Starting /dee2/code/volunteer_pipeline.sh SRR4237587 current disk space = 3051254304768 free memory = 1575468688 SRR4237587 SRAfilesize 58a9246b026293257e6ded9961f1e6d4 SRR4237587.sra SRR4237587.sra file validated SRR4237587 is paired end SRR4237587 is conventional basespace SRR4237587 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237587_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.27725 34.0 33.0 34.0 33.0 34.0 2 33.3815 34.0 33.0 34.0 33.0 34.0 3 33.27525 34.0 33.0 34.0 33.0 34.0 4 33.33825 34.0 33.0 34.0 33.0 34.0 5 33.352 34.0 33.0 34.0 33.0 34.0 6 36.57075 38.0 37.0 38.0 35.0 38.0 7 37.33 38.0 38.0 38.0 37.0 38.0 8 37.09275 38.0 38.0 38.0 36.0 38.0 9 37.50625 38.0 38.0 38.0 37.0 38.0 10-14 37.19499999999999 38.0 38.0 38.0 36.4 38.0 15-19 37.5187 38.0 38.0 38.0 38.0 38.0 20-24 37.48649999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.49374999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.3954 38.0 38.0 38.0 37.6 38.0 35-39 37.245000000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.118849999999995 38.0 38.0 38.0 36.4 38.0 45-49 37.148 38.0 38.0 38.0 36.6 38.0 50-54 37.29639999999999 38.0 38.0 38.0 37.0 38.0 55-59 36.9832 38.0 38.0 38.0 36.0 38.0 60-64 37.0477 38.0 38.0 38.0 36.0 38.0 65-69 37.1552 38.0 38.0 38.0 36.4 38.0 70-74 37.09995 38.0 38.0 38.0 36.6 38.0 75-79 37.03975 38.0 38.0 38.0 36.0 38.0 80-84 37.0055 38.0 38.0 38.0 36.0 38.0 85-89 36.811400000000006 38.0 38.0 38.0 35.6 38.0 90-94 36.9177 38.0 38.0 38.0 35.8 38.0 95-99 36.82769999999999 38.0 38.0 38.0 35.6 38.0 100-104 36.740050000000004 38.0 38.0 38.0 35.2 38.0 105-109 36.83194999999999 38.0 38.0 38.0 35.6 38.0 110-114 36.6249 38.0 38.0 38.0 34.8 38.0 115-119 36.36045 38.0 38.0 38.0 34.2 38.0 120-124 36.4283 38.0 38.0 38.0 34.0 38.0 125-129 36.41445 38.0 38.0 38.0 34.0 38.0 130-134 36.250099999999996 38.0 38.0 38.0 33.8 38.0 135-139 36.0332 38.0 38.0 38.0 33.4 38.0 140-144 35.82600000000001 38.0 38.0 38.0 33.0 38.0 145-149 34.6888 38.0 35.8 38.0 28.0 38.0 150 30.628 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 3.0 18 2.0 19 5.0 20 5.0 21 4.0 22 1.0 23 8.0 24 5.0 25 5.0 26 15.0 27 17.0 28 19.0 29 29.0 30 42.0 31 43.0 32 63.0 33 104.0 34 113.0 35 166.0 36 400.0 37 2946.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.26039058587882 10.766149223835754 9.213820731096645 39.75963945918878 2 22.475 15.375 35.275 26.875 3 20.9 20.175 25.3 33.625 4 23.225 29.549999999999997 22.7 24.525 5 23.200000000000003 32.4 23.575 20.825 6 17.82828282828283 35.93434343434343 25.151515151515152 21.085858585858585 7 13.450000000000001 24.925 43.075 18.55 8 16.25 24.725 32.925 26.1 9 16.775000000000002 25.074999999999996 34.225 23.925 10-14 20.330000000000002 29.425 27.12 23.125 15-19 20.380000000000003 28.189999999999998 27.355 24.075 20-24 19.82 28.465 27.92 23.794999999999998 25-29 20.21 28.89 27.76 23.14 30-34 20.39 28.444999999999997 27.860000000000003 23.305 35-39 20.44 28.78 27.439999999999998 23.34 40-44 20.075000000000003 29.020000000000003 27.415 23.49 45-49 19.759999999999998 28.999999999999996 27.68 23.56 50-54 20.044999999999998 28.405 27.295 24.255 55-59 20.16 28.925 27.255000000000003 23.66 60-64 20.155 28.64 27.689999999999998 23.515 65-69 19.96 28.65 27.655 23.735 70-74 19.605 28.735 27.6 24.060000000000002 75-79 20.355 28.689999999999998 26.745 24.21 80-84 20.465 28.485 27.54 23.51 85-89 20.674999999999997 28.33 27.800000000000004 23.195 90-94 20.794999999999998 28.084999999999997 27.310000000000002 23.810000000000002 95-99 20.685000000000002 28.315 27.57 23.43 100-104 20.544999999999998 28.605000000000004 27.389999999999997 23.46 105-109 20.265 29.215000000000003 27.005000000000003 23.515 110-114 20.9 28.15 27.345000000000002 23.605 115-119 20.185 28.095 27.529999999999998 24.19 120-124 21.065 28.505000000000003 26.665 23.765 125-129 20.765 28.76 27.04 23.435 130-134 21.44 28.705000000000002 26.355 23.5 135-139 20.599999999999998 28.505000000000003 26.945000000000004 23.95 140-144 21.66 27.455000000000002 27.115000000000002 23.77 145-149 21.075 28.565 26.334999999999997 24.025 150 20.1 28.075 26.625 25.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.5 24 1.5 25 4.0 26 5.5 27 7.0 28 7.0 29 8.0 30 15.0 31 23.0 32 32.5 33 41.5 34 55.0 35 79.0 36 92.0 37 104.5 38 126.5 39 151.5 40 184.0 41 214.5 42 243.5 43 277.5 44 284.0 45 262.5 46 253.5 47 252.5 48 230.0 49 185.5 50 163.5 51 160.0 52 129.5 53 95.5 54 76.5 55 57.5 56 45.5 57 37.0 58 23.5 59 14.0 60 11.0 61 9.5 62 7.5 63 5.0 64 4.0 65 2.5 66 2.5 67 1.5 68 1.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.8624999999999998 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.7875 0.0 0.0 0.0 0.0 110-111 2.9875 0.0 0.0 0.0 0.0 112-113 3.15 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.8875 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.8875 0.0 0.0 0.0 0.0 122-123 5.5 0.0 0.0 0.0 0.0 124-125 6.025 0.0 0.0 0.0 0.0 126-127 6.5125 0.0 0.0 0.0 0.0 128-129 7.0125 0.0 0.0 0.0 0.0 130-131 7.4375 0.0 0.0 0.0 0.0 132-133 7.9624999999999995 0.0 0.0 0.0 0.0 134-135 8.575 0.0 0.0 0.0 0.0 136-137 9.1625 0.0 0.0 0.0 0.0 138 9.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTTCC 10 0.0067234724 145.74683 5 >>END_MODULE SRR4237587 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237587_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6695 33.0 33.0 34.0 32.0 34.0 2 32.851 34.0 33.0 34.0 32.0 34.0 3 32.937 34.0 33.0 34.0 32.0 34.0 4 32.225 33.0 33.0 34.0 31.0 34.0 5 32.70875 34.0 33.0 34.0 32.0 34.0 6 36.843 38.0 38.0 38.0 36.0 38.0 7 36.915 38.0 38.0 38.0 36.0 38.0 8 36.98175 38.0 38.0 38.0 36.0 38.0 9 36.846 38.0 38.0 38.0 36.0 38.0 10-14 36.95795 38.0 38.0 38.0 36.0 38.0 15-19 36.9358 38.0 38.0 38.0 35.8 38.0 20-24 36.86275 38.0 38.0 38.0 36.2 38.0 25-29 36.803250000000006 38.0 38.0 38.0 36.0 38.0 30-34 36.79895 38.0 38.0 38.0 35.8 38.0 35-39 36.44975 38.0 37.8 38.0 33.8 38.0 40-44 36.359849999999994 38.0 37.8 38.0 33.4 38.0 45-49 36.89665 38.0 38.0 38.0 36.0 38.0 50-54 36.7641 38.0 38.0 38.0 35.8 38.0 55-59 36.4404 38.0 38.0 38.0 34.0 38.0 60-64 36.7165 38.0 38.0 38.0 35.8 38.0 65-69 36.336850000000005 38.0 37.8 38.0 33.6 38.0 70-74 36.6294 38.0 38.0 38.0 35.2 38.0 75-79 36.61405 38.0 38.0 38.0 35.4 38.0 80-84 36.50635 38.0 38.0 38.0 34.8 38.0 85-89 36.363299999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.25895 38.0 38.0 38.0 33.8 38.0 95-99 36.249900000000004 38.0 38.0 38.0 34.2 38.0 100-104 36.24135 38.0 38.0 38.0 34.0 38.0 105-109 36.06975 38.0 38.0 38.0 33.8 38.0 110-114 36.098349999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.015699999999995 38.0 38.0 38.0 33.8 38.0 120-124 35.951800000000006 38.0 38.0 38.0 33.8 38.0 125-129 35.80345 38.0 38.0 38.0 33.2 38.0 130-134 35.6083 38.0 38.0 38.0 32.4 38.0 135-139 35.383449999999996 38.0 38.0 38.0 31.4 38.0 140-144 35.0784 38.0 37.0 38.0 30.8 38.0 145-149 34.70405 38.0 36.2 38.0 30.0 38.0 150 29.3705 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 3.0 5 0.0 6 3.0 7 1.0 8 4.0 9 1.0 10 0.0 11 1.0 12 2.0 13 4.0 14 8.0 15 4.0 16 6.0 17 10.0 18 5.0 19 7.0 20 3.0 21 9.0 22 10.0 23 9.0 24 10.0 25 20.0 26 24.0 27 28.0 28 33.0 29 39.0 30 44.0 31 51.0 32 66.0 33 72.0 34 118.0 35 170.0 36 393.0 37 2834.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.324999999999996 18.05 14.674999999999999 27.950000000000003 2 25.924999999999997 26.075 32.2 15.8 3 22.925 27.975 29.849999999999998 19.25 4 24.6 34.699999999999996 22.7 18.0 5 25.6 35.675000000000004 22.875 15.85 6 18.725 38.35 25.55 17.375 7 20.575 19.950000000000003 40.375 19.1 8 20.9 24.349999999999998 30.725 24.025 9 22.25 24.4 29.425 23.925 10-14 23.674999999999997 28.970000000000002 26.02 21.335 15-19 23.0 28.15 27.855 20.995 20-24 23.62 27.845 27.605 20.93 25-29 22.85 28.395 27.985 20.77 30-34 22.205 27.58 28.815 21.4 35-39 23.105 27.77 28.095 21.029999999999998 40-44 22.86 28.249999999999996 28.144999999999996 20.745 45-49 23.175 27.750000000000004 27.775 21.3 50-54 23.43 27.884999999999998 28.165000000000003 20.52 55-59 23.44 27.015 28.95 20.595 60-64 23.01 28.4 28.095 20.495 65-69 23.494999999999997 27.63 28.12 20.755000000000003 70-74 23.23 27.750000000000004 28.02 21.0 75-79 23.44 27.155 28.660000000000004 20.745 80-84 23.285 27.42 28.46 20.835 85-89 23.26 27.82 28.28 20.64 90-94 23.385 27.625 28.84 20.150000000000002 95-99 23.555 27.12 28.515 20.810000000000002 100-104 23.974999999999998 28.4 27.67 19.955000000000002 105-109 24.560000000000002 27.865000000000002 27.325 20.25 110-114 24.315 27.73 27.500000000000004 20.455000000000002 115-119 24.425 28.689999999999998 27.325 19.56 120-124 24.98 27.875 27.395000000000003 19.75 125-129 24.48 28.04 27.63 19.85 130-134 24.695 28.26 27.029999999999998 20.015 135-139 24.959999999999997 27.96 27.150000000000002 19.93 140-144 25.46 28.205000000000002 26.645000000000003 19.689999999999998 145-149 25.66 28.4 26.345000000000002 19.595000000000002 150 25.45 27.950000000000003 27.525 19.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.5 19 1.5 20 1.0 21 1.5 22 1.5 23 1.0 24 3.5 25 7.0 26 6.5 27 5.0 28 7.5 29 11.0 30 12.5 31 17.0 32 20.5 33 31.5 34 53.5 35 64.0 36 75.0 37 103.0 38 126.5 39 164.0 40 194.5 41 221.0 42 276.5 43 296.5 44 268.5 45 286.5 46 285.0 47 262.5 48 243.5 49 187.0 50 148.0 51 127.0 52 108.5 53 91.0 54 77.0 55 48.5 56 38.5 57 36.0 58 22.0 59 15.5 60 10.5 61 7.0 62 6.5 63 6.0 64 3.5 65 3.5 66 4.5 67 3.5 68 2.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 2.9625 0.0 0.0 0.0 0.0 112-113 3.125 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.8875 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 4.9125 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 6.0375 0.0 0.0 0.0 0.0 126-127 6.4875 0.0 0.0 0.0 0.0 128-129 6.9625 0.0 0.0 0.0 0.0 130-131 7.4 0.0 0.0 0.0 0.0 132-133 7.949999999999999 0.0 0.0 0.0 0.0 134-135 8.5625 0.0 0.0 0.0 0.0 136-137 9.2 0.0 0.0 0.0 0.0 138 9.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCAG 10 0.006973645 144.0 9 AATATGT 10 0.006973645 144.0 3 >>END_MODULE Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812177 spots for SRR4237587.sra Written 2812177 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra Read 2812170 spots for SRR4237587.sra Written 2812170 spots for SRR4237587.sra SRR ids: ['SRR4237587.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b2sr1hue SRR4237587.sra spots: 56243407 blocks: [[1, 2812170], [2812171, 5624340], [5624341, 8436510], [8436511, 11248680], [11248681, 14060850], [14060851, 16873020], [16873021, 19685190], [19685191, 22497360], [22497361, 25309530], [25309531, 28121700], [28121701, 30933870], [30933871, 33746040], [33746041, 36558210], [36558211, 39370380], [39370381, 42182550], [42182551, 44994720], [44994721, 47806890], [47806891, 50619060], [50619061, 53431230], [53431231, 56243407]] SRR4237587 file size 18927494 SRR4237587 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237587 SRR4237587_1.fastq SRR4237587_2.fastq Input file: SRR4237587_1.fastq Paired file: SRR4237587_2.fastq trimmed: SRR4237587-trimmed-pair1.fastq, SRR4237587-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:02:51 2025 >> started Wed Feb 12 13:03:53 2025 >> done (62.353s) 56243407 read pairs processed; of these: 100467 ( 0.18%) short read pairs filtered out after trimming by size control 65618 ( 0.12%) empty read pairs filtered out after trimming by size control 56077322 (99.70%) read pairs available; of these: 18286831 (32.61%) trimmed read pairs available after processing 37790491 (67.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 17 0.00% 20 20 0.00% 21 8 0.00% 22 12 0.00% 23 20 0.00% 24 10 0.00% 25 13 0.00% 26 20 0.00% 27 18 0.00% 28 26 0.00% 29 36 0.00% 30 42 0.00% 31 51 0.00% 32 63 0.00% 33 62 0.00% 34 75 0.00% 35 84 0.00% 36 113 0.00% 37 141 0.00% 38 135 0.00% 39 153 0.00% 40 179 0.00% 41 216 0.00% 42 238 0.00% 43 245 0.00% 44 278 0.00% 45 359 0.00% 46 369 0.00% 47 410 0.00% 48 478 0.00% 49 514 0.00% 50 651 0.00% 51 688 0.00% 52 716 0.00% 53 850 0.00% 54 886 0.00% 55 995 0.00% 56 1085 0.00% 57 1247 0.00% 58 1426 0.00% 59 1577 0.00% 60 1758 0.00% 61 1983 0.00% 62 2249 0.00% 63 2490 0.00% 64 2742 0.00% 65 3138 0.01% 66 3515 0.01% 67 4390 0.01% 68 5497 0.01% 69 13757 0.02% 70 12507 0.02% 71 6952 0.01% 72 6953 0.01% 73 7854 0.01% 74 8460 0.02% 75 9716 0.02% 76 10432 0.02% 77 11225 0.02% 78 12389 0.02% 79 13739 0.02% 80 15375 0.03% 81 17188 0.03% 82 18886 0.03% 83 21444 0.04% 84 34883 0.06% 85 35420 0.06% 86 30272 0.05% 87 32322 0.06% 88 35291 0.06% 89 38658 0.07% 90 41892 0.07% 91 44739 0.08% 92 57032 0.10% 93 52242 0.09% 94 56745 0.10% 95 58025 0.10% 96 60695 0.11% 97 64160 0.11% 98 67014 0.12% 99 69936 0.12% 100 73830 0.13% 101 77393 0.14% 102 81172 0.14% 103 85874 0.15% 104 89666 0.16% 105 94470 0.17% 106 98904 0.18% 107 102246 0.18% 108 107887 0.19% 109 111912 0.20% 110 112936 0.20% 111 116375 0.21% 112 121858 0.22% 113 123060 0.22% 114 128783 0.23% 115 133360 0.24% 116 136511 0.24% 117 140484 0.25% 118 147065 0.26% 119 148652 0.27% 120 151841 0.27% 121 157325 0.28% 122 158975 0.28% 123 162676 0.29% 124 167616 0.30% 125 172482 0.31% 126 176714 0.32% 127 182579 0.33% 128 186417 0.33% 129 190308 0.34% 130 195973 0.35% 131 199573 0.36% 132 205215 0.37% 133 211166 0.38% 134 216420 0.39% 135 222701 0.40% 136 231685 0.41% 137 238731 0.43% 138 248996 0.44% 139 257710 0.46% 140 269859 0.48% 141 283251 0.51% 142 302676 0.54% 143 325923 0.58% 144 361233 0.64% 145 412183 0.74% 146 501137 0.89% 147 670559 1.20% 148 1120502 2.00% 149 6863458 12.24% 150 37790491 67.39% 56077322 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=9.85 fanout-score-rank=12 prefix-density=0.32 prefix-fanout=5.8 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAAAGCACAGCTGGGATACAAAAGAAAACTGTAAGAAGCAAAAAGGTAGGAGTGATTATCACAGAAGAGGATGAAGAAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=275.31 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=30.6 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=30 prefix-density=0.21 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=502.47 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=18.8 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCTGGCAAGTGCAAGCTTCCTCACCCTGCTAATTGCTAGACTACCGATCGTAATCGATCCAAGGGTTTTCCTCTACATATATGTATCATGTCATAAACGTC SRR4237587 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:04:34 Started mapping on | Feb 12 13:04:35 Finished on | Feb 12 13:09:05 Mapping speed, Million of reads per hour | 747.70 Number of input reads | 56077322 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 54315606 Uniquely mapped reads % | 96.86% Average mapped length | 290.38 Number of splices: Total | 50309221 Number of splices: Annotated (sjdb) | 49458666 Number of splices: GT/AG | 49565827 Number of splices: GC/AG | 587080 Number of splices: AT/AC | 44267 Number of splices: Non-canonical | 112047 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1058675 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 64889 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.11% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 751103 751103 751103 N_multimapping 1058675 1058675 1058675 N_noFeature 1381860 53663893 1771881 N_ambiguous 485488 3630 220772 UnstrandedReadsAssigned:52448258 PositiveStrandReadsAssigned:648083 NegativeStrandReadsAssigned:52322953 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237587 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237587-trimmed-pair1.fastq SRR4237587-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,077,322 reads, 52,012,428 reads pseudoaligned [quant] estimated average fragment length: 227.238 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR4237587.ke.tsv 34699 SRR4237587.se.tsv 87100 total ==> SRR4237587.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.76 1281 15.0308 Potri.005G024800.1.v4.1 1035 808.762 121 3.14541 Potri.004G059700.1.v4.1 961 734.793 40 1.14448 Potri.007G009000.2.v4.1 1416 1189.76 0 0 Potri.003G141000.2.v4.1 2943 2716.76 886.278 6.85854 Potri.016G087400.1.v4.1 270 90.0592 5797 1353.28 Potri.015G069301.1.v4.1 564 342.617 0 0 Potri.010G195200.1.v4.1 1773 1546.76 60 0.815531 Potri.012G127500.1.v4.1 977 750.781 14116 395.286 ==> SRR4237587.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5447 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 839 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237587 completed mapping pipeline successfully