 23.325000000000003 26.3 32.0 18.375 4 24.2 34.425 24.275 17.1 5 26.200000000000003 35.625 23.775 14.399999999999999 6 20.875 39.25 23.5 16.375 7 20.5 21.6 40.0 17.9 8 23.375 24.45 28.95 23.225 9 23.474999999999998 24.05 30.9 21.575 10-14 24.22 28.560000000000002 27.11 20.11 15-19 23.880000000000003 28.48 28.075 19.564999999999998 20-24 24.065 27.96 27.939999999999998 20.035 25-29 23.74 28.43 28.155 19.675 30-34 23.61 27.315 28.854999999999997 20.22 35-39 23.465 28.62 28.105000000000004 19.81 40-44 23.544999999999998 27.839999999999996 28.544999999999998 20.07 45-49 23.810000000000002 28.02 28.389999999999997 19.78 50-54 23.555 28.62 28.12 19.705000000000002 55-59 22.955000000000002 28.084999999999997 28.945 20.015 60-64 23.325000000000003 27.255000000000003 29.505 19.915 65-69 23.555 27.839999999999996 28.825 19.78 70-74 23.655 27.275 29.104999999999997 19.965 75-79 23.385 27.189999999999998 28.9 20.525 80-84 23.435 27.485 28.735 20.345 85-89 23.44 27.575 29.145 19.84 90-94 23.705000000000002 27.595 29.299999999999997 19.400000000000002 95-99 23.035 27.534999999999997 29.335 20.095 100-104 23.435 27.875 29.14 19.55 105-109 23.845 27.029999999999998 29.054999999999996 20.07 110-114 23.955000000000002 27.35 28.89 19.805 115-119 24.060000000000002 27.52 29.354999999999997 19.064999999999998 120-124 23.75 27.27 29.509999999999998 19.470000000000002 125-129 24.26 27.525 28.610000000000003 19.605 130-134 24.435000000000002 28.07 28.470000000000002 19.025 135-139 24.64 27.125 29.445 18.790000000000003 140-144 24.62 27.384999999999998 28.915000000000003 19.08 145-149 25.34 27.6 27.775 19.285 150 27.025 27.625 26.224999999999998 19.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 2.0 21 2.5 22 1.0 23 1.5 24 3.0 25 4.0 26 6.5 27 8.5 28 8.0 29 13.0 30 17.5 31 24.0 32 36.0 33 48.5 34 64.0 35 76.0 36 93.5 37 124.5 38 146.0 39 168.0 40 193.5 41 239.5 42 277.0 43 275.5 44 287.0 45 274.0 46 247.0 47 240.5 48 228.0 49 195.0 50 164.0 51 136.5 52 99.0 53 71.0 54 53.0 55 44.0 56 33.5 57 22.0 58 16.0 59 10.5 60 5.0 61 4.0 62 5.0 63 5.0 64 5.5 65 4.0 66 3.5 67 4.5 68 2.5 69 0.5 70 1.0 71 1.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1625 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.1749999999999998 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.5125000000000002 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.2625 0.0 0.0 0.0 0.0 122-123 2.5375 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.975 0.0 0.0 0.0 0.0 134-135 5.449999999999999 0.0 0.0 0.0 0.0 136-137 6.3 0.0 0.0 0.0 0.0 138 6.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra Read 2789157 spots for SRR4237586.sra Written 2789157 spots for SRR4237586.sra Read 2789148 spots for SRR4237586.sra Written 2789148 spots for SRR4237586.sra SRR ids: ['SRR4237586.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7r2kfmfy SRR4237586.sra spots: 55782969 blocks: [[1, 2789148], [2789149, 5578296], [5578297, 8367444], [8367445, 11156592], [11156593, 13945740], [13945741, 16734888], [16734889, 19524036], [19524037, 22313184], [22313185, 25102332], [25102333, 27891480], [27891481, 30680628], [30680629, 33469776], [33469777, 36258924], [36258925, 39048072], [39048073, 41837220], [41837221, 44626368], [44626369, 47415516], [47415517, 50204664], [50204665, 52993812], [52993813, 55782969]] SRR4237586 file size 18772366 SRR4237586 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237586 SRR4237586_1.fastq SRR4237586_2.fastq Input file: SRR4237586_1.fastq Paired file: SRR4237586_2.fastq trimmed: SRR4237586-trimmed-pair1.fastq, SRR4237586-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:35:12 2025 >> started Wed Feb 12 12:36:16 2025 >> done (63.638s) 55782969 read pairs processed; of these: 55460 ( 0.10%) short read pairs filtered out after trimming by size control 81800 ( 0.15%) empty read pairs filtered out after trimming by size control 55645709 (99.75%) read pairs available; of these: 22628292 (40.66%) trimmed read pairs available after processing 33017417 (59.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 13 0.00% 20 9 0.00% 21 6 0.00% 22 7 0.00% 23 8 0.00% 24 16 0.00% 25 12 0.00% 26 19 0.00% 27 17 0.00% 28 16 0.00% 29 13 0.00% 30 29 0.00% 31 30 0.00% 32 25 0.00% 33 41 0.00% 34 35 0.00% 35 49 0.00% 36 48 0.00% 37 40 0.00% 38 46 0.00% 39 50 0.00% 40 64 0.00% 41 57 0.00% 42 82 0.00% 43 82 0.00% 44 99 0.00% 45 119 0.00% 46 113 0.00% 47 176 0.00% 48 180 0.00% 49 189 0.00% 50 168 0.00% 51 217 0.00% 52 229 0.00% 53 278 0.00% 54 270 0.00% 55 336 0.00% 56 351 0.00% 57 351 0.00% 58 441 0.00% 59 442 0.00% 60 533 0.00% 61 566 0.00% 62 661 0.00% 63 657 0.00% 64 840 0.00% 65 933 0.00% 66 1108 0.00% 67 1581 0.00% 68 2840 0.01% 69 8733 0.02% 70 5113 0.01% 71 2220 0.00% 72 2256 0.00% 73 2354 0.00% 74 2783 0.01% 75 2992 0.01% 76 3396 0.01% 77 3719 0.01% 78 4164 0.01% 79 4576 0.01% 80 5071 0.01% 81 5789 0.01% 82 6985 0.01% 83 7947 0.01% 84 12319 0.02% 85 13463 0.02% 86 14437 0.03% 87 15784 0.03% 88 16551 0.03% 89 17895 0.03% 90 18974 0.03% 91 20671 0.04% 92 22634 0.04% 93 24563 0.04% 94 26871 0.05% 95 29050 0.05% 96 31514 0.06% 97 34073 0.06% 98 35957 0.06% 99 38264 0.07% 100 40832 0.07% 101 43707 0.08% 102 47258 0.08% 103 50372 0.09% 104 54596 0.10% 105 58838 0.11% 106 63306 0.11% 107 66984 0.12% 108 70298 0.13% 109 73805 0.13% 110 77509 0.14% 111 81981 0.15% 112 86045 0.15% 113 90304 0.16% 114 95721 0.17% 115 102943 0.18% 116 106848 0.19% 117 112552 0.20% 118 118380 0.21% 119 121904 0.22% 120 126116 0.23% 121 131929 0.24% 122 135239 0.24% 123 141506 0.25% 124 149011 0.27% 125 155833 0.28% 126 162708 0.29% 127 170316 0.31% 128 178649 0.32% 129 185517 0.33% 130 193389 0.35% 131 199348 0.36% 132 206651 0.37% 133 215713 0.39% 134 225512 0.41% 135 236115 0.42% 136 251232 0.45% 137 266859 0.48% 138 284605 0.51% 139 301188 0.54% 140 322711 0.58% 141 349830 0.63% 142 382279 0.69% 143 424588 0.76% 144 484238 0.87% 145 580924 1.04% 146 734999 1.32% 147 1042744 1.87% 148 1889876 3.40% 149 10478866 18.83% 150 33017417 59.34% 55645709 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=32 prefix-density=0.23 prefix-fanout=2.5 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=10 fanout-score=144.93 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=23.3 sequence=TCATCTTCACAAAC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=2.1 sequence=AATAGGTTCTTGAAGACAGCTGCATACGGACATTTTGGAAGGGATGACCCAGACTTCACCTGGGAAGTTGTCAAGCCCCTCAAATGGGAGAAGCCTCAAGCTTAAGAGTGATTTATCCTATCCCTTTTGCGCAATGCTTATTTTATTGGTACTTATGAATAATTCGGTTTGTCTTGCTGCTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=31 fanout-score=164.86 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=16.7 sequence=TTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGCAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCCATGTAAATACGTACTGTGTTTTGTTTTTCAGTACTCATCTGCAATATGTCTCTTGTTGTTATGGTTCTACGGTTCTACCGTGCCTGGAACATCCTGAGCTGACTAGTTTTGTATTGATCTTTCTTTCT SRR4237586 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:36:56 Started mapping on | Feb 12 12:36:56 Finished on | Feb 12 12:41:28 Mapping speed, Million of reads per hour | 736.49 Number of input reads | 55645709 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 53174990 Uniquely mapped reads % | 95.56% Average mapped length | 292.18 Number of splices: Total | 40163168 Number of splices: Annotated (sjdb) | 39193706 Number of splices: GT/AG | 39459541 Number of splices: GC/AG | 518404 Number of splices: AT/AC | 46977 Number of splices: Non-canonical | 138246 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.03% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1147810 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 475416 % of reads mapped to too many loci | 0.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1383115 1383115 1383115 N_multimapping 1147810 1147810 1147810 N_noFeature 1882988 52257636 2311274 N_ambiguous 753782 5074 261263 UnstrandedReadsAssigned:50538220 PositiveStrandReadsAssigned:912280 NegativeStrandReadsAssigned:50602453 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237586 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237586-trimmed-pair1.fastq SRR4237586-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 55,645,709 reads, 50,863,025 reads pseudoaligned [quant] estimated average fragment length: 222.878 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR4237586.ke.tsv 34699 SRR4237586.se.tsv 87100 total ==> SRR4237586.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.12 2439 27.5649 Potri.005G024800.1.v4.1 1035 813.122 768 19.1728 Potri.004G059700.1.v4.1 961 739.14 63 1.73019 Potri.007G009000.2.v4.1 1416 1194.12 0 0 Potri.003G141000.2.v4.1 2943 2721.12 883.664 6.59204 Potri.016G087400.1.v4.1 270 83.3389 5495.34 1338.53 Potri.015G069301.1.v4.1 564 344.486 0 0 Potri.010G195200.1.v4.1 1773 1551.12 383 5.01226 Potri.012G127500.1.v4.1 977 755.14 7842 210.804 ==> SRR4237586.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16978 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 949 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 32 SRR4237586 completed mapping pipeline successfully