Starting /dee2/code/volunteer_pipeline.sh SRR4237589 current disk space = 3051202113536 free memory = 1575755348 SRR4237589 SRAfilesize 5278101d5f524a245b7ea0890b92b4cb SRR4237589.sra SRR4237589.sra file validated SRR4237589 is paired end SRR4237589 is conventional basespace SRR4237589 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237589_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.271 34.0 33.0 34.0 33.0 34.0 2 33.3595 34.0 33.0 34.0 33.0 34.0 3 33.322 34.0 33.0 34.0 33.0 34.0 4 33.279 34.0 33.0 34.0 33.0 34.0 5 33.2745 34.0 33.0 34.0 33.0 34.0 6 36.1075 38.0 37.0 38.0 34.0 38.0 7 37.15175 38.0 38.0 38.0 36.0 38.0 8 37.256 38.0 38.0 38.0 36.0 38.0 9 37.39625 38.0 38.0 38.0 37.0 38.0 10-14 37.47585 38.0 38.0 38.0 37.4 38.0 15-19 37.44070000000001 38.0 38.0 38.0 37.2 38.0 20-24 36.487 38.0 37.4 38.0 33.4 38.0 25-29 37.370850000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.4025 38.0 38.0 38.0 37.0 38.0 35-39 37.3802 38.0 38.0 38.0 37.0 38.0 40-44 37.2653 38.0 38.0 38.0 36.8 38.0 45-49 37.2603 38.0 38.0 38.0 36.8 38.0 50-54 37.1086 38.0 38.0 38.0 36.0 38.0 55-59 37.05195 38.0 38.0 38.0 35.8 38.0 60-64 37.106700000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.06755 38.0 38.0 38.0 36.0 38.0 70-74 36.47035000000001 38.0 37.4 38.0 33.2 38.0 75-79 36.97965000000001 38.0 38.0 38.0 35.6 38.0 80-84 36.81445 38.0 37.8 38.0 34.8 38.0 85-89 36.8412 38.0 38.0 38.0 35.0 38.0 90-94 36.859449999999995 38.0 38.0 38.0 35.4 38.0 95-99 36.853500000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.725300000000004 38.0 38.0 38.0 34.8 38.0 105-109 36.674150000000004 38.0 38.0 38.0 34.4 38.0 110-114 35.72655 38.0 36.6 38.0 29.2 38.0 115-119 36.47265 38.0 38.0 38.0 34.0 38.0 120-124 35.974450000000004 38.0 37.0 38.0 32.0 38.0 125-129 36.287400000000005 38.0 38.0 38.0 34.0 38.0 130-134 35.8913 38.0 37.0 38.0 32.0 38.0 135-139 34.351749999999996 37.8 33.6 38.0 25.6 38.0 140-144 35.713800000000006 38.0 36.2 38.0 32.4 38.0 145-149 35.4086 38.0 36.0 38.0 32.2 38.0 150 30.68125 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 4.0 20 1.0 21 6.0 22 3.0 23 7.0 24 7.0 25 5.0 26 16.0 27 22.0 28 14.0 29 38.0 30 39.0 31 49.0 32 76.0 33 91.0 34 135.0 35 260.0 36 592.0 37 2633.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.28928928928929 13.463463463463462 9.534534534534535 37.712712712712715 2 23.075000000000003 15.875 33.725 27.325 3 19.725 21.575 26.85 31.85 4 24.15 30.125 22.55 23.175 5 23.35 32.425 23.05 21.175 6 16.946564885496183 36.23409669211196 25.521628498727733 21.297709923664122 7 13.775 27.224999999999998 41.4 17.599999999999998 8 16.525000000000002 25.624999999999996 32.9 24.95 9 17.8 24.65 33.4 24.15 10-14 19.435 29.835 27.36 23.369999999999997 15-19 19.939999999999998 29.015 27.48 23.565 20-24 19.955000000000002 28.78 28.02 23.244999999999997 25-29 19.425 29.775000000000002 27.384999999999998 23.415 30-34 19.41 29.465000000000003 27.800000000000004 23.325000000000003 35-39 20.47 29.049999999999997 27.01 23.47 40-44 19.74 29.26 27.47 23.53 45-49 20.119999999999997 28.48 27.43 23.97 50-54 19.405 29.304999999999996 27.150000000000002 24.14 55-59 20.235 28.89 27.834999999999997 23.04 60-64 19.715 29.765000000000004 27.275 23.244999999999997 65-69 19.775000000000002 28.99 27.575 23.66 70-74 20.395 29.12 26.71 23.775 75-79 19.869999999999997 28.67 27.58 23.880000000000003 80-84 20.555 28.835 27.165 23.445 85-89 20.125 28.325 27.96 23.59 90-94 20.31 28.599999999999998 27.589999999999996 23.5 95-99 19.765 29.12 27.400000000000002 23.715 100-104 20.51 29.215000000000003 27.3 22.975 105-109 20.595 28.7 27.474999999999998 23.23 110-114 20.724999999999998 28.575 27.169999999999998 23.53 115-119 20.625 29.020000000000003 26.784999999999997 23.57 120-124 20.855 29.095 26.96 23.09 125-129 20.215 28.634999999999998 27.16 23.990000000000002 130-134 20.86 28.925 26.395000000000003 23.82 135-139 20.724999999999998 29.625 26.025 23.625 140-144 21.66 28.294999999999998 26.375 23.669999999999998 145-149 21.19 28.560000000000002 26.495 23.755000000000003 150 19.82974461692539 28.31747621432148 26.364546820230345 25.488232348522782 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 1.0 24 2.0 25 5.0 26 7.5 27 7.0 28 9.5 29 17.5 30 22.5 31 31.0 32 44.0 33 51.0 34 61.0 35 79.5 36 91.5 37 99.0 38 131.5 39 170.0 40 189.5 41 218.0 42 241.5 43 254.5 44 270.0 45 275.0 46 270.5 47 257.5 48 231.0 49 198.0 50 167.5 51 135.0 52 117.0 53 94.0 54 62.5 55 45.0 56 35.5 57 27.5 58 19.0 59 15.0 60 8.0 61 3.5 62 5.5 63 5.5 64 4.5 65 4.0 66 3.0 67 1.5 68 1.5 69 2.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 1.7500000000000002 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 3.025 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.449999999999999 0.0 0.0 0.0 0.0 138 6.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237589 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237589_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73975 33.0 33.0 34.0 32.0 34.0 2 32.70175 34.0 33.0 34.0 32.0 34.0 3 32.85175 34.0 33.0 34.0 32.0 34.0 4 32.822 34.0 33.0 34.0 32.0 34.0 5 32.8875 34.0 33.0 34.0 32.0 34.0 6 35.076 38.0 37.0 38.0 26.0 38.0 7 36.56125 38.0 38.0 38.0 34.0 38.0 8 36.6655 38.0 38.0 38.0 35.0 38.0 9 36.80775 38.0 38.0 38.0 36.0 38.0 10-14 36.60415 38.0 38.0 38.0 34.8 38.0 15-19 36.82795 38.0 38.0 38.0 35.8 38.0 20-24 36.897850000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.3698 38.0 37.6 38.0 32.0 38.0 30-34 35.84085 38.0 36.2 38.0 30.4 38.0 35-39 36.899249999999995 38.0 38.0 38.0 36.2 38.0 40-44 36.8735 38.0 38.0 38.0 36.0 38.0 45-49 36.846250000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.8366 38.0 38.0 38.0 36.0 38.0 55-59 36.84835 38.0 38.0 38.0 36.0 38.0 60-64 36.7839 38.0 38.0 38.0 36.0 38.0 65-69 36.77685 38.0 38.0 38.0 36.0 38.0 70-74 36.69499999999999 38.0 38.0 38.0 35.4 38.0 75-79 36.38645 38.0 38.0 38.0 34.0 38.0 80-84 36.45835 38.0 38.0 38.0 34.8 38.0 85-89 36.49335 38.0 38.0 38.0 35.0 38.0 90-94 36.49515 38.0 38.0 38.0 35.0 38.0 95-99 36.4593 38.0 38.0 38.0 34.8 38.0 100-104 36.3262 38.0 38.0 38.0 34.4 38.0 105-109 36.3211 38.0 38.0 38.0 34.2 38.0 110-114 36.2076 38.0 38.0 38.0 34.0 38.0 115-119 36.0107 38.0 37.8 38.0 33.0 38.0 120-124 35.83875 38.0 37.8 38.0 33.0 38.0 125-129 35.79225 38.0 38.0 38.0 33.2 38.0 130-134 35.6312 38.0 38.0 38.0 32.8 38.0 135-139 35.42205 38.0 37.8 38.0 31.4 38.0 140-144 35.20545 38.0 36.6 38.0 31.0 38.0 145-149 34.80965 38.0 36.0 38.0 30.2 38.0 150 28.9065 33.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 2.0 5 1.0 6 0.0 7 0.0 8 2.0 9 3.0 10 1.0 11 3.0 12 3.0 13 4.0 14 2.0 15 7.0 16 3.0 17 6.0 18 6.0 19 4.0 20 6.0 21 6.0 22 7.0 23 19.0 24 15.0 25 18.0 26 15.0 27 17.0 28 27.0 29 36.0 30 32.0 31 55.0 32 67.0 33 79.0 34 130.0 35 186.0 36 369.0 37 2855.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.075 21.6 12.525 25.8 2 28.075 24.325 31.874999999999996 15.725 3 20.875 27.6 32.025 19.5 4 24.65 35.3 22.25 17.8 5 25.074999999999996 37.225 22.175 15.525 6 20.1 38.125 23.474999999999998 18.3 7 20.025000000000002 20.424999999999997 41.375 18.175 8 20.849999999999998 25.3 29.5 24.349999999999998 9 22.5 24.0 29.549999999999997 23.95 10-14 23.595 28.74 26.275 21.39 15-19 23.555 27.700000000000003 27.83 20.915 20-24 23.945 28.115000000000002 27.689999999999998 20.25 25-29 23.115 27.66 28.349999999999998 20.875 30-34 23.36 27.48 28.444999999999997 20.715 35-39 23.365 27.485 28.42 20.73 40-44 22.965 27.744999999999997 27.705000000000002 21.584999999999997 45-49 22.95 28.205000000000002 28.01 20.835 50-54 23.21 27.98 28.025 20.785 55-59 23.34 27.58 28.09 20.990000000000002 60-64 23.61 27.935 28.299999999999997 20.155 65-69 23.996199809990497 27.69138456922846 27.566378318915945 20.746037301865094 70-74 23.505000000000003 27.939999999999998 27.889999999999997 20.665 75-79 23.25 27.450000000000003 28.975 20.325 80-84 23.59 26.945000000000004 28.955 20.51 85-89 23.849999999999998 27.36 28.49 20.3 90-94 23.937393739373938 27.412741274127413 28.347834783478348 20.3020302030203 95-99 23.611180559027954 27.641382069103454 28.756437821891094 19.9909995499775 100-104 23.756187809390468 27.05635281764088 28.281414070703537 20.906045302265113 105-109 23.96599149787447 27.711927981995498 28.322080520130033 20.0 110-114 24.511225561278064 27.68638431921596 28.121406070303518 19.68098404920246 115-119 23.98479695939188 28.175635127025405 27.445489097819564 20.39407881576315 120-124 23.65854878231735 28.559283892583885 27.639145871880782 20.143021453217983 125-129 24.805 27.725 27.815 19.655 130-134 25.169999999999998 27.92 27.27 19.64 135-139 23.84738473847385 28.272827282728276 27.742774277427745 20.137013701370137 140-144 24.866243312165608 27.711385569278463 27.50637531876594 19.91599579978999 145-149 25.366414886699012 27.807513381021458 27.05217347806513 19.773898254214398 150 25.05 28.050000000000004 27.125 19.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.5 25 3.5 26 3.5 27 3.0 28 6.0 29 12.5 30 13.0 31 13.5 32 28.5 33 40.5 34 43.0 35 56.0 36 74.5 37 104.0 38 134.0 39 157.0 40 190.0 41 227.0 42 262.0 43 284.5 44 289.0 45 282.5 46 273.5 47 260.5 48 234.0 49 215.5 50 179.0 51 130.0 52 115.5 53 99.0 54 67.0 55 43.0 56 33.0 57 28.5 58 24.0 59 18.5 60 12.0 61 8.0 62 6.0 63 4.0 64 2.5 65 1.0 66 2.0 67 2.5 68 1.0 69 0.5 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.005 100-104 0.005 105-109 0.025 110-114 0.005 115-119 0.02 120-124 0.015 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.005 145-149 0.045 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 4.025 0.0 0.0 0.0 0.0 126-127 4.55 0.0 0.0 0.0 0.0 128-129 4.925 0.0 0.0 0.0 0.0 130-131 5.237500000000001 0.0 0.0 0.0 0.0 132-133 5.575 0.0 0.0 0.0 0.0 134-135 6.050000000000001 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTCC 10 0.006973645 144.0 6 CCAGCTC 10 0.006973645 144.0 5 ATTAGCA 10 0.006973645 144.0 8 CACAATT 10 0.006973645 144.0 4 CAATTAG 10 0.006973645 144.0 6 AGCAAAT 10 0.006973645 144.0 1 TTAGCAA 10 0.006973645 144.0 9 >>END_MODULE Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202045 spots for SRR4237589.sra Written 2202045 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra Read 2202032 spots for SRR4237589.sra Written 2202032 spots for SRR4237589.sra SRR ids: ['SRR4237589.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v3kou_gj SRR4237589.sra spots: 44040653 blocks: [[1, 2202032], [2202033, 4404064], [4404065, 6606096], [6606097, 8808128], [8808129, 11010160], [11010161, 13212192], [13212193, 15414224], [15414225, 17616256], [17616257, 19818288], [19818289, 22020320], [22020321, 24222352], [24222353, 26424384], [26424385, 28626416], [28626417, 30828448], [30828449, 33030480], [33030481, 35232512], [35232513, 37434544], [37434545, 39636576], [39636577, 41838608], [41838609, 44040653]] SRR4237589 file size 14816214 SRR4237589 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237589 SRR4237589_1.fastq SRR4237589_2.fastq Input file: SRR4237589_1.fastq Paired file: SRR4237589_2.fastq trimmed: SRR4237589-trimmed-pair1.fastq, SRR4237589-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:26:19 2025 >> started Wed Feb 12 13:27:06 2025 >> done (46.875s) 44040653 read pairs processed; of these: 75294 ( 0.17%) short read pairs filtered out after trimming by size control 39849 ( 0.09%) empty read pairs filtered out after trimming by size control 43925510 (99.74%) read pairs available; of these: 14692464 (33.45%) trimmed read pairs available after processing 29233046 (66.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 6 0.00% 20 7 0.00% 21 6 0.00% 22 9 0.00% 23 11 0.00% 24 16 0.00% 25 12 0.00% 26 27 0.00% 27 29 0.00% 28 27 0.00% 29 1467 0.00% 30 53 0.00% 31 100 0.00% 32 25 0.00% 33 31 0.00% 34 37 0.00% 35 74 0.00% 36 68 0.00% 37 49 0.00% 38 68 0.00% 39 73 0.00% 40 70 0.00% 41 105 0.00% 42 64 0.00% 43 87 0.00% 44 86 0.00% 45 89 0.00% 46 119 0.00% 47 123 0.00% 48 151 0.00% 49 147 0.00% 50 162 0.00% 51 217 0.00% 52 189 0.00% 53 262 0.00% 54 245 0.00% 55 310 0.00% 56 288 0.00% 57 340 0.00% 58 391 0.00% 59 444 0.00% 60 580 0.00% 61 636 0.00% 62 646 0.00% 63 688 0.00% 64 840 0.00% 65 940 0.00% 66 1074 0.00% 67 1353 0.00% 68 1983 0.00% 69 4425 0.01% 70 3601 0.01% 71 2335 0.01% 72 2352 0.01% 73 2586 0.01% 74 2732 0.01% 75 3175 0.01% 76 3507 0.01% 77 3934 0.01% 78 4395 0.01% 79 4991 0.01% 80 5451 0.01% 81 6152 0.01% 82 7143 0.02% 83 8889 0.02% 84 19154 0.04% 85 22413 0.05% 86 14383 0.03% 87 15025 0.03% 88 16654 0.04% 89 17067 0.04% 90 19591 0.04% 91 19826 0.05% 92 21677 0.05% 93 24411 0.06% 94 25131 0.06% 95 26493 0.06% 96 28505 0.06% 97 30512 0.07% 98 33887 0.08% 99 34645 0.08% 100 36843 0.08% 101 38854 0.09% 102 41153 0.09% 103 44093 0.10% 104 46680 0.11% 105 50317 0.11% 106 52589 0.12% 107 55786 0.13% 108 59417 0.14% 109 61060 0.14% 110 62710 0.14% 111 65395 0.15% 112 68418 0.16% 113 72026 0.16% 114 74755 0.17% 115 78594 0.18% 116 80756 0.18% 117 85184 0.19% 118 89921 0.20% 119 88874 0.20% 120 91028 0.21% 121 94793 0.22% 122 97364 0.22% 123 102191 0.23% 124 105152 0.24% 125 108616 0.25% 126 113537 0.26% 127 116198 0.26% 128 120731 0.27% 129 123885 0.28% 130 126757 0.29% 131 131716 0.30% 132 136251 0.31% 133 140311 0.32% 134 146468 0.33% 135 152161 0.35% 136 158643 0.36% 137 166553 0.38% 138 175709 0.40% 139 184170 0.42% 140 195561 0.45% 141 209687 0.48% 142 228388 0.52% 143 249101 0.57% 144 285103 0.65% 145 334370 0.76% 146 418181 0.95% 147 585579 1.33% 148 1065563 2.43% 149 6825396 15.54% 150 29233046 66.55% 43925510 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=8.86 fanout-score-rank=14 prefix-density=0.30 prefix-fanout=5.2 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=150.89 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=20.4 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.2 sequence=AGTTCCAATGGCCACTGTTGAGGTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=269.14 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=28.3 sequence=AAGAAGAAGAAA SRR4237589 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:27:52 Started mapping on | Feb 12 13:27:52 Finished on | Feb 12 13:32:29 Mapping speed, Million of reads per hour | 570.87 Number of input reads | 43925510 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 41788948 Uniquely mapped reads % | 95.14% Average mapped length | 292.64 Number of splices: Total | 38086268 Number of splices: Annotated (sjdb) | 37389792 Number of splices: GT/AG | 37499793 Number of splices: GC/AG | 459370 Number of splices: AT/AC | 33642 Number of splices: Non-canonical | 93463 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 821327 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 73084 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1358452 1358452 1358452 N_multimapping 821327 821327 821327 N_noFeature 1180778 41334342 1408557 N_ambiguous 409294 2294 180735 UnstrandedReadsAssigned:40198876 PositiveStrandReadsAssigned:452312 NegativeStrandReadsAssigned:40199656 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237589 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237589-trimmed-pair1.fastq SRR4237589-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,925,510 reads, 39,987,319 reads pseudoaligned [quant] estimated average fragment length: 234.86 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR4237589.ke.tsv 34699 SRR4237589.se.tsv 87100 total ==> SRR4237589.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.14 863 12.3432 Potri.005G024800.1.v4.1 1035 801.14 92 2.9304 Potri.004G059700.1.v4.1 961 727.145 34 1.19318 Potri.007G009000.2.v4.1 1416 1182.14 0 0 Potri.003G141000.2.v4.1 2943 2709.14 723.216 6.81215 Potri.016G087400.1.v4.1 270 82.4605 4536.11 1403.73 Potri.015G069301.1.v4.1 564 333.961 0 0 Potri.010G195200.1.v4.1 1773 1539.14 115 1.90663 Potri.012G127500.1.v4.1 977 743.145 13938 478.602 ==> SRR4237589.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6020 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 694 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 28 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237589 completed mapping pipeline successfully