Starting /dee2/code/volunteer_pipeline.sh SRR4237590 current disk space = 3051217952768 free memory = 1579942916 SRR4237590 SRAfilesize 15674ee03bc8f62ba4099cef2952b4ee SRR4237590.sra SRR4237590.sra file validated SRR4237590 is paired end SRR4237590 is conventional basespace SRR4237590 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237590_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12025 34.0 33.0 34.0 32.0 34.0 2 33.314 34.0 33.0 34.0 33.0 34.0 3 33.3775 34.0 33.0 34.0 33.0 34.0 4 33.34025 34.0 33.0 34.0 33.0 34.0 5 33.408 34.0 33.0 34.0 33.0 34.0 6 33.3215 38.0 36.0 38.0 2.0 38.0 7 36.29525 38.0 37.0 38.0 31.0 38.0 8 36.677 38.0 38.0 38.0 31.0 38.0 9 37.28525 38.0 38.0 38.0 37.0 38.0 10-14 37.446299999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.4617 38.0 38.0 38.0 37.2 38.0 20-24 37.3694 38.0 38.0 38.0 37.0 38.0 25-29 37.3581 38.0 38.0 38.0 37.0 38.0 30-34 37.3565 38.0 38.0 38.0 37.0 38.0 35-39 37.37265 38.0 38.0 38.0 37.0 38.0 40-44 37.25425 38.0 38.0 38.0 36.8 38.0 45-49 37.31355 38.0 38.0 38.0 37.0 38.0 50-54 37.2162 38.0 38.0 38.0 36.8 38.0 55-59 37.1352 38.0 38.0 38.0 36.4 38.0 60-64 37.2202 38.0 38.0 38.0 36.6 38.0 65-69 37.147499999999994 38.0 38.0 38.0 36.4 38.0 70-74 37.099599999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.05815 38.0 38.0 38.0 36.0 38.0 80-84 36.97095 38.0 38.0 38.0 36.0 38.0 85-89 36.858450000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.847899999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.745450000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.6673 38.0 38.0 38.0 34.8 38.0 105-109 36.255 38.0 37.6 38.0 33.0 38.0 110-114 36.43735 38.0 38.0 38.0 33.8 38.0 115-119 36.311099999999996 38.0 37.8 38.0 33.4 38.0 120-124 36.41375000000001 38.0 38.0 38.0 34.0 38.0 125-129 36.289100000000005 38.0 38.0 38.0 33.8 38.0 130-134 36.13415 38.0 37.6 38.0 33.4 38.0 135-139 36.0179 38.0 38.0 38.0 33.0 38.0 140-144 35.66665 38.0 36.8 38.0 32.4 38.0 145-149 34.09565 38.0 34.4 38.0 25.6 38.0 150 30.88225 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 4.0 17 1.0 18 6.0 19 0.0 20 1.0 21 2.0 22 8.0 23 2.0 24 7.0 25 12.0 26 15.0 27 17.0 28 18.0 29 26.0 30 38.0 31 48.0 32 66.0 33 88.0 34 135.0 35 214.0 36 478.0 37 2813.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.68170426065163 12.205513784461154 7.368421052631578 37.74436090225564 2 22.675 16.325 35.35 25.650000000000002 3 20.65 20.75 26.325 32.275 4 23.724999999999998 30.349999999999998 21.975 23.95 5 22.85 34.849999999999994 23.3 19.0 6 17.68802228412256 36.211699164345404 24.9025069637883 21.197771587743734 7 14.45 26.200000000000003 41.65 17.7 8 16.950000000000003 26.025 32.725 24.3 9 17.65 23.05 33.35 25.95 10-14 19.73 30.45 26.775 23.044999999999998 15-19 19.8 28.544999999999998 28.27 23.385 20-24 20.035 28.87 27.165 23.93 25-29 19.99 29.160000000000004 27.400000000000002 23.45 30-34 19.93 29.28 26.724999999999998 24.065 35-39 19.48 29.220000000000002 27.41 23.89 40-44 20.51 28.799999999999997 27.634999999999998 23.055 45-49 20.36 28.95 27.025 23.665 50-54 19.36 28.475 28.155 24.01 55-59 19.79 29.270000000000003 27.24 23.7 60-64 20.68 28.7 26.88 23.74 65-69 20.04 28.854999999999997 27.389999999999997 23.715 70-74 20.21 28.665000000000003 27.58 23.544999999999998 75-79 20.435 29.025000000000002 27.465 23.075000000000003 80-84 20.080000000000002 28.720000000000002 27.345000000000002 23.855 85-89 19.91 28.315 27.305 24.47 90-94 20.175 28.99 26.939999999999998 23.895 95-99 19.73 28.505000000000003 27.250000000000004 24.515 100-104 20.48 29.020000000000003 26.8 23.7 105-109 20.655 28.345 27.08 23.919999999999998 110-114 20.77 29.04 26.41 23.78 115-119 20.86 29.03 26.11 24.0 120-124 20.865000000000002 28.485 26.71 23.94 125-129 21.21 29.225 26.029999999999998 23.535 130-134 21.11 28.71 26.115 24.065 135-139 20.94 28.74 25.835 24.485 140-144 21.09 28.32 25.945 24.645 145-149 20.31 28.410000000000004 26.279999999999998 25.0 150 21.025 27.450000000000003 26.174999999999997 25.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.5 24 4.0 25 3.5 26 5.0 27 5.5 28 8.5 29 16.5 30 19.0 31 27.0 32 40.0 33 49.0 34 56.5 35 73.5 36 91.5 37 104.5 38 114.5 39 141.0 40 178.0 41 207.5 42 233.0 43 258.5 44 290.0 45 301.0 46 289.5 47 265.5 48 227.5 49 201.0 50 177.0 51 137.0 52 113.5 53 88.0 54 70.5 55 58.0 56 37.5 57 30.5 58 22.5 59 13.0 60 8.5 61 6.0 62 3.5 63 1.5 64 1.5 65 5.0 66 4.0 67 0.5 68 2.0 69 2.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 10.25 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.4375 0.0 0.0 0.0 0.0 94-95 1.7125 0.0 0.0 0.0 0.0 96-97 2.025 0.0 0.0 0.0 0.0 98-99 2.45 0.0 0.0 0.0 0.0 100-101 2.9625000000000004 0.0 0.0 0.0 0.0 102-103 3.4000000000000004 0.0 0.0 0.0 0.0 104-105 3.875 0.0 0.0 0.0 0.0 106-107 4.5125 0.0 0.0 0.0 0.0 108-109 4.987500000000001 0.0 0.0 0.0 0.0 110-111 5.5 0.0 0.0 0.0 0.0 112-113 6.1125 0.0 0.0 0.0 0.0 114-115 6.824999999999999 0.0 0.0 0.0 0.0 116-117 7.475 0.0 0.0 0.0 0.0 118-119 8.05 0.0 0.0 0.0 0.0 120-121 9.0375 0.0 0.0 0.0 0.0 122-123 10.025 0.0 0.0 0.0 0.0 124-125 11.075 0.0 0.0 0.0 0.0 126-127 12.1375 0.0 0.0 0.0 0.0 128-129 13.25 0.0 0.0 0.0 0.0 130-131 14.1875 0.0 0.0 0.0 0.0 132-133 15.0 0.0 0.0 0.0 0.0 134-135 15.9125 0.0 0.0 0.0 0.0 136-137 16.737499999999997 0.0 0.0 0.0 0.0 138 17.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237590 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237590_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.751 33.0 33.0 34.0 32.0 34.0 2 32.79475 34.0 33.0 34.0 32.0 34.0 3 32.85325 34.0 33.0 34.0 32.0 34.0 4 32.79075 34.0 33.0 34.0 32.0 34.0 5 32.4375 34.0 33.0 34.0 31.0 34.0 6 36.855 38.0 38.0 38.0 36.0 38.0 7 36.9045 38.0 38.0 38.0 36.0 38.0 8 36.9695 38.0 38.0 38.0 36.0 38.0 9 36.9705 38.0 38.0 38.0 37.0 38.0 10-14 36.906600000000005 38.0 38.0 38.0 36.4 38.0 15-19 36.9442 38.0 38.0 38.0 36.6 38.0 20-24 36.510600000000004 38.0 38.0 38.0 34.4 38.0 25-29 36.8867 38.0 38.0 38.0 36.6 38.0 30-34 36.8678 38.0 38.0 38.0 36.4 38.0 35-39 36.8227 38.0 38.0 38.0 36.0 38.0 40-44 36.7772 38.0 38.0 38.0 36.0 38.0 45-49 36.73649999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.4201 38.0 38.0 38.0 34.0 38.0 55-59 35.866699999999994 38.0 36.8 38.0 30.6 38.0 60-64 36.648649999999996 38.0 38.0 38.0 35.4 38.0 65-69 36.6442 38.0 38.0 38.0 35.8 38.0 70-74 36.62755 38.0 38.0 38.0 35.8 38.0 75-79 36.685500000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.602250000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.57465 38.0 38.0 38.0 36.0 38.0 90-94 36.44245 38.0 38.0 38.0 35.0 38.0 95-99 36.4039 38.0 38.0 38.0 34.8 38.0 100-104 35.294 38.0 36.0 38.0 28.8 38.0 105-109 35.4745 38.0 37.2 38.0 28.6 38.0 110-114 36.16585 38.0 38.0 38.0 34.0 38.0 115-119 36.09609999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.04405 38.0 38.0 38.0 34.0 38.0 125-129 35.846 38.0 38.0 38.0 33.4 38.0 130-134 35.1368 38.0 37.0 38.0 27.6 38.0 135-139 35.25405 38.0 36.6 38.0 31.0 38.0 140-144 34.33409999999999 38.0 35.2 38.0 24.8 38.0 145-149 34.4008 38.0 36.4 38.0 25.2 38.0 150 27.51775 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 8.0 4 3.0 5 3.0 6 4.0 7 2.0 8 3.0 9 1.0 10 2.0 11 4.0 12 0.0 13 3.0 14 3.0 15 6.0 16 2.0 17 3.0 18 3.0 19 4.0 20 3.0 21 1.0 22 8.0 23 7.0 24 17.0 25 21.0 26 22.0 27 12.0 28 38.0 29 33.0 30 39.0 31 52.0 32 71.0 33 79.0 34 114.0 35 216.0 36 497.0 37 2703.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.325 21.175 12.025 24.474999999999998 2 28.7 25.224999999999998 30.775000000000002 15.299999999999999 3 21.525 27.900000000000002 31.424999999999997 19.15 4 24.5 34.599999999999994 22.575 18.325 5 24.525 37.35 22.15 15.975 6 19.7 38.824999999999996 24.025 17.45 7 19.425 19.8 41.449999999999996 19.325 8 21.224999999999998 23.925 29.849999999999998 25.0 9 22.025 23.974999999999998 29.975 24.025 10-14 23.68 29.154999999999998 27.105 20.06 15-19 23.330000000000002 28.110000000000003 27.79 20.77 20-24 23.44 27.865000000000002 27.82 20.875 25-29 23.775 27.705000000000002 28.265 20.255000000000003 30-34 23.425 28.225 27.894999999999996 20.455000000000002 35-39 24.135 27.855 27.915 20.095 40-44 23.865 27.245 28.395 20.495 45-49 23.44 28.03 28.689999999999998 19.84 50-54 23.95 28.16 27.534999999999997 20.355 55-59 24.0 27.21 28.475 20.315 60-64 22.994999999999997 27.3 29.095 20.61 65-69 23.65 27.68 28.199999999999996 20.47 70-74 23.925 28.04 27.779999999999998 20.255000000000003 75-79 24.08 27.639999999999997 28.475 19.805 80-84 23.305 27.47 28.875 20.349999999999998 85-89 23.66 27.525 28.804999999999996 20.01 90-94 23.855 27.67 28.155 20.32 95-99 23.905 27.155 28.585 20.355 100-104 24.104999999999997 27.534999999999997 28.21 20.150000000000002 105-109 24.47 27.389999999999997 28.439999999999998 19.7 110-114 24.425 27.665 27.775 20.135 115-119 24.87 28.065 27.47 19.595000000000002 120-124 25.27 27.845 27.150000000000002 19.735 125-129 25.695 27.58 26.705000000000002 20.02 130-134 26.52 28.065 26.55 18.865000000000002 135-139 26.474999999999998 28.07 26.57 18.884999999999998 140-144 26.655 27.595 26.950000000000003 18.8 145-149 27.355 27.815 26.32 18.509999999999998 150 27.925 25.974999999999998 27.450000000000003 18.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.0 22 1.0 23 1.5 24 1.0 25 2.5 26 3.5 27 5.5 28 5.5 29 6.5 30 13.5 31 19.5 32 20.0 33 30.5 34 47.5 35 72.0 36 89.0 37 100.0 38 130.5 39 159.0 40 194.5 41 241.0 42 272.0 43 273.5 44 284.0 45 299.5 46 275.5 47 242.5 48 235.0 49 217.0 50 160.5 51 125.0 52 119.0 53 99.0 54 69.5 55 48.5 56 38.0 57 26.5 58 18.5 59 13.0 60 8.5 61 5.5 62 5.0 63 4.0 64 2.0 65 2.5 66 2.0 67 2.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 90-91 1.0125000000000002 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.5375 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.25 0.0 0.0 0.0 0.0 100-101 2.7125000000000004 0.0 0.0 0.0 0.0 102-103 3.0999999999999996 0.0 0.0 0.0 0.0 104-105 3.5875000000000004 0.0 0.0 0.0 0.0 106-107 4.25 0.0 0.0 0.0 0.0 108-109 4.737500000000001 0.0 0.0 0.0 0.0 110-111 5.25 0.0 0.0 0.0 0.0 112-113 5.887499999999999 0.0 0.0 0.0 0.0 114-115 6.625 0.0 0.0 0.0 0.0 116-117 7.2625 0.0 0.0 0.0 0.0 118-119 7.8 0.0 0.0 0.0 0.0 120-121 8.7625 0.0 0.0 0.0 0.0 122-123 9.7375 0.0 0.0 0.0 0.0 124-125 10.774999999999999 0.0 0.0 0.0 0.0 126-127 11.8 0.0 0.0 0.0 0.0 128-129 12.850000000000001 0.0 0.0 0.0 0.0 130-131 13.662500000000001 0.0 0.0 0.0 0.0 132-133 14.4375 0.0 0.0 0.0 0.0 134-135 15.2375 0.0 0.0 0.0 0.0 136-137 16.1125 0.0 0.0 0.0 0.0 138 16.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148184 spots for SRR4237590.sra Written 2148184 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra Read 2148182 spots for SRR4237590.sra Written 2148182 spots for SRR4237590.sra SRR ids: ['SRR4237590.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m7s6xs9r SRR4237590.sra spots: 42963642 blocks: [[1, 2148182], [2148183, 4296364], [4296365, 6444546], [6444547, 8592728], [8592729, 10740910], [10740911, 12889092], [12889093, 15037274], [15037275, 17185456], [17185457, 19333638], [19333639, 21481820], [21481821, 23630002], [23630003, 25778184], [25778185, 27926366], [27926367, 30074548], [30074549, 32222730], [32222731, 34370912], [34370913, 36519094], [36519095, 38667276], [38667277, 40815458], [40815459, 42963642]] SRR4237590 file size 14453354 SRR4237590 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237590 SRR4237590_1.fastq SRR4237590_2.fastq Input file: SRR4237590_1.fastq Paired file: SRR4237590_2.fastq trimmed: SRR4237590-trimmed-pair1.fastq, SRR4237590-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:10:47 2025 >> started Wed Feb 12 13:11:32 2025 >> done (44.928s) 42963642 read pairs processed; of these: 101404 ( 0.24%) short read pairs filtered out after trimming by size control 90867 ( 0.21%) empty read pairs filtered out after trimming by size control 42771371 (99.55%) read pairs available; of these: 18771324 (43.89%) trimmed read pairs available after processing 24000047 (56.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 11 0.00% 20 14 0.00% 21 10 0.00% 22 6 0.00% 23 10 0.00% 24 15 0.00% 25 10 0.00% 26 15 0.00% 27 10 0.00% 28 24 0.00% 29 19 0.00% 30 36 0.00% 31 30 0.00% 32 53 0.00% 33 59 0.00% 34 67 0.00% 35 93 0.00% 36 92 0.00% 37 106 0.00% 38 130 0.00% 39 165 0.00% 40 198 0.00% 41 210 0.00% 42 231 0.00% 43 289 0.00% 44 270 0.00% 45 326 0.00% 46 392 0.00% 47 390 0.00% 48 482 0.00% 49 560 0.00% 50 673 0.00% 51 719 0.00% 52 832 0.00% 53 884 0.00% 54 1051 0.00% 55 1132 0.00% 56 1256 0.00% 57 1400 0.00% 58 1663 0.00% 59 1847 0.00% 60 2238 0.01% 61 2508 0.01% 62 2862 0.01% 63 3168 0.01% 64 3510 0.01% 65 4198 0.01% 66 4387 0.01% 67 4965 0.01% 68 5777 0.01% 69 7963 0.02% 70 8284 0.02% 71 8023 0.02% 72 9015 0.02% 73 9757 0.02% 74 10836 0.03% 75 12202 0.03% 76 13384 0.03% 77 14610 0.03% 78 16160 0.04% 79 17988 0.04% 80 20288 0.05% 81 22627 0.05% 82 25221 0.06% 83 28666 0.07% 84 41662 0.10% 85 38923 0.09% 86 42011 0.10% 87 45402 0.11% 88 47784 0.11% 89 50329 0.12% 90 54742 0.13% 91 60428 0.14% 92 64893 0.15% 93 69088 0.16% 94 74380 0.17% 95 78097 0.18% 96 83352 0.19% 97 87882 0.21% 98 92015 0.22% 99 97048 0.23% 100 103839 0.24% 101 107305 0.25% 102 113782 0.27% 103 120304 0.28% 104 126315 0.30% 105 132082 0.31% 106 139030 0.33% 107 142858 0.33% 108 146783 0.34% 109 152194 0.36% 110 155338 0.36% 111 160749 0.38% 112 165516 0.39% 113 170120 0.40% 114 176022 0.41% 115 181629 0.42% 116 185004 0.43% 117 189813 0.44% 118 194637 0.46% 119 196650 0.46% 120 197938 0.46% 121 202714 0.47% 122 204332 0.48% 123 208481 0.49% 124 212913 0.50% 125 216897 0.51% 126 221081 0.52% 127 223638 0.52% 128 225288 0.53% 129 229371 0.54% 130 231901 0.54% 131 232993 0.54% 132 236156 0.55% 133 239596 0.56% 134 242360 0.57% 135 247634 0.58% 136 253099 0.59% 137 257188 0.60% 138 265725 0.62% 139 268997 0.63% 140 276986 0.65% 141 285470 0.67% 142 298342 0.70% 143 316966 0.74% 144 341186 0.80% 145 382654 0.89% 146 447544 1.05% 147 587822 1.37% 148 961089 2.25% 149 5892529 13.78% 150 24000047 56.11% 42771371 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=40 prefix-density=0.15 prefix-fanout=1.9 sequence=TCTGACCTGGGCTGGCAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=286.51 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=29.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=38 prefix-density=0.17 prefix-fanout=2.4 sequence=TCTAGCTAGTGGTTTAATAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=2190.42 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=28.0 sequence=AAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGT SRR4237590 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:12:14 Started mapping on | Feb 12 13:12:14 Finished on | Feb 12 13:15:55 Mapping speed, Million of reads per hour | 696.73 Number of input reads | 42771371 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 41041993 Uniquely mapped reads % | 95.96% Average mapped length | 284.55 Number of splices: Total | 37402899 Number of splices: Annotated (sjdb) | 36752976 Number of splices: GT/AG | 36827847 Number of splices: GC/AG | 449667 Number of splices: AT/AC | 34350 Number of splices: Non-canonical | 91035 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 786859 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 53589 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 994901 994901 994901 N_multimapping 786859 786859 786859 N_noFeature 1108200 40559372 1396733 N_ambiguous 358627 2664 162379 UnstrandedReadsAssigned:39575166 PositiveStrandReadsAssigned:479957 NegativeStrandReadsAssigned:39482881 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR4237590 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237590-trimmed-pair1.fastq SRR4237590-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,771,371 reads, 39,342,605 reads pseudoaligned [quant] estimated average fragment length: 200.417 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,002 rounds 52401 SRR4237590.ke.tsv 34699 SRR4237590.se.tsv 87100 total ==> SRR4237590.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.58 769 11.8523 Potri.005G024800.1.v4.1 1035 835.583 91 3.05253 Potri.004G059700.1.v4.1 961 761.604 8 0.294421 Potri.007G009000.2.v4.1 1416 1216.58 0 0 Potri.003G141000.2.v4.1 2943 2743.58 764.203 7.80727 Potri.016G087400.1.v4.1 270 103.479 4870.61 1319.28 Potri.015G069301.1.v4.1 564 367.193 0 0 Potri.010G195200.1.v4.1 1773 1573.58 50.7977 0.904822 Potri.012G127500.1.v4.1 977 777.604 14507 522.91 ==> SRR4237590.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2110 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 607 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 54 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237590 completed mapping pipeline successfully