Starting /dee2/code/volunteer_pipeline.sh SRR4237591 current disk space = 3051251421184 free memory = 1497009620 SRR4237591 SRAfilesize de7f6027da8ce118411936127e1c5153 SRR4237591.sra SRR4237591.sra file validated SRR4237591 is paired end SRR4237591 is conventional basespace SRR4237591 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237591_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.27425 34.0 33.0 34.0 33.0 34.0 2 33.27025 34.0 33.0 34.0 33.0 34.0 3 33.39275 34.0 33.0 34.0 33.0 34.0 4 33.3775 34.0 33.0 34.0 33.0 34.0 5 33.29875 34.0 33.0 34.0 33.0 34.0 6 36.776 38.0 37.0 38.0 35.0 38.0 7 36.60375 38.0 38.0 38.0 36.0 38.0 8 37.187 38.0 38.0 38.0 36.0 38.0 9 37.34675 38.0 38.0 38.0 37.0 38.0 10-14 37.44245 38.0 38.0 38.0 37.2 38.0 15-19 37.477000000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.4893 38.0 38.0 38.0 37.8 38.0 25-29 37.480399999999996 38.0 38.0 38.0 37.8 38.0 30-34 37.4345 38.0 38.0 38.0 37.8 38.0 35-39 37.068200000000004 38.0 38.0 38.0 36.2 38.0 40-44 37.322950000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.37304999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.297900000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.240249999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.1894 38.0 38.0 38.0 36.8 38.0 65-69 36.308350000000004 38.0 36.2 38.0 32.4 38.0 70-74 36.609849999999994 38.0 37.4 38.0 34.0 38.0 75-79 37.0447 38.0 38.0 38.0 36.0 38.0 80-84 36.926100000000005 38.0 38.0 38.0 35.8 38.0 85-89 36.24085 38.0 37.0 38.0 32.0 38.0 90-94 36.6314 38.0 37.4 38.0 33.8 38.0 95-99 36.80095 38.0 38.0 38.0 35.4 38.0 100-104 36.8107 38.0 38.0 38.0 35.0 38.0 105-109 36.3855 38.0 37.8 38.0 33.4 38.0 110-114 36.6462 38.0 38.0 38.0 35.0 38.0 115-119 35.8871 38.0 37.2 38.0 30.8 38.0 120-124 36.439049999999995 38.0 38.0 38.0 34.2 38.0 125-129 36.37065 38.0 38.0 38.0 34.0 38.0 130-134 36.190900000000006 38.0 38.0 38.0 33.4 38.0 135-139 36.014 38.0 38.0 38.0 33.4 38.0 140-144 35.832 38.0 37.6 38.0 32.6 38.0 145-149 35.43495 38.0 36.6 38.0 32.6 38.0 150 30.1345 35.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 3.0 15 1.0 16 1.0 17 1.0 18 3.0 19 3.0 20 3.0 21 3.0 22 2.0 23 4.0 24 7.0 25 12.0 26 10.0 27 17.0 28 32.0 29 28.0 30 30.0 31 36.0 32 41.0 33 90.0 34 131.0 35 199.0 36 540.0 37 2800.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.0 11.600000000000001 8.225 41.175 2 23.092319239429575 15.261446084563424 35.90192644483363 25.74430823117338 3 20.075000000000003 18.075 26.25 35.6 4 22.625 28.375 23.3 25.7 5 23.575 32.550000000000004 23.625 20.25 6 17.925 36.825 23.7 21.55 7 14.391237901171678 27.075904228222107 40.601120733571065 17.93173713703515 8 16.525000000000002 26.075 33.6 23.799999999999997 9 16.225 24.425 34.75 24.6 10-14 19.580000000000002 30.620000000000005 26.6 23.200000000000003 15-19 19.685 29.25 27.175 23.89 20-24 19.950000000000003 29.13 27.700000000000003 23.22 25-29 19.63 29.759999999999998 27.08 23.53 30-34 19.78 28.994999999999997 27.544999999999998 23.68 35-39 19.96 28.994999999999997 26.974999999999998 24.07 40-44 19.57 29.43 27.500000000000004 23.5 45-49 19.865 29.17 27.685 23.28 50-54 19.495 29.909999999999997 27.37 23.225 55-59 19.65098254912746 29.6064803240162 26.831341567078354 23.91119555977799 60-64 19.955000000000002 28.235 27.79 24.02 65-69 19.919999999999998 28.875 26.945000000000004 24.26 70-74 19.994999999999997 29.07 27.644999999999996 23.29 75-79 19.805 28.65 27.625 23.919999999999998 80-84 19.445 28.655 27.565 24.335 85-89 20.005 28.955 27.29 23.75 90-94 19.885 29.330000000000002 27.305 23.48 95-99 19.88 28.895 27.500000000000004 23.724999999999998 100-104 20.875 29.154999999999998 26.290000000000003 23.68 105-109 20.794999999999998 28.71 27.04 23.455000000000002 110-114 20.775 29.134999999999998 26.424999999999997 23.665 115-119 20.945 29.03 26.32 23.705000000000002 120-124 21.565 29.53 25.35 23.555 125-129 20.979999999999997 29.060000000000002 25.735000000000003 24.224999999999998 130-134 21.2 29.215000000000003 25.314999999999998 24.27 135-139 21.11 28.605000000000004 25.96 24.325 140-144 20.934186837367474 28.280656131226245 25.63012602520504 25.155031006201238 145-149 21.145 28.21 25.97 24.675 150 20.423600605143722 27.93746848209783 25.668179525970753 25.970751386787693 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 1.5 24 0.5 25 3.0 26 4.0 27 5.5 28 10.5 29 15.5 30 22.5 31 25.5 32 31.5 33 51.5 34 71.5 35 90.0 36 105.5 37 117.0 38 133.5 39 166.0 40 191.0 41 214.0 42 243.0 43 246.5 44 256.5 45 260.0 46 237.0 47 233.0 48 230.0 49 204.0 50 177.5 51 152.5 52 128.0 53 105.5 54 78.5 55 51.0 56 39.0 57 29.5 58 16.0 59 12.0 60 8.5 61 6.0 62 4.5 63 3.5 64 3.5 65 1.0 66 1.0 67 2.5 68 2.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 1.8499999999999999 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.02 145-149 0.0 150 0.8500000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.4875 0.0 0.0 0.0 0.0 94-95 1.85 0.0 0.0 0.0 0.0 96-97 2.3499999999999996 0.0 0.0 0.0 0.0 98-99 2.65 0.0 0.0 0.0 0.0 100-101 3.2125000000000004 0.0 0.0 0.0 0.0 102-103 3.9375 0.0 0.0 0.0 0.0 104-105 4.5875 0.0 0.0 0.0 0.0 106-107 5.275 0.0 0.0 0.0 0.0 108-109 6.1875 0.0 0.0 0.0 0.0 110-111 7.1125 0.0 0.0 0.0 0.0 112-113 7.8375 0.0 0.0 0.0 0.0 114-115 8.6625 0.0 0.0 0.0 0.0 116-117 9.5625 0.0 0.0 0.0 0.0 118-119 10.5625 0.0 0.0 0.0 0.0 120-121 11.625 0.0 0.0 0.0 0.0 122-123 12.65 0.0 0.0 0.0 0.0 124-125 13.7375 0.0 0.0 0.0 0.0 126-127 14.8125 0.0 0.0 0.0 0.0 128-129 16.0375 0.0 0.0 0.0 0.0 130-131 17.0375 0.0 0.0 0.0 0.0 132-133 18.25 0.0 0.0 0.0 0.0 134-135 19.4 0.0 0.0 0.0 0.0 136-137 20.6125 0.0 0.0 0.0 0.0 138 21.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACAAT 10 0.0064824508 147.51282 7 GGAACGG 10 0.0064824508 147.51282 6 >>END_MODULE SRR4237591 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237591_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37575 33.0 33.0 34.0 31.0 34.0 2 32.8015 33.0 33.0 34.0 32.0 34.0 3 32.824 34.0 33.0 34.0 32.0 34.0 4 31.0865 33.0 32.0 34.0 25.0 34.0 5 32.3625 33.0 33.0 34.0 31.0 34.0 6 36.81575 38.0 38.0 38.0 36.0 38.0 7 37.048 38.0 38.0 38.0 36.0 38.0 8 37.038 38.0 38.0 38.0 36.0 38.0 9 37.08225 38.0 38.0 38.0 36.0 38.0 10-14 37.071549999999995 38.0 38.0 38.0 36.6 38.0 15-19 37.04275 38.0 38.0 38.0 36.4 38.0 20-24 37.06665 38.0 38.0 38.0 36.8 38.0 25-29 37.05665 38.0 38.0 38.0 36.6 38.0 30-34 37.06505 38.0 38.0 38.0 36.2 38.0 35-39 37.047399999999996 38.0 38.0 38.0 36.2 38.0 40-44 36.964800000000004 38.0 38.0 38.0 36.2 38.0 45-49 36.9993 38.0 38.0 38.0 36.0 38.0 50-54 36.54645 38.0 38.0 38.0 34.0 38.0 55-59 36.846 38.0 38.0 38.0 35.8 38.0 60-64 36.874750000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.524300000000004 38.0 37.8 38.0 34.4 38.0 70-74 36.71939999999999 38.0 38.0 38.0 35.6 38.0 75-79 36.66765 38.0 38.0 38.0 35.6 38.0 80-84 36.644499999999994 38.0 38.0 38.0 35.4 38.0 85-89 36.622 38.0 38.0 38.0 35.2 38.0 90-94 36.6039 38.0 38.0 38.0 35.0 38.0 95-99 36.55845000000001 38.0 38.0 38.0 35.0 38.0 100-104 36.4675 38.0 38.0 38.0 34.6 38.0 105-109 36.44275 38.0 38.0 38.0 34.6 38.0 110-114 36.347 38.0 38.0 38.0 34.2 38.0 115-119 36.22005 38.0 38.0 38.0 34.0 38.0 120-124 36.01075 38.0 38.0 38.0 33.8 38.0 125-129 35.881350000000005 38.0 38.0 38.0 33.4 38.0 130-134 35.64895 38.0 38.0 38.0 32.6 38.0 135-139 35.54875 38.0 38.0 38.0 32.8 38.0 140-144 35.29945 38.0 37.2 38.0 31.2 38.0 145-149 34.7197 38.0 36.0 38.0 30.6 38.0 150 28.58425 35.0 25.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 4.0 4 0.0 5 0.0 6 2.0 7 1.0 8 4.0 9 0.0 10 3.0 11 1.0 12 2.0 13 2.0 14 2.0 15 1.0 16 5.0 17 5.0 18 7.0 19 4.0 20 10.0 21 10.0 22 13.0 23 12.0 24 9.0 25 19.0 26 15.0 27 22.0 28 31.0 29 36.0 30 37.0 31 31.0 32 73.0 33 63.0 34 116.0 35 185.0 36 395.0 37 2879.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.93206317372775 20.230634244171473 11.832539483579845 29.00476309852093 2 28.249999999999996 24.5 31.574999999999996 15.675 3 20.349999999999998 28.375 31.55 19.725 4 24.125 33.5 25.025 17.349999999999998 5 26.1 36.025 21.4 16.475 6 20.05 39.65 23.375 16.925 7 19.45 20.875 41.425 18.25 8 22.225 24.775 29.175 23.825 9 22.525000000000002 23.849999999999998 30.575000000000003 23.05 10-14 23.75 28.854999999999997 26.795 20.599999999999998 15-19 23.79 27.6 27.98 20.630000000000003 20-24 23.906195309765486 28.68143407170359 27.51637581879094 19.895994799739988 25-29 24.013602040306044 27.559133870080508 28.31424713707056 20.113016952542882 30-34 23.5 27.88 28.375 20.244999999999997 35-39 23.615627032164475 27.717472862788256 28.307738482317042 20.35916162273023 40-44 23.901731211848293 28.154708295807062 27.68938256779746 20.254177924547186 45-49 23.653278647526633 28.214875206322215 27.709698394438053 20.422147751713098 50-54 23.208738350536127 28.209239402745766 28.15913418178174 20.422888064936366 55-59 23.550905996596256 28.641505656221845 27.920712784062466 19.886875563119432 60-64 23.482611958969226 27.9009256942707 28.08606454841131 20.530397798348762 65-69 23.818099954975235 26.8447646205413 29.101005553054183 20.236129871429288 70-74 24.09427542033627 27.066653322658123 28.52281825460368 20.316253002401922 75-79 23.457223001402525 27.579643358044482 28.892005610098177 20.07112803045482 80-84 24.078243033668517 27.675221371754468 28.055430486767722 20.191105107809296 85-89 24.20694486140298 28.06964875412789 28.05463824677274 19.66876813769639 90-94 23.864091273018413 27.83226581265012 28.32766212970376 19.975980784627705 95-99 24.497148003602522 27.45922145501851 28.02962073451416 20.014009806864806 100-104 25.1588691518639 28.186139604703524 27.180385288966725 19.474605954465847 105-109 24.73855391543658 27.910933199899922 27.77082812109082 19.57968476357268 110-114 25.216650803987378 28.031858939037217 27.35560787456795 19.395882382407454 115-119 25.67067067067067 28.203203203203202 26.78178178178178 19.344344344344343 120-124 26.15338375995592 28.01683113760457 26.80959775584832 19.020187346591193 125-129 26.577208091327858 28.09433206489085 26.75746044462247 18.570999399158822 130-134 27.2822770246611 28.39277674953729 25.931669251163026 18.393276974638585 135-139 27.300935889094642 28.30689154696962 25.9396426605275 18.452529903408237 140-144 27.73576401061752 27.625582210647572 25.862673411128362 18.77598036760655 145-149 27.707341518416438 28.02806314206966 25.923327486845405 18.341267852668505 150 28.953953953953953 27.75275275275275 26.001001001001 17.29229229229229 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 3.0 24 2.5 25 2.0 26 2.5 27 4.5 28 9.5 29 13.0 30 16.0 31 21.0 32 23.0 33 36.5 34 50.5 35 59.0 36 82.5 37 113.0 38 134.0 39 158.5 40 196.5 41 229.0 42 250.0 43 277.5 44 288.0 45 285.0 46 270.5 47 237.0 48 236.0 49 225.5 50 187.0 51 148.5 52 112.0 53 89.0 54 67.5 55 49.0 56 33.0 57 24.0 58 19.0 59 11.5 60 10.0 61 7.5 62 4.5 63 2.5 64 1.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.015 30-34 0.0 35-39 0.045 40-44 0.06999999999999999 45-49 0.034999999999999996 50-54 0.21 55-59 0.11 60-64 0.075 65-69 0.055 70-74 0.08 75-79 0.18 80-84 0.055 85-89 0.06999999999999999 90-94 0.08 95-99 0.06999999999999999 100-104 0.075 105-109 0.075 110-114 0.185 115-119 0.1 120-124 0.185 125-129 0.13999999999999999 130-134 0.045 135-139 0.095 140-144 0.165 145-149 0.22499999999999998 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.4875 0.0 0.0 0.0 0.0 94-95 1.8625 0.0 0.0 0.0 0.0 96-97 2.3625 0.0 0.0 0.0 0.0 98-99 2.7 0.0 0.0 0.0 0.0 100-101 3.25 0.0 0.0 0.0 0.0 102-103 3.9625000000000004 0.0 0.0 0.0 0.0 104-105 4.574999999999999 0.0 0.0 0.0 0.0 106-107 5.25 0.0 0.0 0.0 0.0 108-109 6.1875 0.0 0.0 0.0 0.0 110-111 7.125 0.0 0.0 0.0 0.0 112-113 7.8375 0.0 0.0 0.0 0.0 114-115 8.6625 0.0 0.0 0.0 0.0 116-117 9.5625 0.0 0.0 0.0 0.0 118-119 10.575 0.0 0.0 0.0 0.0 120-121 11.625 0.0 0.0 0.0 0.0 122-123 12.575 0.0 0.0 0.0 0.0 124-125 13.6125 0.0 0.0 0.0 0.0 126-127 14.625 0.0 0.0 0.0 0.0 128-129 15.8125 0.0 0.0 0.0 0.0 130-131 16.825000000000003 0.0 0.0 0.0 0.0 132-133 18.025 0.0 0.0 0.0 0.0 134-135 19.174999999999997 0.0 0.0 0.0 0.0 136-137 20.4 0.0 0.0 0.0 0.0 138 21.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATCTT 10 0.007059411 143.41249 2 >>END_MODULE Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264986 spots for SRR4237591.sra Written 2264986 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra Read 2264982 spots for SRR4237591.sra Written 2264982 spots for SRR4237591.sra SRR ids: ['SRR4237591.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_du2mllff SRR4237591.sra spots: 45299644 blocks: [[1, 2264982], [2264983, 4529964], [4529965, 6794946], [6794947, 9059928], [9059929, 11324910], [11324911, 13589892], [13589893, 15854874], [15854875, 18119856], [18119857, 20384838], [20384839, 22649820], [22649821, 24914802], [24914803, 27179784], [27179785, 29444766], [29444767, 31709748], [31709749, 33974730], [33974731, 36239712], [36239713, 38504694], [38504695, 40769676], [40769677, 43034658], [43034659, 45299644]] SRR4237591 file size 15240386 SRR4237591 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237591 SRR4237591_1.fastq SRR4237591_2.fastq Input file: SRR4237591_1.fastq Paired file: SRR4237591_2.fastq trimmed: SRR4237591-trimmed-pair1.fastq, SRR4237591-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:48:49 2025 >> started Wed Feb 12 12:49:38 2025 >> done (49.305s) 45299644 read pairs processed; of these: 58255 ( 0.13%) short read pairs filtered out after trimming by size control 53316 ( 0.12%) empty read pairs filtered out after trimming by size control 45188073 (99.75%) read pairs available; of these: 20892775 (46.24%) trimmed read pairs available after processing 24295298 (53.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 8 0.00% 21 10 0.00% 22 11 0.00% 23 19 0.00% 24 15 0.00% 25 20 0.00% 26 10 0.00% 27 25 0.00% 28 23 0.00% 29 26 0.00% 30 36 0.00% 31 45 0.00% 32 49 0.00% 33 52 0.00% 34 71 0.00% 35 96 0.00% 36 90 0.00% 37 107 0.00% 38 127 0.00% 39 160 0.00% 40 210 0.00% 41 192 0.00% 42 208 0.00% 43 255 0.00% 44 286 0.00% 45 326 0.00% 46 391 0.00% 47 459 0.00% 48 575 0.00% 49 640 0.00% 50 682 0.00% 51 831 0.00% 52 893 0.00% 53 994 0.00% 54 1110 0.00% 55 1222 0.00% 56 1450 0.00% 57 1626 0.00% 58 2019 0.00% 59 2201 0.00% 60 2520 0.01% 61 2945 0.01% 62 3309 0.01% 63 3713 0.01% 64 4281 0.01% 65 4751 0.01% 66 5193 0.01% 67 5918 0.01% 68 6894 0.02% 69 9226 0.02% 70 10167 0.02% 71 9954 0.02% 72 11095 0.02% 73 12615 0.03% 74 14246 0.03% 75 15767 0.03% 76 17404 0.04% 77 19066 0.04% 78 20969 0.05% 79 23411 0.05% 80 25913 0.06% 81 29129 0.06% 82 32888 0.07% 83 37218 0.08% 84 51707 0.11% 85 55584 0.12% 86 51835 0.11% 87 56042 0.12% 88 60101 0.13% 89 67118 0.15% 90 72630 0.16% 91 77424 0.17% 92 90885 0.20% 93 89445 0.20% 94 99796 0.22% 95 105881 0.23% 96 112726 0.25% 97 118638 0.26% 98 124277 0.28% 99 131468 0.29% 100 136856 0.30% 101 142433 0.32% 102 151043 0.33% 103 159755 0.35% 104 167472 0.37% 105 175132 0.39% 106 184994 0.41% 107 190879 0.42% 108 195697 0.43% 109 200536 0.44% 110 202050 0.45% 111 207413 0.46% 112 213177 0.47% 113 218399 0.48% 114 225986 0.50% 115 234868 0.52% 116 237442 0.53% 117 244478 0.54% 118 250578 0.55% 119 251026 0.56% 120 250963 0.56% 121 255130 0.56% 122 254821 0.56% 123 257386 0.57% 124 262676 0.58% 125 266152 0.59% 126 269948 0.60% 127 275159 0.61% 128 277698 0.61% 129 280311 0.62% 130 282713 0.63% 131 281303 0.62% 132 283620 0.63% 133 285103 0.63% 134 287053 0.64% 135 291507 0.65% 136 295351 0.65% 137 301348 0.67% 138 308454 0.68% 139 312581 0.69% 140 319090 0.71% 141 326704 0.72% 142 338430 0.75% 143 351509 0.78% 144 372878 0.83% 145 410690 0.91% 146 470544 1.04% 147 590276 1.31% 148 941143 2.08% 149 5490280 12.15% 150 24295298 53.76% 45188073 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=11.68 fanout-score-rank=8 prefix-density=0.31 prefix-fanout=6.2 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=106.96 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=11.6 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=35 prefix-density=0.19 prefix-fanout=2.5 sequence=TCTAGCTAGTGGTTTAATAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=54.24 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=12.3 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR4237591 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:50:18 Started mapping on | Feb 12 12:50:18 Finished on | Feb 12 12:53:35 Mapping speed, Million of reads per hour | 825.77 Number of input reads | 45188073 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 43653632 Uniquely mapped reads % | 96.60% Average mapped length | 281.66 Number of splices: Total | 34746065 Number of splices: Annotated (sjdb) | 34098154 Number of splices: GT/AG | 34215486 Number of splices: GC/AG | 407513 Number of splices: AT/AC | 30840 Number of splices: Non-canonical | 92226 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 867904 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 86249 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.25% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 693484 693484 693484 N_multimapping 867904 867904 867904 N_noFeature 1313402 43013296 1680058 N_ambiguous 451694 2777 175815 UnstrandedReadsAssigned:41888536 PositiveStrandReadsAssigned:637559 NegativeStrandReadsAssigned:41797759 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=133 echo kmer=129 SRR4237591 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237591-trimmed-pair1.fastq SRR4237591-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,188,073 reads, 41,708,437 reads pseudoaligned [quant] estimated average fragment length: 191.256 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52401 SRR4237591.ke.tsv 34699 SRR4237591.se.tsv 87100 total ==> SRR4237591.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1827.74 763 10.9388 Potri.005G024800.1.v4.1 1035 844.744 93 2.88481 Potri.004G059700.1.v4.1 961 770.766 28 0.95191 Potri.007G009000.2.v4.1 1416 1225.74 0 0 Potri.003G141000.2.v4.1 2943 2752.74 722.403 6.8766 Potri.016G087400.1.v4.1 270 107.866 5423.33 1317.47 Potri.015G069301.1.v4.1 564 375.993 0 0 Potri.010G195200.1.v4.1 1773 1582.74 139 2.30125 Potri.012G127500.1.v4.1 977 786.751 9999 333.027 ==> SRR4237591.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7578 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 711 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 57 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237591 completed mapping pipeline successfully