Starting /dee2/code/volunteer_pipeline.sh SRR4237592 current disk space = 3051237666816 free memory = 1582036092 SRR4237592 SRAfilesize dd4b4d7f18174b629a7ca194fdce1d23 SRR4237592.sra SRR4237592.sra file validated SRR4237592 is paired end SRR4237592 is conventional basespace SRR4237592 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237592_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16025 34.0 33.0 34.0 32.0 34.0 2 33.13425 34.0 33.0 34.0 32.0 34.0 3 33.2225 34.0 33.0 34.0 32.0 34.0 4 33.225 34.0 33.0 34.0 32.0 34.0 5 33.20975 34.0 33.0 34.0 33.0 34.0 6 36.82425 38.0 37.0 38.0 35.0 38.0 7 37.2445 38.0 38.0 38.0 36.0 38.0 8 37.34875 38.0 38.0 38.0 37.0 38.0 9 37.37825 38.0 38.0 38.0 37.0 38.0 10-14 37.3931 38.0 38.0 38.0 37.0 38.0 15-19 37.37935 38.0 38.0 38.0 37.0 38.0 20-24 37.388 38.0 38.0 38.0 37.0 38.0 25-29 37.3805 38.0 38.0 38.0 37.0 38.0 30-34 37.3749 38.0 38.0 38.0 37.0 38.0 35-39 37.29575 38.0 38.0 38.0 37.0 38.0 40-44 37.202099999999994 38.0 38.0 38.0 36.2 38.0 45-49 37.153749999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.0901 38.0 38.0 38.0 36.0 38.0 55-59 36.99935000000001 38.0 38.0 38.0 36.0 38.0 60-64 37.0095 38.0 38.0 38.0 36.0 38.0 65-69 36.95885 38.0 38.0 38.0 35.8 38.0 70-74 36.953649999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.1933 38.0 37.2 38.0 32.4 38.0 80-84 36.77505 38.0 38.0 38.0 34.8 38.0 85-89 36.4713 38.0 37.8 38.0 33.6 38.0 90-94 36.4732 38.0 37.8 38.0 33.8 38.0 95-99 36.5319 38.0 38.0 38.0 34.0 38.0 100-104 36.4818 38.0 38.0 38.0 34.0 38.0 105-109 36.404450000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.2732 38.0 37.8 38.0 33.8 38.0 115-119 36.1436 38.0 37.8 38.0 33.4 38.0 120-124 36.04385 38.0 37.6 38.0 33.2 38.0 125-129 36.0252 38.0 37.2 38.0 33.0 38.0 130-134 35.651650000000004 38.0 36.6 38.0 31.4 38.0 135-139 35.579100000000004 38.0 36.0 38.0 31.0 38.0 140-144 35.36035 38.0 36.0 38.0 31.0 38.0 145-149 34.97175 38.0 36.0 38.0 31.0 38.0 150 29.0885 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 1.0 17 3.0 18 1.0 19 2.0 20 3.0 21 5.0 22 7.0 23 1.0 24 11.0 25 10.0 26 22.0 27 15.0 28 28.0 29 34.0 30 53.0 31 41.0 32 69.0 33 103.0 34 137.0 35 231.0 36 539.0 37 2680.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.175000000000004 12.85 7.625 31.35 2 24.64312546957175 14.074630603556223 34.15977961432507 27.122464312546956 3 19.85 19.15 27.975 33.025 4 22.3 29.15 23.425 25.124999999999996 5 22.900000000000002 33.775 23.925 19.400000000000002 6 18.59183162114758 35.50488599348534 24.154347281383114 21.748935103983964 7 13.875000000000002 25.55 41.925000000000004 18.65 8 18.25 24.9 32.074999999999996 24.775 9 16.975 24.4 33.175 25.45 10-14 20.044999999999998 30.205 27.175 22.575 15-19 19.62 29.145 27.76 23.474999999999998 20-24 19.869999999999997 28.749999999999996 27.305 24.075 25-29 19.650000000000002 29.635 27.145000000000003 23.57 30-34 19.794999999999998 29.720000000000002 27.169999999999998 23.315 35-39 19.82 29.13 27.61 23.44 40-44 19.785 29.995 27.33 22.89 45-49 20.34 28.910000000000004 27.165 23.585 50-54 19.825 28.765 27.725 23.685000000000002 55-59 19.835 29.25 27.255000000000003 23.66 60-64 19.91 28.82 27.63 23.64 65-69 20.015 28.775000000000002 27.115000000000002 24.095 70-74 20.294999999999998 29.599999999999998 26.955000000000002 23.150000000000002 75-79 20.25 28.63 27.115000000000002 24.005000000000003 80-84 20.215 29.075 27.43 23.28 85-89 19.875 28.95 27.72 23.455000000000002 90-94 20.07 28.83 27.450000000000003 23.65 95-99 20.544999999999998 28.125 27.900000000000002 23.43 100-104 20.62 29.26 27.005000000000003 23.115 105-109 20.345 28.87 27.665 23.119999999999997 110-114 20.275000000000002 27.92 27.77 24.035 115-119 20.75 28.605000000000004 27.205000000000002 23.44 120-124 20.51 28.99 27.055 23.445 125-129 21.07 28.470000000000002 27.075 23.385 130-134 21.42 28.110000000000003 26.77 23.7 135-139 20.965 28.26 27.025 23.75 140-144 20.455000000000002 28.18 26.740000000000002 24.625 145-149 20.625 28.24 26.950000000000003 24.185000000000002 150 19.817997977755308 28.26086956521739 26.9211324570273 25.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 2.5 23 1.5 24 2.0 25 4.0 26 5.0 27 6.0 28 10.0 29 11.5 30 18.5 31 29.5 32 42.5 33 50.5 34 52.5 35 81.5 36 105.0 37 115.5 38 139.5 39 148.0 40 174.5 41 213.0 42 234.5 43 277.5 44 282.5 45 260.0 46 265.0 47 263.5 48 231.5 49 183.5 50 158.0 51 151.0 52 115.0 53 90.5 54 77.5 55 47.0 56 35.0 57 28.5 58 19.5 59 12.5 60 11.0 61 11.0 62 10.5 63 6.5 64 4.0 65 4.0 66 2.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.22499999999999998 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 1.0999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9500000000000002 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.725 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.7 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.7625 0.0 0.0 0.0 0.0 132-133 6.125 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.925000000000001 0.0 0.0 0.0 0.0 138 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTATAA 10 0.006973645 144.0 5 ACCTCTC 10 0.006973645 144.0 6 >>END_MODULE SRR4237592 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237592_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40975 33.0 33.0 34.0 31.0 34.0 2 32.55775 33.0 33.0 34.0 32.0 34.0 3 31.0955 33.0 32.0 34.0 18.0 34.0 4 32.19475 33.0 33.0 34.0 28.0 34.0 5 32.484 33.0 33.0 34.0 32.0 34.0 6 36.65625 38.0 38.0 38.0 35.0 38.0 7 36.734 38.0 38.0 38.0 36.0 38.0 8 36.57375 38.0 38.0 38.0 35.0 38.0 9 36.70875 38.0 38.0 38.0 36.0 38.0 10-14 35.92935 38.0 37.0 38.0 30.8 38.0 15-19 35.986000000000004 38.0 37.2 38.0 30.4 38.0 20-24 36.649300000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.6159 38.0 38.0 38.0 36.0 38.0 30-34 36.57495 38.0 38.0 38.0 35.8 38.0 35-39 36.19369999999999 38.0 37.8 38.0 33.4 38.0 40-44 36.51035 38.0 38.0 38.0 35.4 38.0 45-49 36.552800000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.54605 38.0 38.0 38.0 35.6 38.0 55-59 36.444300000000005 38.0 38.0 38.0 35.0 38.0 60-64 36.45795 38.0 38.0 38.0 35.2 38.0 65-69 36.267450000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.3006 38.0 38.0 38.0 34.8 38.0 75-79 36.306650000000005 38.0 38.0 38.0 34.8 38.0 80-84 36.165949999999995 38.0 38.0 38.0 34.2 38.0 85-89 36.137299999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.132999999999996 38.0 38.0 38.0 34.2 38.0 95-99 35.52685 38.0 37.4 38.0 29.4 38.0 100-104 35.9562 38.0 38.0 38.0 34.0 38.0 105-109 35.897149999999996 38.0 38.0 38.0 34.0 38.0 110-114 35.80159999999999 38.0 38.0 38.0 33.6 38.0 115-119 34.084050000000005 37.8 33.4 38.0 27.2 38.0 120-124 35.3331 38.0 37.2 38.0 30.8 38.0 125-129 35.466699999999996 38.0 38.0 38.0 31.8 38.0 130-134 35.186099999999996 38.0 37.0 38.0 30.6 38.0 135-139 34.987449999999995 38.0 36.4 38.0 29.6 38.0 140-144 33.20295 37.6 32.4 38.0 22.8 38.0 145-149 33.8516 38.0 35.2 38.0 24.0 38.0 150 27.7555 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 15.0 4 6.0 5 5.0 6 1.0 7 1.0 8 5.0 9 2.0 10 7.0 11 2.0 12 3.0 13 2.0 14 6.0 15 4.0 16 2.0 17 10.0 18 6.0 19 7.0 20 9.0 21 6.0 22 7.0 23 11.0 24 16.0 25 19.0 26 27.0 27 22.0 28 36.0 29 34.0 30 27.0 31 56.0 32 73.0 33 99.0 34 137.0 35 208.0 36 556.0 37 2556.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.95 24.8 10.825 21.425 2 30.175 24.4 30.575000000000003 14.85 3 21.825 27.6 32.75 17.825 4 24.275 35.475 23.375 16.875 5 25.124999999999996 36.825 21.825 16.225 6 20.325 38.95 23.799999999999997 16.925 7 20.575 20.1 38.725 20.599999999999998 8 20.474999999999998 25.074999999999996 29.575000000000003 24.875 9 22.55 24.15 30.15 23.150000000000002 10-14 23.35 29.115000000000002 26.305 21.23 15-19 23.465 28.249999999999996 27.575 20.71 20-24 23.115 28.68 27.439999999999998 20.765 25-29 23.505000000000003 28.34 28.299999999999997 19.855 30-34 23.49 27.82 27.994999999999997 20.695 35-39 23.18 28.79 27.82 20.21 40-44 23.244999999999997 28.03 28.185 20.54 45-49 23.84 27.589999999999996 28.044999999999998 20.525 50-54 23.275000000000002 28.52 27.915 20.29 55-59 23.494999999999997 27.915 28.42 20.169999999999998 60-64 23.405 27.915 28.144999999999996 20.535 65-69 23.03 27.665 29.015 20.29 70-74 22.814999999999998 27.725 28.305000000000003 21.154999999999998 75-79 23.494999999999997 27.694999999999997 28.395 20.415 80-84 23.68 27.295 28.845 20.18 85-89 23.785 27.534999999999997 28.52 20.16 90-94 23.255 27.955000000000002 27.71 21.08 95-99 23.669999999999998 28.095 27.800000000000004 20.435 100-104 23.965 27.779999999999998 28.105000000000004 20.150000000000002 105-109 23.535 28.205000000000002 27.894999999999996 20.365 110-114 23.945 27.095000000000002 28.720000000000002 20.24 115-119 24.21 27.985 28.055000000000003 19.75 120-124 24.02 28.12 27.810000000000002 20.05 125-129 24.46 27.62 28.13 19.79 130-134 24.645 27.55 27.445000000000004 20.36 135-139 24.83 27.235 27.689999999999998 20.244999999999997 140-144 24.47 27.785 27.639999999999997 20.105 145-149 25.324999999999996 27.584999999999997 27.500000000000004 19.59 150 24.349999999999998 27.474999999999998 27.6 20.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 1.5 21 0.5 22 1.0 23 1.5 24 1.5 25 2.0 26 4.0 27 9.0 28 11.0 29 11.0 30 10.5 31 12.0 32 25.0 33 38.0 34 51.0 35 68.5 36 88.0 37 108.5 38 136.0 39 164.5 40 198.0 41 235.5 42 259.0 43 278.5 44 280.5 45 283.5 46 285.5 47 265.0 48 231.5 49 197.5 50 163.5 51 137.0 52 111.5 53 88.5 54 68.5 55 43.0 56 32.5 57 22.5 58 17.0 59 15.0 60 10.0 61 7.0 62 4.0 63 1.5 64 2.5 65 3.0 66 2.5 67 2.0 68 1.0 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.3625 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.7625 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 5.0125 0.0 0.0 0.0 0.0 130-131 5.675000000000001 0.0 0.0 0.0 0.0 132-133 6.0875 0.0 0.0 0.0 0.0 134-135 6.4 0.0 0.0 0.0 0.0 136-137 6.824999999999999 0.0 0.0 0.0 0.0 138 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.007966741 18.0 40-44 >>END_MODULE Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721807 spots for SRR4237592.sra Written 1721807 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra Read 1721802 spots for SRR4237592.sra Written 1721802 spots for SRR4237592.sra SRR ids: ['SRR4237592.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tkumyusx SRR4237592.sra spots: 34436045 blocks: [[1, 1721802], [1721803, 3443604], [3443605, 5165406], [5165407, 6887208], [6887209, 8609010], [8609011, 10330812], [10330813, 12052614], [12052615, 13774416], [13774417, 15496218], [15496219, 17218020], [17218021, 18939822], [18939823, 20661624], [20661625, 22383426], [22383427, 24105228], [24105229, 25827030], [25827031, 27548832], [27548833, 29270634], [29270635, 30992436], [30992437, 32714238], [32714239, 34436045]] SRR4237592 file size 11580287 SRR4237592 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237592 SRR4237592_1.fastq SRR4237592_2.fastq Input file: SRR4237592_1.fastq Paired file: SRR4237592_2.fastq trimmed: SRR4237592-trimmed-pair1.fastq, SRR4237592-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:36:09 2025 >> started Wed Feb 12 13:36:48 2025 >> done (38.271s) 34436045 read pairs processed; of these: 84763 ( 0.25%) short read pairs filtered out after trimming by size control 51227 ( 0.15%) empty read pairs filtered out after trimming by size control 34300055 (99.61%) read pairs available; of these: 12265745 (35.76%) trimmed read pairs available after processing 22034310 (64.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 6 0.00% 21 7 0.00% 22 9 0.00% 23 5 0.00% 24 11 0.00% 25 6 0.00% 26 14 0.00% 27 16 0.00% 28 14 0.00% 29 7 0.00% 30 18 0.00% 31 24 0.00% 32 21 0.00% 33 18 0.00% 34 18 0.00% 35 22 0.00% 36 22 0.00% 37 33 0.00% 38 43 0.00% 39 43 0.00% 40 34 0.00% 41 60 0.00% 42 62 0.00% 43 73 0.00% 44 78 0.00% 45 94 0.00% 46 75 0.00% 47 108 0.00% 48 106 0.00% 49 132 0.00% 50 146 0.00% 51 186 0.00% 52 178 0.00% 53 214 0.00% 54 249 0.00% 55 266 0.00% 56 297 0.00% 57 355 0.00% 58 388 0.00% 59 438 0.00% 60 523 0.00% 61 569 0.00% 62 624 0.00% 63 766 0.00% 64 801 0.00% 65 923 0.00% 66 1122 0.00% 67 1382 0.00% 68 1843 0.01% 69 2750 0.01% 70 2447 0.01% 71 2038 0.01% 72 2206 0.01% 73 2386 0.01% 74 2641 0.01% 75 3076 0.01% 76 3305 0.01% 77 3650 0.01% 78 4116 0.01% 79 4548 0.01% 80 5305 0.02% 81 6033 0.02% 82 6899 0.02% 83 8304 0.02% 84 15183 0.04% 85 16851 0.05% 86 14486 0.04% 87 16892 0.05% 88 20093 0.06% 89 16836 0.05% 90 17719 0.05% 91 20135 0.06% 92 22444 0.07% 93 21903 0.06% 94 23918 0.07% 95 25609 0.07% 96 26837 0.08% 97 28166 0.08% 98 29880 0.09% 99 31912 0.09% 100 34048 0.10% 101 36047 0.11% 102 38623 0.11% 103 40660 0.12% 104 43355 0.13% 105 45862 0.13% 106 48166 0.14% 107 49979 0.15% 108 53067 0.15% 109 56481 0.16% 110 57942 0.17% 111 59106 0.17% 112 61339 0.18% 113 64007 0.19% 114 67720 0.20% 115 69978 0.20% 116 72965 0.21% 117 76025 0.22% 118 78114 0.23% 119 80396 0.23% 120 82498 0.24% 121 84614 0.25% 122 86434 0.25% 123 89567 0.26% 124 92463 0.27% 125 95658 0.28% 126 99444 0.29% 127 102013 0.30% 128 105020 0.31% 129 108131 0.32% 130 111830 0.33% 131 113807 0.33% 132 116943 0.34% 133 121056 0.35% 134 125491 0.37% 135 129956 0.38% 136 136592 0.40% 137 142788 0.42% 138 148908 0.43% 139 156075 0.46% 140 164845 0.48% 141 175081 0.51% 142 189208 0.55% 143 207290 0.60% 144 237609 0.69% 145 271627 0.79% 146 339539 0.99% 147 475979 1.39% 148 865373 2.52% 149 5534996 16.14% 150 22034310 64.24% 34300055 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=34 prefix-density=0.23 prefix-fanout=2.5 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=157.11 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=14.3 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=40 prefix-density=0.22 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=74.41 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=16.1 sequence=TGCTGCTGAAATT SRR4237592 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:37:29 Started mapping on | Feb 12 13:37:30 Finished on | Feb 12 13:40:00 Mapping speed, Million of reads per hour | 823.20 Number of input reads | 34300055 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 33155189 Uniquely mapped reads % | 96.66% Average mapped length | 291.69 Number of splices: Total | 30139979 Number of splices: Annotated (sjdb) | 29605593 Number of splices: GT/AG | 29687167 Number of splices: GC/AG | 350043 Number of splices: AT/AC | 29560 Number of splices: Non-canonical | 73209 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 628962 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 40274 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 570635 570635 570635 N_multimapping 628962 628962 628962 N_noFeature 812522 32720084 1026989 N_ambiguous 358533 2492 135953 UnstrandedReadsAssigned:31984134 PositiveStrandReadsAssigned:432613 NegativeStrandReadsAssigned:31992247 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237592 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237592-trimmed-pair1.fastq SRR4237592-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,300,055 reads, 31,828,828 reads pseudoaligned [quant] estimated average fragment length: 230.36 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,293 rounds 52401 SRR4237592.ke.tsv 34699 SRR4237592.se.tsv 87100 total ==> SRR4237592.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.64 943 16.6034 Potri.005G024800.1.v4.1 1035 805.64 109 4.26083 Potri.004G059700.1.v4.1 961 731.703 23 0.989925 Potri.007G009000.2.v4.1 1416 1186.64 0 0 Potri.003G141000.2.v4.1 2943 2713.64 585.102 6.79029 Potri.016G087400.1.v4.1 270 85.7137 3893.58 1430.57 Potri.015G069301.1.v4.1 564 338.871 0 0 Potri.010G195200.1.v4.1 1773 1543.64 110 2.24417 Potri.012G127500.1.v4.1 977 747.686 9510 400.563 ==> SRR4237592.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3670 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 584 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 65 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237592 completed mapping pipeline successfully