Starting /dee2/code/volunteer_pipeline.sh SRR4237593 current disk space = 3051242397696 free memory = 1494269784 SRR4237593 SRAfilesize 0212ee794c2557704d5551db2237d266 SRR4237593.sra SRR4237593.sra file validated SRR4237593 is paired end SRR4237593 is conventional basespace SRR4237593 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237593_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.34025 34.0 33.0 34.0 33.0 34.0 2 33.422 34.0 33.0 34.0 33.0 34.0 3 33.44475 34.0 34.0 34.0 33.0 34.0 4 33.385 34.0 34.0 34.0 33.0 34.0 5 33.36625 34.0 34.0 34.0 33.0 34.0 6 36.795 38.0 37.0 38.0 35.0 38.0 7 37.269 38.0 38.0 38.0 36.0 38.0 8 37.395 38.0 38.0 38.0 37.0 38.0 9 37.517 38.0 38.0 38.0 38.0 38.0 10-14 37.5053 38.0 38.0 38.0 37.8 38.0 15-19 37.51049999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.529399999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.44175 38.0 38.0 38.0 37.8 38.0 30-34 37.157300000000006 38.0 38.0 38.0 36.4 38.0 35-39 37.4799 38.0 38.0 38.0 38.0 38.0 40-44 37.37065 38.0 38.0 38.0 37.0 38.0 45-49 37.366200000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.214999999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.1899 38.0 38.0 38.0 36.8 38.0 60-64 37.27569999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.2795 38.0 38.0 38.0 37.0 38.0 70-74 37.224149999999995 38.0 38.0 38.0 37.0 38.0 75-79 37.20525 38.0 38.0 38.0 37.0 38.0 80-84 37.0992 38.0 38.0 38.0 36.4 38.0 85-89 37.05055 38.0 38.0 38.0 36.0 38.0 90-94 37.03365 38.0 38.0 38.0 36.0 38.0 95-99 37.05415000000001 38.0 38.0 38.0 36.0 38.0 100-104 36.953199999999995 38.0 38.0 38.0 36.0 38.0 105-109 36.77395 38.0 38.0 38.0 35.2 38.0 110-114 36.6351 38.0 38.0 38.0 34.6 38.0 115-119 35.8373 38.0 37.0 38.0 29.4 38.0 120-124 36.515100000000004 38.0 38.0 38.0 34.6 38.0 125-129 36.506899999999995 38.0 38.0 38.0 34.2 38.0 130-134 36.4173 38.0 38.0 38.0 34.0 38.0 135-139 36.312850000000005 38.0 38.0 38.0 34.0 38.0 140-144 35.99145 38.0 38.0 38.0 33.2 38.0 145-149 34.548500000000004 38.0 35.6 38.0 27.0 38.0 150 30.31025 35.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 3.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 7.0 20 3.0 21 5.0 22 3.0 23 5.0 24 7.0 25 6.0 26 12.0 27 17.0 28 15.0 29 29.0 30 36.0 31 57.0 32 47.0 33 56.0 34 113.0 35 166.0 36 368.0 37 3042.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.69138276553106 12.850701402805612 9.143286573146291 32.31462925851704 2 24.224999999999998 14.475 32.6 28.7 3 19.325 22.025 25.05 33.6 4 21.85546386596649 29.08227056764191 24.48112028007002 24.58114528632158 5 21.825 34.75 22.650000000000002 20.775 6 18.224999999999998 36.925000000000004 24.25 20.599999999999998 7 14.7 26.174999999999997 41.425 17.7 8 16.05 26.0 32.800000000000004 25.15 9 16.7 25.1 33.25 24.95 10-14 19.994999999999997 29.854999999999997 26.965 23.185 15-19 19.24 29.17 27.77 23.82 20-24 19.435 29.385 27.439999999999998 23.74 25-29 20.07 29.555 27.01 23.365 30-34 20.185 29.195 27.26 23.36 35-39 19.919999999999998 29.075 27.284999999999997 23.72 40-44 20.02 29.255 27.47 23.255 45-49 20.485 29.03 27.175 23.31 50-54 20.315 29.45 27.07 23.165 55-59 20.244999999999997 28.82 27.900000000000002 23.035 60-64 19.78 28.825 27.400000000000002 23.995 65-69 19.77 28.785 27.66 23.785 70-74 20.064999999999998 28.365000000000002 27.61 23.96 75-79 19.400000000000002 28.804999999999996 27.35 24.445 80-84 19.869999999999997 28.194999999999997 27.834999999999997 24.099999999999998 85-89 20.24 28.794999999999998 27.05 23.915 90-94 20.105 28.505000000000003 27.939999999999998 23.45 95-99 20.52 28.815 26.82 23.845 100-104 20.68 29.04 26.790000000000003 23.49 105-109 20.3 28.54 27.315 23.845 110-114 20.635 28.475 27.029999999999998 23.86 115-119 20.630000000000003 28.349999999999998 27.295 23.724999999999998 120-124 20.72 27.725 27.800000000000004 23.755000000000003 125-129 21.0 27.975 27.705000000000002 23.32 130-134 20.95 28.000000000000004 27.455000000000002 23.595 135-139 20.335 28.88 26.875 23.91 140-144 20.875 28.389999999999997 26.575 24.16 145-149 20.745 28.16 26.985 24.11 150 20.191580539450467 28.182505671792285 28.031257877489285 23.59465591126796 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 4.0 24 2.5 25 4.5 26 6.0 27 3.0 28 9.0 29 16.5 30 22.0 31 29.5 32 42.5 33 48.5 34 54.5 35 66.5 36 85.0 37 102.5 38 126.5 39 162.5 40 192.5 41 226.0 42 246.5 43 252.0 44 252.0 45 265.0 46 269.5 47 266.5 48 244.0 49 200.5 50 159.5 51 129.5 52 118.5 53 106.5 54 83.0 55 57.0 56 37.0 57 23.0 58 22.5 59 19.0 60 11.0 61 7.5 62 7.5 63 3.5 64 1.5 65 2.5 66 2.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.7125000000000004 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.8375000000000004 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.6375 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.862500000000001 0.0 0.0 0.0 0.0 136-137 6.300000000000001 0.0 0.0 0.0 0.0 138 6.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATAAC 10 0.0069754543 143.9875 1 ATCAATT 10 0.0069754543 143.9875 2 >>END_MODULE SRR4237593 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237593_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.824 33.0 33.0 34.0 32.0 34.0 2 32.61575 33.0 33.0 34.0 32.0 34.0 3 32.78725 34.0 33.0 34.0 32.0 34.0 4 32.79625 34.0 33.0 34.0 32.0 34.0 5 32.84175 34.0 33.0 34.0 32.0 34.0 6 36.948 38.0 38.0 38.0 36.0 38.0 7 36.971 38.0 38.0 38.0 36.0 38.0 8 36.962 38.0 38.0 38.0 36.0 38.0 9 36.95575 38.0 38.0 38.0 36.0 38.0 10-14 36.9219 38.0 38.0 38.0 36.4 38.0 15-19 36.8765 38.0 38.0 38.0 36.0 38.0 20-24 36.90245 38.0 38.0 38.0 36.4 38.0 25-29 36.85680000000001 38.0 38.0 38.0 36.4 38.0 30-34 36.169500000000006 38.0 37.4 38.0 30.8 38.0 35-39 36.85915 38.0 38.0 38.0 36.2 38.0 40-44 35.2856 38.0 35.4 38.0 26.2 38.0 45-49 35.84585 38.0 36.8 38.0 30.4 38.0 50-54 36.31395 38.0 37.8 38.0 33.6 38.0 55-59 36.680249999999994 38.0 38.0 38.0 35.8 38.0 60-64 36.696600000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.72605 38.0 38.0 38.0 36.0 38.0 70-74 36.667899999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.4384 38.0 38.0 38.0 35.2 38.0 80-84 36.5741 38.0 38.0 38.0 35.6 38.0 85-89 36.52285 38.0 38.0 38.0 35.4 38.0 90-94 36.504099999999994 38.0 38.0 38.0 35.2 38.0 95-99 36.4704 38.0 38.0 38.0 35.0 38.0 100-104 36.38440000000001 38.0 38.0 38.0 34.8 38.0 105-109 36.32805 38.0 38.0 38.0 34.4 38.0 110-114 36.2687 38.0 38.0 38.0 34.4 38.0 115-119 36.1268 38.0 38.0 38.0 34.0 38.0 120-124 36.005 38.0 38.0 38.0 34.0 38.0 125-129 35.792100000000005 38.0 38.0 38.0 33.2 38.0 130-134 35.7572 38.0 38.0 38.0 33.4 38.0 135-139 35.59445 38.0 38.0 38.0 33.0 38.0 140-144 35.2538 38.0 38.0 38.0 31.2 38.0 145-149 34.8099 38.0 37.6 38.0 31.0 38.0 150 29.46 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 3.0 5 5.0 6 1.0 7 3.0 8 3.0 9 1.0 10 2.0 11 3.0 12 2.0 13 8.0 14 0.0 15 4.0 16 6.0 17 8.0 18 7.0 19 8.0 20 9.0 21 6.0 22 10.0 23 9.0 24 15.0 25 21.0 26 20.0 27 25.0 28 22.0 29 30.0 30 35.0 31 41.0 32 52.0 33 65.0 34 103.0 35 164.0 36 437.0 37 2861.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.475 22.2 10.725 21.6 2 28.875 23.7 30.4 17.025000000000002 3 22.425 27.675 31.775 18.125 4 25.900000000000002 34.425 22.7 16.975 5 24.175 38.775 21.375 15.675 6 21.375 39.7 22.375 16.55 7 20.525 21.375 40.150000000000006 17.95 8 22.725 23.3 29.95 24.025 9 22.625 24.025 29.625 23.724999999999998 10-14 23.875 28.315 26.174999999999997 21.634999999999998 15-19 23.96 28.07 27.634999999999998 20.335 20-24 23.805 28.189999999999998 27.439999999999998 20.565 25-29 23.7 28.015 27.765 20.52 30-34 23.39 27.97 28.144999999999996 20.495 35-39 23.24 28.075 27.82 20.865000000000002 40-44 23.585 28.03 27.79 20.595 45-49 23.715 27.939999999999998 28.04 20.305 50-54 23.599999999999998 27.71 28.01 20.68 55-59 23.935000000000002 27.21 28.315 20.54 60-64 23.435 27.38 28.804999999999996 20.380000000000003 65-69 23.78 28.515 27.800000000000004 19.905 70-74 24.3 27.62 27.694999999999997 20.385 75-79 23.45 27.96 28.799999999999997 19.79 80-84 23.605 27.48 28.475 20.44 85-89 24.315 27.83 27.605 20.25 90-94 23.27 28.325 27.935 20.47 95-99 23.465 28.24 27.779999999999998 20.515 100-104 24.12 27.615000000000002 27.815 20.45 105-109 24.115000000000002 27.735 27.845 20.305 110-114 23.815 28.38 27.405 20.4 115-119 24.5 27.495000000000005 27.85 20.155 120-124 24.065 28.105000000000004 27.775 20.055 125-129 24.555 27.49 27.98 19.975 130-134 25.080000000000002 28.1 27.47 19.35 135-139 25.16 27.694999999999997 27.284999999999997 19.86 140-144 25.05 28.065 27.339999999999996 19.545 145-149 25.724999999999998 27.560000000000002 27.24 19.475 150 26.0 27.325 26.775 19.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 0.5 22 0.5 23 1.0 24 2.0 25 2.5 26 3.0 27 5.0 28 6.5 29 8.5 30 11.5 31 18.5 32 22.5 33 29.0 34 47.5 35 63.5 36 73.0 37 90.5 38 125.0 39 170.0 40 195.5 41 226.0 42 256.0 43 273.5 44 286.5 45 275.5 46 276.5 47 271.5 48 252.0 49 207.0 50 172.5 51 149.5 52 115.0 53 96.5 54 78.5 55 55.0 56 37.0 57 27.5 58 17.0 59 15.0 60 9.5 61 4.5 62 5.0 63 2.5 64 1.5 65 2.0 66 1.0 67 0.5 68 0.5 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.6624999999999996 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.3125 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.15 0.0 0.0 0.0 0.0 138 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTCCA 10 0.006973645 144.0 4 TCTGAGG 10 0.006973645 144.0 7 >>END_MODULE Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243594 spots for SRR4237593.sra Written 2243594 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra Read 2243588 spots for SRR4237593.sra Written 2243588 spots for SRR4237593.sra SRR ids: ['SRR4237593.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_odz08ev3 SRR4237593.sra spots: 44871766 blocks: [[1, 2243588], [2243589, 4487176], [4487177, 6730764], [6730765, 8974352], [8974353, 11217940], [11217941, 13461528], [13461529, 15705116], [15705117, 17948704], [17948705, 20192292], [20192293, 22435880], [22435881, 24679468], [24679469, 26923056], [26923057, 29166644], [29166645, 31410232], [31410233, 33653820], [33653821, 35897408], [35897409, 38140996], [38140997, 40384584], [40384585, 42628172], [42628173, 44871766]] SRR4237593 file size 15096228 SRR4237593 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237593 SRR4237593_1.fastq SRR4237593_2.fastq Input file: SRR4237593_1.fastq Paired file: SRR4237593_2.fastq trimmed: SRR4237593-trimmed-pair1.fastq, SRR4237593-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:27:31 2025 >> started Wed Feb 12 13:28:23 2025 >> done (51.957s) 44871766 read pairs processed; of these: 101862 ( 0.23%) short read pairs filtered out after trimming by size control 58514 ( 0.13%) empty read pairs filtered out after trimming by size control 44711390 (99.64%) read pairs available; of these: 14419780 (32.25%) trimmed read pairs available after processing 30291610 (67.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 16 0.00% 21 10 0.00% 22 8 0.00% 23 8 0.00% 24 15 0.00% 25 11 0.00% 26 10 0.00% 27 8 0.00% 28 18 0.00% 29 15 0.00% 30 21 0.00% 31 16 0.00% 32 27 0.00% 33 27 0.00% 34 35 0.00% 35 25 0.00% 36 35 0.00% 37 39 0.00% 38 28 0.00% 39 41 0.00% 40 57 0.00% 41 54 0.00% 42 70 0.00% 43 64 0.00% 44 74 0.00% 45 92 0.00% 46 78 0.00% 47 109 0.00% 48 139 0.00% 49 146 0.00% 50 166 0.00% 51 183 0.00% 52 205 0.00% 53 226 0.00% 54 253 0.00% 55 257 0.00% 56 300 0.00% 57 322 0.00% 58 409 0.00% 59 431 0.00% 60 550 0.00% 61 581 0.00% 62 662 0.00% 63 732 0.00% 64 833 0.00% 65 1000 0.00% 66 1098 0.00% 67 1262 0.00% 68 1767 0.00% 69 4457 0.01% 70 3586 0.01% 71 2086 0.00% 72 2292 0.01% 73 2478 0.01% 74 2987 0.01% 75 3171 0.01% 76 3500 0.01% 77 3843 0.01% 78 4386 0.01% 79 4808 0.01% 80 5427 0.01% 81 6427 0.01% 82 7237 0.02% 83 8879 0.02% 84 18557 0.04% 85 17472 0.04% 86 16314 0.04% 87 16479 0.04% 88 18925 0.04% 89 19960 0.04% 90 19481 0.04% 91 20919 0.05% 92 24960 0.06% 93 25495 0.06% 94 27332 0.06% 95 28097 0.06% 96 30106 0.07% 97 31340 0.07% 98 32536 0.07% 99 35939 0.08% 100 37110 0.08% 101 39276 0.09% 102 42940 0.10% 103 45015 0.10% 104 47533 0.11% 105 50784 0.11% 106 53027 0.12% 107 55454 0.12% 108 59844 0.13% 109 60094 0.13% 110 62935 0.14% 111 67035 0.15% 112 68838 0.15% 113 71880 0.16% 114 75805 0.17% 115 78695 0.18% 116 81305 0.18% 117 84237 0.19% 118 86400 0.19% 119 88501 0.20% 120 91314 0.20% 121 93845 0.21% 122 97446 0.22% 123 101712 0.23% 124 105263 0.24% 125 109301 0.24% 126 114134 0.26% 127 115781 0.26% 128 119343 0.27% 129 124161 0.28% 130 127544 0.29% 131 130882 0.29% 132 135626 0.30% 133 141067 0.32% 134 145509 0.33% 135 151770 0.34% 136 158341 0.35% 137 166144 0.37% 138 173917 0.39% 139 180686 0.40% 140 191620 0.43% 141 204902 0.46% 142 220200 0.49% 143 242595 0.54% 144 274570 0.61% 145 326907 0.73% 146 411921 0.92% 147 619333 1.39% 148 996261 2.23% 149 6628950 14.83% 150 30291610 67.75% 44711390 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=35 prefix-density=0.25 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=103.95 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=20.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=9 fanout-score=60.42 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=14.3 sequence=TGTTGGTGGTGG SRR4237593 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:29:15 Started mapping on | Feb 12 13:29:15 Finished on | Feb 12 13:35:10 Mapping speed, Million of reads per hour | 453.41 Number of input reads | 44711390 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 42389781 Uniquely mapped reads % | 94.81% Average mapped length | 292.67 Number of splices: Total | 37898563 Number of splices: Annotated (sjdb) | 37232466 Number of splices: GT/AG | 37309061 Number of splices: GC/AG | 454438 Number of splices: AT/AC | 38213 Number of splices: Non-canonical | 96851 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 816072 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 70942 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1570745 1570745 1570745 N_multimapping 816072 816072 816072 N_noFeature 1166044 41809708 1452274 N_ambiguous 470094 3261 173792 UnstrandedReadsAssigned:40753643 PositiveStrandReadsAssigned:576812 NegativeStrandReadsAssigned:40763715 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237593 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237593-trimmed-pair1.fastq SRR4237593-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,711,390 reads, 40,549,091 reads pseudoaligned [quant] estimated average fragment length: 238.17 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR4237593.ke.tsv 34699 SRR4237593.se.tsv 87100 total ==> SRR4237593.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.83 965.507 13.7896 Potri.005G024800.1.v4.1 1035 797.83 99 3.15605 Potri.004G059700.1.v4.1 961 723.872 49 1.72169 Potri.007G009000.2.v4.1 1416 1178.83 0 0 Potri.003G141000.2.v4.1 2943 2705.83 644.165 6.05504 Potri.016G087400.1.v4.1 270 82.6306 5248 1615.37 Potri.015G069301.1.v4.1 564 332.234 0 0 Potri.010G195200.1.v4.1 1773 1535.83 186 3.08028 Potri.012G127500.1.v4.1 977 739.867 18837 647.557 ==> SRR4237593.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4289 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 788 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR4237593 completed mapping pipeline successfully