Starting /dee2/code/volunteer_pipeline.sh SRR4237594 current disk space = 3051666788352 free memory = 1579181624 SRR4237594 SRAfilesize 237d1d632653af22d7721a5703911e69 SRR4237594.sra SRR4237594.sra file validated SRR4237594 is paired end SRR4237594 is conventional basespace SRR4237594 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237594_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36675 34.0 33.0 34.0 33.0 34.0 2 33.39075 34.0 33.0 34.0 33.0 34.0 3 33.46325 34.0 34.0 34.0 33.0 34.0 4 33.35875 34.0 34.0 34.0 33.0 34.0 5 33.3595 34.0 33.0 34.0 33.0 34.0 6 36.07525 38.0 37.0 38.0 34.0 38.0 7 37.171 38.0 38.0 38.0 36.0 38.0 8 37.21775 38.0 38.0 38.0 36.0 38.0 9 37.436 38.0 38.0 38.0 37.0 38.0 10-14 37.5172 38.0 38.0 38.0 37.6 38.0 15-19 37.52395 38.0 38.0 38.0 38.0 38.0 20-24 37.061400000000006 38.0 38.0 38.0 36.0 38.0 25-29 37.481950000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.4492 38.0 38.0 38.0 38.0 38.0 35-39 37.451 38.0 38.0 38.0 37.6 38.0 40-44 37.40259999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.363749999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.26155 38.0 38.0 38.0 36.8 38.0 55-59 37.1891 38.0 38.0 38.0 36.8 38.0 60-64 37.227850000000004 38.0 38.0 38.0 36.8 38.0 65-69 37.2014 38.0 38.0 38.0 37.0 38.0 70-74 36.666 38.0 37.8 38.0 34.4 38.0 75-79 37.03995 38.0 38.0 38.0 36.0 38.0 80-84 36.93175000000001 38.0 38.0 38.0 35.6 38.0 85-89 37.01255 38.0 38.0 38.0 36.0 38.0 90-94 36.968900000000005 38.0 38.0 38.0 35.8 38.0 95-99 36.968149999999994 38.0 38.0 38.0 36.0 38.0 100-104 36.8735 38.0 38.0 38.0 35.8 38.0 105-109 36.853950000000005 38.0 38.0 38.0 36.0 38.0 110-114 35.69335 38.0 36.4 38.0 29.6 38.0 115-119 36.6388 38.0 38.0 38.0 35.0 38.0 120-124 36.3994 38.0 38.0 38.0 34.0 38.0 125-129 36.5305 38.0 38.0 38.0 34.8 38.0 130-134 36.14465 38.0 37.4 38.0 33.4 38.0 135-139 34.31400000000001 37.6 33.0 38.0 26.8 38.0 140-144 36.039750000000005 38.0 38.0 38.0 33.4 38.0 145-149 35.794349999999994 38.0 38.0 38.0 33.4 38.0 150 31.27225 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 3.0 19 1.0 20 1.0 21 5.0 22 4.0 23 7.0 24 6.0 25 6.0 26 9.0 27 19.0 28 22.0 29 21.0 30 39.0 31 47.0 32 46.0 33 68.0 34 121.0 35 187.0 36 498.0 37 2883.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.19409704852426 11.905952976488244 8.479239619809904 41.42071035517759 2 21.75 16.900000000000002 36.199999999999996 25.15 3 20.549999999999997 19.975 25.45 34.025 4 23.625 29.849999999999998 22.400000000000002 24.125 5 22.825 34.375 22.15 20.65 6 17.046911048449115 36.47782619841066 25.019225839528325 21.456036913611896 7 13.5 26.075 42.75 17.675 8 16.725 24.15 33.300000000000004 25.825 9 16.8 24.15 34.65 24.4 10-14 19.939999999999998 30.45 26.57 23.04 15-19 19.605 29.134999999999998 27.42 23.84 20-24 19.925 29.065 27.805000000000003 23.205000000000002 25-29 19.355 29.575000000000003 27.195000000000004 23.875 30-34 19.6 28.904999999999998 27.389999999999997 24.104999999999997 35-39 19.225 29.89 27.35 23.535 40-44 20.005 29.64 26.950000000000003 23.405 45-49 19.009999999999998 28.725 28.349999999999998 23.915 50-54 19.7 29.409999999999997 27.275 23.615 55-59 19.325 29.14 27.43 24.104999999999997 60-64 19.705000000000002 29.044999999999998 27.560000000000002 23.69 65-69 19.67 29.049999999999997 27.810000000000002 23.47 70-74 19.81 29.404999999999998 26.895000000000003 23.89 75-79 20.02 29.17 27.55 23.26 80-84 19.735 29.14 27.400000000000002 23.724999999999998 85-89 19.61 29.43 26.895000000000003 24.065 90-94 19.56 29.349999999999998 27.35 23.74 95-99 20.18 28.285 27.67 23.865 100-104 20.025000000000002 29.195 26.855 23.925 105-109 19.585 29.28 27.584999999999997 23.549999999999997 110-114 19.82 29.04 27.355 23.785 115-119 20.175 28.395 27.284999999999997 24.145 120-124 20.59 28.735 27.295 23.380000000000003 125-129 20.380000000000003 28.595 27.435 23.59 130-134 20.745 28.73 26.705000000000002 23.82 135-139 20.465 28.24 27.735 23.56 140-144 20.555 28.77 26.35 24.325 145-149 20.3 28.860000000000003 26.965 23.875 150 20.995995995995994 28.203203203203202 26.851851851851855 23.94894894894895 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.5 23 2.5 24 4.0 25 3.0 26 3.5 27 4.5 28 7.0 29 13.5 30 19.5 31 27.0 32 44.0 33 55.5 34 61.5 35 77.0 36 93.0 37 121.0 38 146.0 39 166.5 40 190.0 41 225.5 42 247.0 43 260.0 44 284.5 45 274.0 46 264.0 47 247.0 48 214.5 49 195.5 50 163.5 51 137.0 52 109.5 53 84.0 54 68.5 55 47.5 56 37.0 57 27.0 58 17.0 59 13.0 60 12.0 61 9.0 62 7.5 63 4.5 64 2.0 65 1.5 66 1.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 2.475 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2625000000000002 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.575 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.3125 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 3.9125 0.0 0.0 0.0 0.0 136-137 4.3125 0.0 0.0 0.0 0.0 138 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGAA 10 0.0064790826 147.53847 4 CATATGA 10 0.0064790826 147.53847 3 TTAACAA 10 0.0069954093 143.85 8 >>END_MODULE SRR4237594 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237594_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86625 33.0 33.0 34.0 32.0 34.0 2 32.88775 34.0 33.0 34.0 32.0 34.0 3 32.98925 34.0 33.0 34.0 32.0 34.0 4 32.94025 34.0 33.0 34.0 32.0 34.0 5 32.865 34.0 33.0 34.0 32.0 34.0 6 34.66425 38.0 36.0 38.0 16.0 38.0 7 36.6055 38.0 37.0 38.0 34.0 38.0 8 36.7045 38.0 38.0 38.0 35.0 38.0 9 36.95575 38.0 38.0 38.0 36.0 38.0 10-14 36.79925 38.0 38.0 38.0 35.6 38.0 15-19 36.940549999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.99715 38.0 38.0 38.0 36.4 38.0 25-29 36.272400000000005 38.0 37.2 38.0 32.2 38.0 30-34 36.09585 38.0 37.0 38.0 32.4 38.0 35-39 36.894 38.0 38.0 38.0 36.4 38.0 40-44 36.9215 38.0 38.0 38.0 36.4 38.0 45-49 36.88935 38.0 38.0 38.0 36.0 38.0 50-54 36.89305 38.0 38.0 38.0 36.0 38.0 55-59 36.88375 38.0 38.0 38.0 36.2 38.0 60-64 36.8247 38.0 38.0 38.0 36.0 38.0 65-69 36.7835 38.0 38.0 38.0 36.0 38.0 70-74 36.74015000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.4397 38.0 38.0 38.0 34.4 38.0 80-84 36.51215 38.0 38.0 38.0 34.8 38.0 85-89 36.5951 38.0 38.0 38.0 35.8 38.0 90-94 36.57625 38.0 38.0 38.0 35.2 38.0 95-99 36.524249999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.3676 38.0 38.0 38.0 34.6 38.0 105-109 36.3437 38.0 38.0 38.0 34.6 38.0 110-114 36.3058 38.0 38.0 38.0 34.2 38.0 115-119 36.08175 38.0 37.8 38.0 33.4 38.0 120-124 35.9122 38.0 38.0 38.0 33.0 38.0 125-129 35.9089 38.0 38.0 38.0 33.6 38.0 130-134 35.777249999999995 38.0 38.0 38.0 32.8 38.0 135-139 35.6338 38.0 38.0 38.0 32.8 38.0 140-144 35.3842 38.0 37.8 38.0 31.6 38.0 145-149 34.962900000000005 38.0 38.0 38.0 31.2 38.0 150 29.27775 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 2.0 5 0.0 6 7.0 7 1.0 8 1.0 9 4.0 10 3.0 11 4.0 12 0.0 13 2.0 14 4.0 15 3.0 16 1.0 17 5.0 18 3.0 19 3.0 20 4.0 21 7.0 22 12.0 23 9.0 24 12.0 25 10.0 26 24.0 27 21.0 28 37.0 29 35.0 30 35.0 31 48.0 32 62.0 33 87.0 34 93.0 35 183.0 36 382.0 37 2886.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.975 19.5 12.775 28.749999999999996 2 27.275 25.25 33.275 14.2 3 20.674999999999997 28.025 31.15 20.150000000000002 4 25.724999999999998 34.55 22.575 17.150000000000002 5 26.025 37.025000000000006 21.175 15.775 6 19.025 40.150000000000006 23.35 17.474999999999998 7 18.75 21.099999999999998 40.975 19.175 8 22.425 23.65 29.349999999999998 24.575 9 22.575 25.025 30.599999999999998 21.8 10-14 24.26 28.294999999999998 26.924999999999997 20.52 15-19 23.419999999999998 28.68 27.875 20.025000000000002 20-24 23.855 28.79 27.229999999999997 20.125 25-29 24.145 27.725 27.685 20.445 30-34 23.22 28.360000000000003 27.935 20.485 35-39 24.03 28.215 27.37 20.385 40-44 23.46 27.800000000000004 28.63 20.11 45-49 23.71 28.07 27.825 20.395 50-54 23.995 27.705000000000002 28.175 20.125 55-59 23.974999999999998 27.500000000000004 28.199999999999996 20.325 60-64 23.93 27.839999999999996 27.975 20.255000000000003 65-69 23.365 27.544999999999998 29.054999999999996 20.035 70-74 22.97 27.48 29.145 20.405 75-79 23.625 27.73 28.389999999999997 20.255000000000003 80-84 23.685000000000002 27.42 28.384999999999998 20.51 85-89 23.52 28.28 28.09 20.11 90-94 23.437343734373435 27.83278327832783 28.40784078407841 20.32203220322032 95-99 23.335 27.96 28.494999999999997 20.21 100-104 23.72 27.48 28.660000000000004 20.14 105-109 23.409681936387276 27.625525105021005 28.665733146629325 20.29905981196239 110-114 23.794999999999998 27.355 28.555000000000003 20.294999999999998 115-119 23.909781956391278 27.590518103620727 28.62072414482897 19.878975795159032 120-124 23.794758951790357 27.385477095419088 28.855771154230847 19.963992798559712 125-129 24.205 27.685 28.415000000000003 19.695 130-134 24.635 28.084999999999997 27.284999999999997 19.994999999999997 135-139 24.337433743374337 27.847784778477845 28.28282828282828 19.53195319531953 140-144 24.349999999999998 27.315 28.65 19.685 145-149 25.232569770931278 27.073121936580975 28.328498549564866 19.365809742922877 150 25.3 27.3 27.575 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 2.0 23 2.5 24 2.0 25 3.5 26 3.0 27 3.5 28 7.0 29 8.5 30 13.5 31 18.0 32 25.5 33 40.0 34 48.5 35 52.5 36 71.0 37 109.5 38 139.0 39 164.0 40 204.5 41 247.0 42 261.0 43 264.0 44 288.5 45 302.0 46 282.5 47 245.5 48 222.5 49 212.0 50 170.0 51 143.0 52 128.5 53 89.5 54 66.5 55 47.5 56 25.0 57 15.5 58 14.0 59 13.0 60 10.0 61 8.0 62 7.5 63 5.0 64 3.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.02 120-124 0.02 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.03 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0125 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.075 0.0 0.0 0.025 0.0 88-89 0.075 0.0 0.0 0.025 0.0 90-91 0.075 0.0 0.0 0.025 0.0 92-93 0.15 0.0 0.0 0.025 0.0 94-95 0.1875 0.0 0.0 0.025 0.0 96-97 0.225 0.0 0.0 0.025 0.0 98-99 0.3125 0.0 0.0 0.025 0.0 100-101 0.35 0.0 0.0 0.025 0.0 102-103 0.4625 0.0 0.0 0.025 0.0 104-105 0.5125 0.0 0.0 0.025 0.0 106-107 0.65 0.0 0.0 0.025 0.0 108-109 0.7375 0.0 0.0 0.025 0.0 110-111 0.875 0.0 0.0 0.025 0.0 112-113 1.0 0.0 0.0 0.025 0.0 114-115 1.1875 0.0 0.0 0.025 0.0 116-117 1.3624999999999998 0.0 0.0 0.025 0.0 118-119 1.5750000000000002 0.0 0.0 0.025 0.0 120-121 1.7 0.0 0.0 0.025 0.0 122-123 2.0999999999999996 0.0 0.0 0.025 0.0 124-125 2.3499999999999996 0.0 0.0 0.025 0.0 126-127 2.75 0.0 0.0 0.025 0.0 128-129 3.25 0.0 0.0 0.025 0.0 130-131 3.5625 0.0 0.0 0.025 0.0 132-133 3.9000000000000004 0.0 0.0 0.025 0.0 134-135 4.25 0.0 0.0 0.025 0.0 136-137 4.7125 0.0 0.0 0.025 0.0 138 4.9 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCCA 10 0.006973645 144.0 9 >>END_MODULE Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949814 spots for SRR4237594.sra Written 2949814 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra Read 2949810 spots for SRR4237594.sra Written 2949810 spots for SRR4237594.sra SRR ids: ['SRR4237594.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r9yf800l SRR4237594.sra spots: 58996204 blocks: [[1, 2949810], [2949811, 5899620], [5899621, 8849430], [8849431, 11799240], [11799241, 14749050], [14749051, 17698860], [17698861, 20648670], [20648671, 23598480], [23598481, 26548290], [26548291, 29498100], [29498101, 32447910], [32447911, 35397720], [35397721, 38347530], [38347531, 41297340], [41297341, 44247150], [44247151, 47196960], [47196961, 50146770], [50146771, 53096580], [53096581, 56046390], [56046391, 58996204]] SRR4237594 file size 19854950 SRR4237594 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237594 SRR4237594_1.fastq SRR4237594_2.fastq Input file: SRR4237594_1.fastq Paired file: SRR4237594_2.fastq trimmed: SRR4237594-trimmed-pair1.fastq, SRR4237594-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:00:41 2025 >> started Wed Feb 12 15:01:50 2025 >> done (68.850s) 58996204 read pairs processed; of these: 79700 ( 0.14%) short read pairs filtered out after trimming by size control 22388 ( 0.04%) empty read pairs filtered out after trimming by size control 58894116 (99.83%) read pairs available; of these: 17543539 (29.79%) trimmed read pairs available after processing 41350577 (70.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 9 0.00% 20 6 0.00% 21 4 0.00% 22 13 0.00% 23 12 0.00% 24 16 0.00% 25 13 0.00% 26 7 0.00% 27 13 0.00% 28 12 0.00% 29 16 0.00% 30 24 0.00% 31 20 0.00% 32 20 0.00% 33 33 0.00% 34 31 0.00% 35 31 0.00% 36 33 0.00% 37 37 0.00% 38 41 0.00% 39 53 0.00% 40 45 0.00% 41 54 0.00% 42 63 0.00% 43 68 0.00% 44 92 0.00% 45 85 0.00% 46 77 0.00% 47 93 0.00% 48 131 0.00% 49 107 0.00% 50 136 0.00% 51 137 0.00% 52 157 0.00% 53 158 0.00% 54 189 0.00% 55 217 0.00% 56 257 0.00% 57 280 0.00% 58 309 0.00% 59 332 0.00% 60 347 0.00% 61 432 0.00% 62 440 0.00% 63 531 0.00% 64 584 0.00% 65 691 0.00% 66 772 0.00% 67 871 0.00% 68 1007 0.00% 69 2184 0.00% 70 2265 0.00% 71 1483 0.00% 72 1556 0.00% 73 1630 0.00% 74 1872 0.00% 75 2211 0.00% 76 2289 0.00% 77 2606 0.00% 78 2916 0.00% 79 3333 0.01% 80 3598 0.01% 81 4263 0.01% 82 5079 0.01% 83 6345 0.01% 84 18442 0.03% 85 23190 0.04% 86 11714 0.02% 87 11556 0.02% 88 13007 0.02% 89 13414 0.02% 90 15769 0.03% 91 15151 0.03% 92 16511 0.03% 93 19146 0.03% 94 18972 0.03% 95 20030 0.03% 96 21471 0.04% 97 23301 0.04% 98 26772 0.05% 99 26460 0.04% 100 28460 0.05% 101 29964 0.05% 102 31505 0.05% 103 33595 0.06% 104 36283 0.06% 105 38601 0.07% 106 41200 0.07% 107 45027 0.08% 108 49069 0.08% 109 50336 0.09% 110 51507 0.09% 111 54256 0.09% 112 57522 0.10% 113 60740 0.10% 114 62747 0.11% 115 66447 0.11% 116 70032 0.12% 117 75234 0.13% 118 81677 0.14% 119 79871 0.14% 120 82657 0.14% 121 88011 0.15% 122 90704 0.15% 123 96411 0.16% 124 98931 0.17% 125 103729 0.18% 126 110175 0.19% 127 114770 0.19% 128 120877 0.21% 129 125984 0.21% 130 131066 0.22% 131 135810 0.23% 132 141795 0.24% 133 148908 0.25% 134 156134 0.27% 135 165091 0.28% 136 174854 0.30% 137 186088 0.32% 138 197992 0.34% 139 211278 0.36% 140 225732 0.38% 141 246598 0.42% 142 270100 0.46% 143 299146 0.51% 144 346642 0.59% 145 410164 0.70% 146 522264 0.89% 147 735328 1.25% 148 1349036 2.29% 149 9065535 15.39% 150 41350577 70.21% 58894116 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=37 prefix-density=0.17 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=323.06 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=18.5 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=310.58 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=30.2 sequence=AAGAAGAAGAAG SRR4237594 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:02:38 Started mapping on | Feb 12 15:02:38 Finished on | Feb 12 15:07:17 Mapping speed, Million of reads per hour | 759.92 Number of input reads | 58894116 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 56764129 Uniquely mapped reads % | 96.38% Average mapped length | 294.61 Number of splices: Total | 52172806 Number of splices: Annotated (sjdb) | 51298703 Number of splices: GT/AG | 51381236 Number of splices: GC/AG | 624152 Number of splices: AT/AC | 46170 Number of splices: Non-canonical | 121248 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1151851 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 114214 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1022579 1022579 1022579 N_multimapping 1151851 1151851 1151851 N_noFeature 1443119 56142166 1763821 N_ambiguous 533817 3219 230416 UnstrandedReadsAssigned:54787193 PositiveStrandReadsAssigned:618744 NegativeStrandReadsAssigned:54769892 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237594 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237594-trimmed-pair1.fastq SRR4237594-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 58,894,116 reads, 54,357,991 reads pseudoaligned [quant] estimated average fragment length: 241.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR4237594.ke.tsv 34699 SRR4237594.se.tsv 87100 total ==> SRR4237594.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.26 1307 13.5238 Potri.005G024800.1.v4.1 1035 794.255 182 4.2139 Potri.004G059700.1.v4.1 961 720.281 13 0.331905 Potri.007G009000.2.v4.1 1416 1175.26 0 0 Potri.003G141000.2.v4.1 2943 2702.26 945.225 6.43253 Potri.016G087400.1.v4.1 270 76.0189 8162.27 1974.52 Potri.015G069301.1.v4.1 564 327.05 0 0 Potri.010G195200.1.v4.1 1773 1532.26 183.811 2.20604 Potri.012G127500.1.v4.1 977 736.262 20056 500.939 ==> SRR4237594.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5422 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 840 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 74 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237594 completed mapping pipeline successfully