Starting /dee2/code/volunteer_pipeline.sh SRR4237588 current disk space = 3051263401984 free memory = 1582736052 SRR4237588 SRAfilesize 97c5beffc55f6bee0d1c3eb645a150b7 SRR4237588.sra SRR4237588.sra file validated SRR4237588 is paired end SRR4237588 is conventional basespace SRR4237588 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237588_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.40475 34.0 33.0 34.0 33.0 34.0 2 33.46575 34.0 34.0 34.0 33.0 34.0 3 33.45125 34.0 34.0 34.0 33.0 34.0 4 33.49225 34.0 34.0 34.0 33.0 34.0 5 33.444 34.0 34.0 34.0 33.0 34.0 6 36.90875 38.0 37.0 38.0 36.0 38.0 7 37.34425 38.0 38.0 38.0 37.0 38.0 8 37.5315 38.0 38.0 38.0 38.0 38.0 9 37.5745 38.0 38.0 38.0 38.0 38.0 10-14 37.590250000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.5947 38.0 38.0 38.0 38.0 38.0 20-24 37.560649999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.53635 38.0 38.0 38.0 38.0 38.0 30-34 37.50995 38.0 38.0 38.0 38.0 38.0 35-39 37.5364 38.0 38.0 38.0 37.8 38.0 40-44 37.395950000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.40604999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.3548 38.0 38.0 38.0 37.0 38.0 55-59 37.31054999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.28415 38.0 38.0 38.0 37.0 38.0 65-69 37.231899999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.07495 38.0 38.0 38.0 36.4 38.0 75-79 36.92075 38.0 38.0 38.0 35.4 38.0 80-84 37.069449999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.656150000000004 38.0 37.8 38.0 34.4 38.0 90-94 36.59715 38.0 37.8 38.0 34.8 38.0 95-99 36.99045 38.0 38.0 38.0 36.0 38.0 100-104 36.99249999999999 38.0 38.0 38.0 36.0 38.0 105-109 36.85265 38.0 38.0 38.0 35.2 38.0 110-114 36.589150000000004 38.0 38.0 38.0 34.4 38.0 115-119 36.7779 38.0 38.0 38.0 35.0 38.0 120-124 36.633 38.0 38.0 38.0 34.6 38.0 125-129 36.5499 38.0 38.0 38.0 34.4 38.0 130-134 36.415000000000006 38.0 38.0 38.0 34.0 38.0 135-139 36.197250000000004 38.0 37.8 38.0 33.6 38.0 140-144 35.94644999999999 38.0 37.8 38.0 33.0 38.0 145-149 35.49400000000001 38.0 37.2 38.0 32.6 38.0 150 31.2845 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 0.0 21 3.0 22 3.0 23 8.0 24 7.0 25 7.0 26 13.0 27 15.0 28 22.0 29 24.0 30 33.0 31 50.0 32 47.0 33 66.0 34 105.0 35 156.0 36 372.0 37 3065.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.055041280960715 12.05904428321241 9.457092819614711 38.42882161621216 2 22.225 16.45 33.825 27.500000000000004 3 19.025 20.0 25.324999999999996 35.65 4 22.275 28.95 23.150000000000002 25.624999999999996 5 22.6 34.25 22.95 20.200000000000003 6 18.533400301356103 36.790557508789554 23.681567051732795 20.994475138121548 7 13.4 27.775 40.975 17.849999999999998 8 16.650000000000002 25.624999999999996 32.45 25.275 9 17.125 23.7 34.375 24.8 10-14 19.17 30.53 27.27 23.03 15-19 19.445 29.82 27.495000000000005 23.24 20-24 19.439999999999998 29.54 27.195000000000004 23.825 25-29 19.35 29.985 27.295 23.369999999999997 30-34 19.345000000000002 29.060000000000002 27.405 24.19 35-39 19.245 29.24 27.400000000000002 24.115000000000002 40-44 19.759999999999998 29.53 27.47 23.24 45-49 19.465 28.915000000000003 27.37 24.25 50-54 19.63 29.304999999999996 27.68 23.385 55-59 19.865 29.345 27.1 23.69 60-64 19.875 29.354999999999997 26.784999999999997 23.985 65-69 19.919999999999998 29.154999999999998 27.105 23.82 70-74 19.985 29.265 27.169999999999998 23.580000000000002 75-79 20.05 28.765 27.85 23.335 80-84 19.939999999999998 29.549999999999997 27.555000000000003 22.955000000000002 85-89 19.835 29.044999999999998 26.945000000000004 24.175 90-94 19.82 28.720000000000002 27.189999999999998 24.27 95-99 19.435 28.78 27.63 24.154999999999998 100-104 20.495 28.83 27.18 23.494999999999997 105-109 19.52 28.325 27.939999999999998 24.215 110-114 20.365 28.68 27.029999999999998 23.925 115-119 20.13 28.88 27.07 23.919999999999998 120-124 20.77 28.139999999999997 26.779999999999998 24.310000000000002 125-129 19.96 28.315 27.825 23.9 130-134 20.13 28.744999999999997 27.1 24.025 135-139 20.57 28.42 27.034999999999997 23.974999999999998 140-144 20.71 28.955 26.595000000000002 23.74 145-149 20.57 28.89 26.66 23.880000000000003 150 20.45 28.849999999999998 27.525 23.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.5 25 5.0 26 7.5 27 9.0 28 8.0 29 15.0 30 25.0 31 35.5 32 39.0 33 46.5 34 62.5 35 73.5 36 89.0 37 107.0 38 129.5 39 167.5 40 202.0 41 225.5 42 247.0 43 274.5 44 277.5 45 265.5 46 265.5 47 239.0 48 218.5 49 204.0 50 174.0 51 139.5 52 99.0 53 79.0 54 73.0 55 57.0 56 36.0 57 24.0 58 20.0 59 13.5 60 9.0 61 6.5 62 3.5 63 3.0 64 4.0 65 5.0 66 3.5 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.44999999999999996 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.25 0.0 0.0 0.0 0.0 134-135 4.487500000000001 0.0 0.0 0.0 0.0 136-137 4.725 0.0 0.0 0.0 0.0 138 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTTGT 10 0.006973645 144.0 9 >>END_MODULE SRR4237588 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237588_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.054 34.0 33.0 34.0 32.0 34.0 2 33.066 34.0 33.0 34.0 33.0 34.0 3 33.13125 34.0 33.0 34.0 33.0 34.0 4 33.14975 34.0 33.0 34.0 33.0 34.0 5 33.13 34.0 33.0 34.0 33.0 34.0 6 37.1935 38.0 38.0 38.0 37.0 38.0 7 37.30425 38.0 38.0 38.0 37.0 38.0 8 37.15225 38.0 38.0 38.0 37.0 38.0 9 37.18225 38.0 38.0 38.0 37.0 38.0 10-14 37.19865 38.0 38.0 38.0 37.4 38.0 15-19 37.1731 38.0 38.0 38.0 37.0 38.0 20-24 37.15050000000001 38.0 38.0 38.0 37.0 38.0 25-29 36.60615 38.0 38.0 38.0 34.4 38.0 30-34 37.071299999999994 38.0 38.0 38.0 37.0 38.0 35-39 36.86 38.0 38.0 38.0 36.2 38.0 40-44 36.82735 38.0 38.0 38.0 36.2 38.0 45-49 36.6215 38.0 38.0 38.0 35.0 38.0 50-54 36.92530000000001 38.0 38.0 38.0 36.6 38.0 55-59 37.0725 38.0 38.0 38.0 37.0 38.0 60-64 37.06335 38.0 38.0 38.0 37.0 38.0 65-69 37.03575 38.0 38.0 38.0 37.0 38.0 70-74 36.924150000000004 38.0 38.0 38.0 36.6 38.0 75-79 37.0356 38.0 38.0 38.0 37.0 38.0 80-84 36.9207 38.0 38.0 38.0 36.4 38.0 85-89 36.927749999999996 38.0 38.0 38.0 36.4 38.0 90-94 36.880399999999995 38.0 38.0 38.0 36.2 38.0 95-99 36.8651 38.0 38.0 38.0 36.0 38.0 100-104 36.84375 38.0 38.0 38.0 36.0 38.0 105-109 36.6263 38.0 38.0 38.0 35.4 38.0 110-114 36.63015 38.0 38.0 38.0 35.4 38.0 115-119 36.5155 38.0 38.0 38.0 34.8 38.0 120-124 36.44695 38.0 38.0 38.0 35.0 38.0 125-129 36.379799999999996 38.0 38.0 38.0 34.8 38.0 130-134 36.2953 38.0 38.0 38.0 34.4 38.0 135-139 36.1677 38.0 38.0 38.0 34.0 38.0 140-144 35.8326 38.0 38.0 38.0 33.4 38.0 145-149 35.65775 38.0 38.0 38.0 33.4 38.0 150 30.85425 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 4.0 5 0.0 6 1.0 7 4.0 8 0.0 9 1.0 10 0.0 11 4.0 12 0.0 13 1.0 14 2.0 15 7.0 16 1.0 17 2.0 18 4.0 19 5.0 20 6.0 21 6.0 22 6.0 23 11.0 24 16.0 25 11.0 26 16.0 27 13.0 28 16.0 29 27.0 30 20.0 31 41.0 32 43.0 33 74.0 34 90.0 35 121.0 36 299.0 37 3141.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.25 21.125 13.275 25.35 2 28.299999999999997 26.150000000000002 31.175000000000004 14.374999999999998 3 21.025 28.4 30.925000000000004 19.650000000000002 4 24.725 34.175 21.975 19.125 5 24.45 37.775 22.7 15.075 6 20.375 38.275 23.474999999999998 17.875 7 19.825 22.025 40.525 17.625 8 23.599999999999998 24.8 28.4 23.200000000000003 9 21.825 25.474999999999998 28.999999999999996 23.7 10-14 24.365000000000002 29.049999999999997 26.08 20.505000000000003 15-19 23.494999999999997 28.37 27.515 20.62 20-24 24.005000000000003 28.08 27.61 20.305 25-29 23.385 27.889999999999997 28.325 20.4 30-34 22.945 27.944999999999997 28.175 20.935000000000002 35-39 23.815 27.339999999999996 28.115000000000002 20.73 40-44 23.935000000000002 27.01 28.470000000000002 20.585 45-49 23.62 27.55 27.955000000000002 20.875 50-54 23.31 28.28 28.035 20.375 55-59 24.474999999999998 27.839999999999996 27.744999999999997 19.939999999999998 60-64 24.22 27.584999999999997 28.08 20.115 65-69 24.23 28.09 27.700000000000003 19.98 70-74 24.224999999999998 27.425 28.110000000000003 20.24 75-79 23.39 27.88 28.744999999999997 19.985 80-84 23.695 27.88 28.134999999999998 20.29 85-89 24.0 28.199999999999996 28.43 19.37 90-94 23.425 27.785 28.994999999999997 19.794999999999998 95-99 23.445 27.755000000000003 29.049999999999997 19.75 100-104 24.325 27.889999999999997 28.139999999999997 19.645000000000003 105-109 23.724999999999998 27.785 28.24 20.25 110-114 23.745 27.665 28.665000000000003 19.925 115-119 24.37 27.38 28.410000000000004 19.84 120-124 23.9 27.384999999999998 28.62 20.095 125-129 24.63 27.49 28.025 19.855 130-134 24.235 27.72 27.915 20.13 135-139 24.610000000000003 27.37 28.475 19.545 140-144 24.705 27.495000000000005 28.050000000000004 19.75 145-149 25.095 27.744999999999997 27.994999999999997 19.165 150 25.224999999999998 26.275 28.199999999999996 20.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 1.5 22 1.5 23 0.0 24 1.0 25 1.5 26 1.5 27 5.0 28 6.0 29 6.5 30 15.5 31 16.0 32 20.0 33 37.0 34 53.0 35 65.5 36 86.5 37 106.0 38 132.0 39 158.5 40 196.5 41 230.0 42 250.5 43 291.0 44 296.0 45 281.0 46 282.5 47 269.5 48 233.0 49 195.0 50 167.5 51 136.0 52 111.0 53 92.0 54 66.5 55 54.0 56 41.0 57 26.5 58 18.0 59 14.0 60 10.5 61 5.5 62 3.0 63 2.0 64 2.0 65 2.0 66 1.0 67 0.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 2.025 0.0 0.0 0.0 0.0 120-121 2.275 0.0 0.0 0.0 0.0 122-123 2.6500000000000004 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.6 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.325 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 4.7875 0.0 0.0 0.0 0.0 138 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGTT 10 0.006973645 144.0 5 >>END_MODULE Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962458 spots for SRR4237588.sra Written 1962458 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra Read 1962446 spots for SRR4237588.sra Written 1962446 spots for SRR4237588.sra SRR ids: ['SRR4237588.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ykg80vvp SRR4237588.sra spots: 39248932 blocks: [[1, 1962446], [1962447, 3924892], [3924893, 5887338], [5887339, 7849784], [7849785, 9812230], [9812231, 11774676], [11774677, 13737122], [13737123, 15699568], [15699569, 17662014], [17662015, 19624460], [19624461, 21586906], [21586907, 23549352], [23549353, 25511798], [25511799, 27474244], [27474245, 29436690], [29436691, 31399136], [31399137, 33361582], [33361583, 35324028], [35324029, 37286474], [37286475, 39248932]] SRR4237588 file size 13201816 SRR4237588 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237588 SRR4237588_1.fastq SRR4237588_2.fastq Input file: SRR4237588_1.fastq Paired file: SRR4237588_2.fastq trimmed: SRR4237588-trimmed-pair1.fastq, SRR4237588-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:56:42 2025 >> started Wed Feb 12 12:57:23 2025 >> done (41.245s) 39248932 read pairs processed; of these: 77685 ( 0.20%) short read pairs filtered out after trimming by size control 30532 ( 0.08%) empty read pairs filtered out after trimming by size control 39140715 (99.72%) read pairs available; of these: 10635733 (27.17%) trimmed read pairs available after processing 28504982 (72.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 6 0.00% 21 7 0.00% 22 9 0.00% 23 7 0.00% 24 8 0.00% 25 12 0.00% 26 10 0.00% 27 11 0.00% 28 5 0.00% 29 21 0.00% 30 22 0.00% 31 13 0.00% 32 19 0.00% 33 18 0.00% 34 23 0.00% 35 21 0.00% 36 27 0.00% 37 24 0.00% 38 42 0.00% 39 48 0.00% 40 49 0.00% 41 43 0.00% 42 45 0.00% 43 43 0.00% 44 57 0.00% 45 69 0.00% 46 69 0.00% 47 85 0.00% 48 77 0.00% 49 117 0.00% 50 126 0.00% 51 131 0.00% 52 140 0.00% 53 155 0.00% 54 170 0.00% 55 172 0.00% 56 197 0.00% 57 209 0.00% 58 233 0.00% 59 281 0.00% 60 307 0.00% 61 330 0.00% 62 365 0.00% 63 431 0.00% 64 511 0.00% 65 605 0.00% 66 696 0.00% 67 803 0.00% 68 1113 0.00% 69 4175 0.01% 70 5025 0.01% 71 2663 0.01% 72 1763 0.00% 73 1652 0.00% 74 1799 0.00% 75 1852 0.00% 76 2008 0.01% 77 2236 0.01% 78 2445 0.01% 79 2783 0.01% 80 3088 0.01% 81 3448 0.01% 82 4011 0.01% 83 4930 0.01% 84 12843 0.03% 85 10000 0.03% 86 9927 0.03% 87 11791 0.03% 88 12810 0.03% 89 10252 0.03% 90 11380 0.03% 91 12169 0.03% 92 15315 0.04% 93 14953 0.04% 94 17416 0.04% 95 16961 0.04% 96 17325 0.04% 97 18488 0.05% 98 19147 0.05% 99 20760 0.05% 100 22023 0.06% 101 23531 0.06% 102 24884 0.06% 103 26803 0.07% 104 28155 0.07% 105 29997 0.08% 106 32479 0.08% 107 36179 0.09% 108 36388 0.09% 109 37881 0.10% 110 39081 0.10% 111 41628 0.11% 112 44014 0.11% 113 46007 0.12% 114 48492 0.12% 115 52045 0.13% 116 53720 0.14% 117 56988 0.15% 118 59636 0.15% 119 62064 0.16% 120 66155 0.17% 121 67593 0.17% 122 73294 0.19% 123 72478 0.19% 124 76659 0.20% 125 78691 0.20% 126 82443 0.21% 127 85903 0.22% 128 89549 0.23% 129 92778 0.24% 130 96444 0.25% 131 99684 0.25% 132 103730 0.27% 133 108041 0.28% 134 112172 0.29% 135 117928 0.30% 136 128226 0.33% 137 130598 0.33% 138 137199 0.35% 139 144702 0.37% 140 152847 0.39% 141 163279 0.42% 142 176671 0.45% 143 190418 0.49% 144 214950 0.55% 145 247883 0.63% 146 302930 0.77% 147 440306 1.12% 148 713017 1.82% 149 4983758 12.73% 150 28504982 72.83% 39140715 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.67 fanout-score-rank=44 prefix-density=0.27 prefix-fanout=1.0 sequence=CACTAGCTAGACGTGCAAGATTCAACCTACACACAAGAACCCACTAGATAGACTTCCACTGGAACCATGCAGCATTCTCCCGTGATGACCTCATTACTCAGTCTTTTCTACTGGGGTTTCTGTTTCAACCTTCTCCTCTGTTTCAACAGGCTTCTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=112.99 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=12.3 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=25.05 fanout-score-rank=5 prefix-density=0.46 prefix-fanout=10.0 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=55.54 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.4 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR4237588 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:58:08 Started mapping on | Feb 12 12:58:08 Finished on | Feb 12 13:01:39 Mapping speed, Million of reads per hour | 667.80 Number of input reads | 39140715 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 37695935 Uniquely mapped reads % | 96.31% Average mapped length | 294.16 Number of splices: Total | 32756930 Number of splices: Annotated (sjdb) | 32183146 Number of splices: GT/AG | 32274509 Number of splices: GC/AG | 375524 Number of splices: AT/AC | 29584 Number of splices: Non-canonical | 77313 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.38 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 754844 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 77066 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 724952 724952 724952 N_multimapping 754844 754844 754844 N_noFeature 969711 37190284 1229290 N_ambiguous 398380 2659 150184 UnstrandedReadsAssigned:36327844 PositiveStrandReadsAssigned:502992 NegativeStrandReadsAssigned:36316461 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237588 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237588-trimmed-pair1.fastq SRR4237588-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,140,715 reads, 36,137,846 reads pseudoaligned [quant] estimated average fragment length: 234.502 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR4237588.ke.tsv 34699 SRR4237588.se.tsv 87100 total ==> SRR4237588.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.5 951 14.4396 Potri.005G024800.1.v4.1 1035 801.498 79 2.67063 Potri.004G059700.1.v4.1 961 727.529 15 0.558637 Potri.007G009000.2.v4.1 1416 1182.5 0 0 Potri.003G141000.2.v4.1 2943 2709.5 490.183 4.90183 Potri.016G087400.1.v4.1 270 79.7581 4993.19 1696.26 Potri.015G069301.1.v4.1 564 334.071 0 0 Potri.010G195200.1.v4.1 1773 1539.5 60 1.05599 Potri.012G127500.1.v4.1 977 743.519 9022 328.776 ==> SRR4237588.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5709 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 669 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237588 completed mapping pipeline successfully