Starting /dee2/code/volunteer_pipeline.sh SRR4237595 current disk space = 3051674808320 free memory = 1580118072 SRR4237595 SRAfilesize 9d393f47c765b463ec353d20e921a391 SRR4237595.sra SRR4237595.sra file validated SRR4237595 is paired end SRR4237595 is conventional basespace SRR4237595 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237595_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02625 34.0 33.0 34.0 32.0 34.0 2 33.187 34.0 33.0 34.0 32.0 34.0 3 33.2495 34.0 33.0 34.0 32.0 34.0 4 33.24125 34.0 33.0 34.0 32.0 34.0 5 33.24725 34.0 33.0 34.0 32.0 34.0 6 35.2545 38.0 37.0 38.0 32.0 38.0 7 36.73975 38.0 37.0 38.0 34.0 38.0 8 36.93975 38.0 38.0 38.0 35.0 38.0 9 37.23275 38.0 38.0 38.0 36.0 38.0 10-14 37.38575 38.0 38.0 38.0 37.0 38.0 15-19 37.20885 38.0 38.0 38.0 36.6 38.0 20-24 37.2119 38.0 38.0 38.0 36.6 38.0 25-29 37.19955 38.0 38.0 38.0 36.4 38.0 30-34 35.56245 37.8 35.2 38.0 28.4 38.0 35-39 36.700900000000004 38.0 37.4 38.0 34.2 38.0 40-44 37.21125 38.0 38.0 38.0 36.2 38.0 45-49 36.285700000000006 38.0 37.0 38.0 31.2 38.0 50-54 37.078 38.0 38.0 38.0 36.0 38.0 55-59 36.99145 38.0 38.0 38.0 36.0 38.0 60-64 37.033699999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.930400000000006 38.0 38.0 38.0 35.8 38.0 70-74 36.696600000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.88185 38.0 38.0 38.0 35.4 38.0 80-84 36.78404999999999 38.0 38.0 38.0 35.0 38.0 85-89 35.56385 37.8 35.4 38.0 30.6 38.0 90-94 35.814350000000005 37.8 36.4 38.0 31.2 38.0 95-99 35.62285 38.0 35.8 38.0 29.6 38.0 100-104 36.321749999999994 38.0 37.6 38.0 33.8 38.0 105-109 35.728899999999996 38.0 37.0 38.0 30.0 38.0 110-114 34.91009999999999 37.8 34.6 38.0 26.8 38.0 115-119 36.15885 38.0 37.6 38.0 33.6 38.0 120-124 34.2905 37.6 33.2 38.0 26.2 38.0 125-129 35.9786 38.0 37.0 38.0 32.8 38.0 130-134 35.84815 38.0 37.0 38.0 32.6 38.0 135-139 35.821749999999994 38.0 37.0 38.0 32.8 38.0 140-144 35.3439 38.0 36.0 38.0 31.4 38.0 145-149 33.85475 38.0 35.2 38.0 22.2 38.0 150 28.7585 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 3.0 19 1.0 20 5.0 21 3.0 22 5.0 23 4.0 24 10.0 25 10.0 26 25.0 27 26.0 28 30.0 29 46.0 30 59.0 31 73.0 32 95.0 33 113.0 34 202.0 35 339.0 36 790.0 37 2156.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.51875937968984 11.030515257628814 9.854927463731865 41.59579789894948 2 23.35 16.475 34.8 25.374999999999996 3 22.15 19.650000000000002 24.45 33.75 4 22.35 29.849999999999998 22.45 25.35 5 23.65 35.15 21.9 19.3 6 16.875981161695446 38.0690737833595 23.861852433281005 21.19309262166405 7 14.424999999999999 25.85 41.675000000000004 18.05 8 16.825000000000003 26.075 32.525 24.575 9 16.925 24.3 33.75 25.025 10-14 19.825 30.42 26.605 23.150000000000002 15-19 19.5 29.15 28.244999999999997 23.105 20-24 19.775000000000002 29.565 27.355 23.305 25-29 19.66 29.975 27.279999999999998 23.085 30-34 19.814999999999998 29.62 27.26 23.305 35-39 20.005 29.13 27.52 23.345 40-44 19.25 29.56 27.200000000000003 23.990000000000002 45-49 20.105 29.215000000000003 26.745 23.935000000000002 50-54 18.915000000000003 29.830000000000002 27.26 23.995 55-59 19.915 28.775000000000002 27.765 23.544999999999998 60-64 19.53 29.21 27.16 24.099999999999998 65-69 19.575 29.13 27.455000000000002 23.84 70-74 19.445 29.7 26.96 23.895 75-79 19.945 29.035 27.47 23.549999999999997 80-84 20.24 28.194999999999997 27.685 23.880000000000003 85-89 19.85 28.945 27.634999999999998 23.57 90-94 20.25 29.395 26.735 23.62 95-99 19.79 29.485 27.245 23.48 100-104 20.31 28.384999999999998 27.88 23.425 105-109 19.515 28.965000000000003 27.474999999999998 24.044999999999998 110-114 20.669999999999998 28.084999999999997 27.235 24.01 115-119 20.555 28.799999999999997 26.895000000000003 23.75 120-124 19.96 28.470000000000002 27.279999999999998 24.29 125-129 20.3 28.544999999999998 26.985 24.169999999999998 130-134 20.28 28.605000000000004 27.575 23.54 135-139 20.365 29.195 26.445 23.995 140-144 20.115 28.12 26.46 25.305 145-149 20.885 28.7 26.305 24.11 150 19.02975743935984 29.582395598899723 26.03150787696924 25.35633908477119 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 2.0 23 2.0 24 1.5 25 2.5 26 4.5 27 6.0 28 8.5 29 15.5 30 22.5 31 33.5 32 45.5 33 56.0 34 63.5 35 76.0 36 94.0 37 112.0 38 145.5 39 171.0 40 185.0 41 222.0 42 253.0 43 268.5 44 262.0 45 263.5 46 268.5 47 247.5 48 222.5 49 183.5 50 162.0 51 140.5 52 104.5 53 87.5 54 71.0 55 48.0 56 38.5 57 30.5 58 17.0 59 12.5 60 12.5 61 6.0 62 3.5 63 4.5 64 4.0 65 5.0 66 3.5 67 2.0 68 2.0 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 4.45 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.775 0.0 0.0 0.0 0.0 112-113 3.2750000000000004 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 3.9749999999999996 0.0 0.0 0.0 0.0 118-119 4.475 0.0 0.0 0.0 0.0 120-121 4.85 0.0 0.0 0.0 0.0 122-123 5.3625 0.0 0.0 0.0 0.0 124-125 6.025 0.0 0.0 0.0 0.0 126-127 6.487500000000001 0.0 0.0 0.0 0.0 128-129 7.175 0.0 0.0 0.0 0.0 130-131 7.987500000000001 0.0 0.0 0.0 0.0 132-133 8.912500000000001 0.0 0.0 0.0 0.0 134-135 9.4375 0.0 0.0 0.0 0.0 136-137 10.2375 0.0 0.0 0.0 0.0 138 10.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237595 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237595_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.64275 33.0 32.0 34.0 27.0 34.0 2 32.5475 33.0 33.0 34.0 31.0 34.0 3 32.68575 33.0 33.0 34.0 32.0 34.0 4 32.67075 33.0 33.0 34.0 32.0 34.0 5 32.815 33.0 33.0 34.0 32.0 34.0 6 34.126 38.0 35.0 38.0 16.0 38.0 7 36.34225 38.0 37.0 38.0 31.0 38.0 8 36.72425 38.0 38.0 38.0 35.0 38.0 9 36.57375 38.0 38.0 38.0 34.0 38.0 10-14 36.923 38.0 38.0 38.0 35.8 38.0 15-19 37.0273 38.0 38.0 38.0 36.2 38.0 20-24 36.957350000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.9179 38.0 38.0 38.0 36.0 38.0 30-34 36.89205 38.0 38.0 38.0 36.0 38.0 35-39 36.89790000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.8996 38.0 38.0 38.0 36.0 38.0 45-49 36.87105 38.0 38.0 38.0 36.0 38.0 50-54 36.85815 38.0 38.0 38.0 36.0 38.0 55-59 36.8446 38.0 38.0 38.0 36.0 38.0 60-64 36.274150000000006 38.0 37.4 38.0 32.4 38.0 65-69 36.738099999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.7151 38.0 38.0 38.0 35.0 38.0 75-79 36.6943 38.0 38.0 38.0 35.0 38.0 80-84 35.96 38.0 37.4 38.0 31.4 38.0 85-89 36.4547 38.0 38.0 38.0 34.6 38.0 90-94 36.3412 38.0 37.8 38.0 33.8 38.0 95-99 36.226749999999996 38.0 38.0 38.0 33.6 38.0 100-104 36.373000000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.27675 38.0 38.0 38.0 34.0 38.0 110-114 36.098749999999995 38.0 37.8 38.0 33.4 38.0 115-119 35.855000000000004 38.0 37.6 38.0 32.6 38.0 120-124 34.19775 37.8 33.2 38.0 26.0 38.0 125-129 35.6361 38.0 37.0 38.0 31.2 38.0 130-134 35.5425 38.0 37.0 38.0 31.0 38.0 135-139 35.3725 38.0 36.4 38.0 31.0 38.0 140-144 35.196549999999995 38.0 36.0 38.0 31.0 38.0 145-149 34.4895 38.0 36.0 38.0 28.0 38.0 150 28.00125 33.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 2.0 13 2.0 14 3.0 15 5.0 16 3.0 17 1.0 18 5.0 19 9.0 20 5.0 21 5.0 22 7.0 23 9.0 24 23.0 25 21.0 26 14.0 27 29.0 28 39.0 29 42.0 30 56.0 31 42.0 32 75.0 33 120.0 34 124.0 35 220.0 36 519.0 37 2607.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.3 19.475 14.524999999999999 27.700000000000003 2 28.575 23.875 32.95 14.6 3 20.974999999999998 28.15 32.1 18.775 4 25.074999999999996 34.0 22.6 18.325 5 26.025 35.175 22.725 16.075 6 19.6 38.9 25.4 16.1 7 20.925 19.6 41.525 17.95 8 22.2 24.6 28.825 24.375 9 22.175 25.474999999999998 29.875 22.475 10-14 23.625 28.645 26.805 20.925 15-19 23.39 28.27 28.084999999999997 20.255000000000003 20-24 23.345 28.560000000000002 27.555000000000003 20.54 25-29 23.645 28.15 28.17 20.035 30-34 23.630000000000003 27.97 28.53 19.869999999999997 35-39 22.745 28.360000000000003 27.994999999999997 20.9 40-44 24.08 28.09 27.67 20.16 45-49 23.695 28.08 27.839999999999996 20.385 50-54 23.485 27.560000000000002 28.689999999999998 20.265 55-59 23.0 27.534999999999997 28.98 20.485 60-64 23.515 27.155 28.785 20.544999999999998 65-69 23.565 27.810000000000002 28.43 20.195 70-74 23.73 27.61 28.199999999999996 20.46 75-79 23.380000000000003 28.015 28.735 19.869999999999997 80-84 23.895 27.595 28.42 20.09 85-89 23.535 27.800000000000004 28.63 20.035 90-94 24.015 27.735 28.595 19.655 95-99 23.125 28.105000000000004 28.64 20.13 100-104 24.42 27.965 28.000000000000004 19.615 105-109 23.64 28.375 28.32 19.665 110-114 24.375 27.355 28.51 19.759999999999998 115-119 24.425 27.605 28.175 19.794999999999998 120-124 24.455 28.189999999999998 27.93 19.425 125-129 24.305 28.299999999999997 27.565 19.830000000000002 130-134 25.525 27.845 27.689999999999998 18.94 135-139 25.095 28.595 27.42 18.89 140-144 25.965 27.83 26.889999999999997 19.314999999999998 145-149 26.424999999999997 28.060000000000002 26.900000000000002 18.615000000000002 150 25.525 27.0 27.800000000000004 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 1.5 24 3.0 25 3.0 26 2.5 27 4.0 28 8.5 29 10.5 30 17.0 31 24.0 32 25.0 33 37.0 34 51.0 35 64.5 36 88.5 37 102.0 38 125.5 39 177.5 40 222.0 41 244.0 42 261.5 43 293.0 44 297.5 45 276.5 46 266.5 47 257.5 48 226.5 49 184.5 50 162.0 51 135.0 52 104.5 53 82.0 54 59.0 55 53.0 56 43.0 57 21.5 58 12.0 59 8.5 60 10.0 61 9.5 62 4.0 63 3.0 64 4.0 65 3.5 66 3.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.325 0.0 0.0 0.0 0.0 114-115 3.7125 0.0 0.0 0.0 0.0 116-117 4.137499999999999 0.0 0.0 0.0 0.0 118-119 4.6625 0.0 0.0 0.0 0.0 120-121 5.05 0.0 0.0 0.0 0.0 122-123 5.5125 0.0 0.0 0.0 0.0 124-125 6.15 0.0 0.0 0.0 0.0 126-127 6.612500000000001 0.0 0.0 0.0 0.0 128-129 7.3 0.0 0.0 0.0 0.0 130-131 8.125 0.0 0.0 0.0 0.0 132-133 9.0625 0.0 0.0 0.0 0.0 134-135 9.5625 0.0 0.0 0.0 0.0 136-137 10.2875 0.0 0.0 0.0 0.0 138 10.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTGGA 10 0.006973645 144.0 5 AATTATA 10 0.006973645 144.0 7 ATAGTGG 10 0.006973645 144.0 4 >>END_MODULE Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856249 spots for SRR4237595.sra Written 2856249 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra Read 2856233 spots for SRR4237595.sra Written 2856233 spots for SRR4237595.sra SRR ids: ['SRR4237595.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hsce44xf SRR4237595.sra spots: 57124676 blocks: [[1, 2856233], [2856234, 5712466], [5712467, 8568699], [8568700, 11424932], [11424933, 14281165], [14281166, 17137398], [17137399, 19993631], [19993632, 22849864], [22849865, 25706097], [25706098, 28562330], [28562331, 31418563], [31418564, 34274796], [34274797, 37131029], [37131030, 39987262], [39987263, 42843495], [42843496, 45699728], [45699729, 48555961], [48555962, 51412194], [51412195, 54268427], [54268428, 57124676]] SRR4237595 file size 19224406 SRR4237595 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237595 SRR4237595_1.fastq SRR4237595_2.fastq Input file: SRR4237595_1.fastq Paired file: SRR4237595_2.fastq trimmed: SRR4237595-trimmed-pair1.fastq, SRR4237595-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:55:53 2025 >> started Wed Feb 12 14:57:02 2025 >> done (69.526s) 57124676 read pairs processed; of these: 72218 ( 0.13%) short read pairs filtered out after trimming by size control 38412 ( 0.07%) empty read pairs filtered out after trimming by size control 57014046 (99.81%) read pairs available; of these: 22685496 (39.79%) trimmed read pairs available after processing 34328550 (60.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 9 0.00% 20 10 0.00% 21 5 0.00% 22 10 0.00% 23 10 0.00% 24 12 0.00% 25 9 0.00% 26 17 0.00% 27 14 0.00% 28 12 0.00% 29 14 0.00% 30 15 0.00% 31 25 0.00% 32 37 0.00% 33 30 0.00% 34 52 0.00% 35 42 0.00% 36 34 0.00% 37 54 0.00% 38 55 0.00% 39 63 0.00% 40 85 0.00% 41 91 0.00% 42 104 0.00% 43 133 0.00% 44 131 0.00% 45 163 0.00% 46 181 0.00% 47 204 0.00% 48 245 0.00% 49 276 0.00% 50 291 0.00% 51 365 0.00% 52 393 0.00% 53 440 0.00% 54 509 0.00% 55 566 0.00% 56 663 0.00% 57 816 0.00% 58 878 0.00% 59 1015 0.00% 60 1124 0.00% 61 1303 0.00% 62 1472 0.00% 63 1738 0.00% 64 1923 0.00% 65 2235 0.00% 66 2514 0.00% 67 2987 0.01% 68 3726 0.01% 69 5653 0.01% 70 4950 0.01% 71 4689 0.01% 72 5234 0.01% 73 6106 0.01% 74 6804 0.01% 75 7444 0.01% 76 8400 0.01% 77 9190 0.02% 78 10469 0.02% 79 11627 0.02% 80 13058 0.02% 81 14949 0.03% 82 17161 0.03% 83 20498 0.04% 84 40384 0.07% 85 26516 0.05% 86 30828 0.05% 87 32622 0.06% 88 34358 0.06% 89 36425 0.06% 90 42958 0.08% 91 48853 0.09% 92 47275 0.08% 93 54291 0.10% 94 55748 0.10% 95 60511 0.11% 96 65335 0.11% 97 68775 0.12% 98 72905 0.13% 99 78700 0.14% 100 81947 0.14% 101 85108 0.15% 102 90709 0.16% 103 97177 0.17% 104 102886 0.18% 105 108705 0.19% 106 115627 0.20% 107 121067 0.21% 108 125534 0.22% 109 130688 0.23% 110 132982 0.23% 111 138549 0.24% 112 144520 0.25% 113 149017 0.26% 114 155903 0.27% 115 162664 0.29% 116 169260 0.30% 117 173922 0.31% 118 180207 0.32% 119 185542 0.33% 120 186962 0.33% 121 193579 0.34% 122 197614 0.35% 123 201540 0.35% 124 208098 0.36% 125 213279 0.37% 126 220620 0.39% 127 228109 0.40% 128 232329 0.41% 129 238560 0.42% 130 244294 0.43% 131 248598 0.44% 132 254383 0.45% 133 260584 0.46% 134 266889 0.47% 135 276580 0.49% 136 287249 0.50% 137 295741 0.52% 138 309103 0.54% 139 323008 0.57% 140 337393 0.59% 141 353946 0.62% 142 379663 0.67% 143 410337 0.72% 144 458677 0.80% 145 530490 0.93% 146 650834 1.14% 147 878088 1.54% 148 1542415 2.71% 149 8634691 15.14% 150 34328550 60.21% 57014046 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=8.89 fanout-score-rank=19 prefix-density=0.30 prefix-fanout=5.2 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=291.41 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=30.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.4 sequence=TCTAGCTAGTGGTTTAATAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=392.24 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=20.3 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTC SRR4237595 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:58:48 Started mapping on | Feb 12 14:58:51 Finished on | Feb 12 15:02:47 Mapping speed, Million of reads per hour | 869.71 Number of input reads | 57014046 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 48464549 Uniquely mapped reads % | 85.00% Average mapped length | 287.70 Number of splices: Total | 43067498 Number of splices: Annotated (sjdb) | 42284590 Number of splices: GT/AG | 42369665 Number of splices: GC/AG | 533120 Number of splices: AT/AC | 39544 Number of splices: Non-canonical | 125169 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 997859 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 109651 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.01% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7606110 7606110 7606110 N_multimapping 997859 997859 997859 N_noFeature 1479739 47868513 1814177 N_ambiguous 634269 8265 365715 UnstrandedReadsAssigned:46350541 PositiveStrandReadsAssigned:587771 NegativeStrandReadsAssigned:46284657 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=147 echo kmer=143 SRR4237595 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237595-trimmed-pair1.fastq SRR4237595-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,014,046 reads, 52,473,390 reads pseudoaligned [quant] estimated average fragment length: 209.64 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,278 rounds 52401 SRR4237595.ke.tsv 34699 SRR4237595.se.tsv 87100 total ==> SRR4237595.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1809.36 1231 14.0085 Potri.005G024800.1.v4.1 1035 826.36 150 3.73749 Potri.004G059700.1.v4.1 961 752.366 74 2.02517 Potri.007G009000.2.v4.1 1416 1207.36 0 0 Potri.003G141000.2.v4.1 2943 2734.36 833.294 6.27481 Potri.016G087400.1.v4.1 270 95.8987 5464.52 1173.27 Potri.015G069301.1.v4.1 564 357.732 0 0 Potri.010G195200.1.v4.1 1773 1564.36 143 1.88216 Potri.012G127500.1.v4.1 977 768.36 33953 909.854 ==> SRR4237595.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5868 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 913 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR4237595 completed mapping pipeline successfully