Starting /dee2/code/volunteer_pipeline.sh SRR4237596 current disk space = 3051647610880 free memory = 1578786332 SRR4237596 SRAfilesize 2af714ffb0703cb6775f462955b0d81e SRR4237596.sra SRR4237596.sra file validated SRR4237596 is paired end SRR4237596 is conventional basespace SRR4237596 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237596_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23225 34.0 33.0 34.0 32.0 34.0 2 33.23075 34.0 33.0 34.0 32.0 34.0 3 33.31775 34.0 33.0 34.0 33.0 34.0 4 33.2595 34.0 33.0 34.0 33.0 34.0 5 33.30425 34.0 33.0 34.0 33.0 34.0 6 36.04175 38.0 37.0 38.0 34.0 38.0 7 37.02025 38.0 38.0 38.0 35.0 38.0 8 37.19625 38.0 38.0 38.0 36.0 38.0 9 37.388 38.0 38.0 38.0 37.0 38.0 10-14 37.38055 38.0 38.0 38.0 37.0 38.0 15-19 37.3991 38.0 38.0 38.0 37.0 38.0 20-24 37.4071 38.0 38.0 38.0 37.4 38.0 25-29 37.295100000000005 38.0 38.0 38.0 37.2 38.0 30-34 37.36195 38.0 38.0 38.0 37.0 38.0 35-39 37.32775 38.0 38.0 38.0 37.0 38.0 40-44 37.27395 38.0 38.0 38.0 37.0 38.0 45-49 37.18939999999999 38.0 38.0 38.0 36.6 38.0 50-54 36.36395 38.0 37.2 38.0 31.6 38.0 55-59 37.132400000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.972350000000006 38.0 38.0 38.0 35.8 38.0 65-69 36.843149999999994 38.0 38.0 38.0 35.6 38.0 70-74 36.941050000000004 38.0 38.0 38.0 35.6 38.0 75-79 37.02505 38.0 38.0 38.0 36.0 38.0 80-84 36.851099999999995 38.0 38.0 38.0 35.4 38.0 85-89 36.840050000000005 38.0 38.0 38.0 35.6 38.0 90-94 36.84325 38.0 38.0 38.0 35.6 38.0 95-99 36.72945 38.0 38.0 38.0 34.8 38.0 100-104 36.766 38.0 38.0 38.0 35.0 38.0 105-109 35.917449999999995 38.0 37.0 38.0 29.6 38.0 110-114 36.2751 38.0 37.6 38.0 33.6 38.0 115-119 36.257200000000005 38.0 38.0 38.0 33.8 38.0 120-124 36.21165 38.0 38.0 38.0 33.8 38.0 125-129 36.2426 38.0 38.0 38.0 33.8 38.0 130-134 35.97955 38.0 37.6 38.0 33.0 38.0 135-139 35.869749999999996 38.0 37.4 38.0 32.6 38.0 140-144 35.7757 38.0 37.0 38.0 33.0 38.0 145-149 35.42035 38.0 36.0 38.0 32.6 38.0 150 30.56 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 1.0 17 2.0 18 2.0 19 1.0 20 2.0 21 4.0 22 8.0 23 2.0 24 6.0 25 10.0 26 12.0 27 16.0 28 39.0 29 38.0 30 34.0 31 56.0 32 55.0 33 88.0 34 116.0 35 195.0 36 471.0 37 2836.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.482724086129195 11.266900350525788 10.165247871807711 40.0851276915373 2 22.45 15.625 35.775 26.150000000000002 3 19.8 20.849999999999998 26.575 32.775 4 23.7 27.925 22.525000000000002 25.85 5 23.175 34.8 23.125 18.9 6 17.868098159509202 37.26993865030675 23.849693251533743 21.012269938650306 7 14.075 25.900000000000002 42.525 17.5 8 16.900000000000002 26.674999999999997 30.65 25.775 9 17.125 24.375 35.35 23.150000000000002 10-14 20.075000000000003 30.28 26.51 23.135 15-19 19.71 29.270000000000003 27.51 23.51 20-24 19.97 29.494999999999997 26.875 23.66 25-29 19.59 29.854999999999997 27.33 23.225 30-34 19.415 29.315 27.66 23.61 35-39 19.79 29.220000000000002 27.52 23.47 40-44 19.755 29.759999999999998 26.805 23.68 45-49 19.830000000000002 28.78 27.58 23.810000000000002 50-54 19.975 29.12 27.425 23.48 55-59 20.335 29.115000000000002 26.99 23.56 60-64 19.43 29.085 27.779999999999998 23.705000000000002 65-69 19.675 29.12 27.555000000000003 23.65 70-74 19.97 28.92 27.105 24.005000000000003 75-79 19.825 29.205 27.265 23.705000000000002 80-84 20.435 28.53 27.315 23.72 85-89 20.31 28.53 26.900000000000002 24.26 90-94 19.895 28.915000000000003 27.18 24.01 95-99 20.645 28.345 27.584999999999997 23.425 100-104 20.19 28.88 27.310000000000002 23.62 105-109 20.335 28.689999999999998 27.36 23.615 110-114 20.150000000000002 28.67 27.92 23.26 115-119 21.0 28.505000000000003 26.865 23.630000000000003 120-124 20.674999999999997 28.43 27.24 23.655 125-129 20.84 28.865000000000002 26.919999999999998 23.375 130-134 20.82 28.07 27.134999999999998 23.974999999999998 135-139 20.335 28.294999999999998 27.26 24.11 140-144 20.445 28.444999999999997 27.26 23.849999999999998 145-149 20.625 28.955 26.919999999999998 23.5 150 21.05 29.225 25.025 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 1.0 25 3.0 26 5.0 27 7.0 28 10.5 29 18.5 30 22.5 31 29.5 32 39.0 33 44.5 34 53.0 35 73.0 36 93.5 37 119.0 38 141.5 39 160.0 40 193.0 41 215.0 42 228.0 43 256.0 44 272.0 45 266.5 46 260.0 47 261.0 48 242.0 49 193.5 50 167.0 51 149.5 52 122.0 53 90.5 54 68.5 55 50.0 56 35.5 57 31.5 58 22.5 59 15.0 60 11.0 61 7.5 62 4.5 63 2.5 64 2.0 65 1.0 66 1.5 67 2.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 2.1999999999999997 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.5125000000000002 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.1624999999999996 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.6375 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.5 0.0 0.0 0.0 0.0 134-135 4.925000000000001 0.0 0.0 0.0 0.0 136-137 5.2375 0.0 0.0 0.0 0.0 138 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237596 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237596_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7 33.0 33.0 34.0 32.0 34.0 2 32.77525 33.0 33.0 34.0 32.0 34.0 3 32.00825 33.0 33.0 34.0 28.0 34.0 4 32.6615 33.0 33.0 34.0 32.0 34.0 5 32.82775 34.0 33.0 34.0 32.0 34.0 6 36.96925 38.0 38.0 38.0 36.0 38.0 7 36.8655 38.0 38.0 38.0 36.0 38.0 8 37.09125 38.0 38.0 38.0 37.0 38.0 9 36.94675 38.0 38.0 38.0 36.0 38.0 10-14 36.98135 38.0 38.0 38.0 36.4 38.0 15-19 37.0338 38.0 38.0 38.0 37.0 38.0 20-24 36.676249999999996 38.0 38.0 38.0 35.2 38.0 25-29 36.6457 38.0 38.0 38.0 34.6 38.0 30-34 37.02139999999999 38.0 38.0 38.0 36.6 38.0 35-39 37.088350000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.015249999999995 38.0 38.0 38.0 36.8 38.0 45-49 36.79045 38.0 38.0 38.0 35.6 38.0 50-54 35.982150000000004 38.0 36.4 38.0 30.8 38.0 55-59 36.78105 38.0 38.0 38.0 35.4 38.0 60-64 36.8772 38.0 38.0 38.0 36.0 38.0 65-69 36.5968 38.0 38.0 38.0 34.8 38.0 70-74 36.268449999999994 38.0 37.2 38.0 32.0 38.0 75-79 36.5364 38.0 37.8 38.0 34.0 38.0 80-84 36.79455 38.0 38.0 38.0 36.0 38.0 85-89 36.64765 38.0 38.0 38.0 35.6 38.0 90-94 36.6683 38.0 38.0 38.0 35.8 38.0 95-99 36.60485 38.0 38.0 38.0 35.0 38.0 100-104 36.51865 38.0 38.0 38.0 35.0 38.0 105-109 36.426 38.0 38.0 38.0 34.6 38.0 110-114 36.3324 38.0 38.0 38.0 34.2 38.0 115-119 35.051 38.0 35.8 38.0 28.0 38.0 120-124 35.3498 38.0 36.6 38.0 28.8 38.0 125-129 35.89190000000001 38.0 38.0 38.0 33.4 38.0 130-134 35.7137 38.0 38.0 38.0 32.6 38.0 135-139 35.22285 38.0 36.8 38.0 29.8 38.0 140-144 35.224849999999996 38.0 36.4 38.0 31.0 38.0 145-149 34.796899999999994 38.0 36.2 38.0 30.6 38.0 150 29.85325 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 4.0 5 1.0 6 2.0 7 2.0 8 0.0 9 1.0 10 1.0 11 3.0 12 1.0 13 2.0 14 4.0 15 4.0 16 6.0 17 2.0 18 5.0 19 4.0 20 7.0 21 5.0 22 11.0 23 8.0 24 9.0 25 17.0 26 20.0 27 21.0 28 30.0 29 40.0 30 34.0 31 52.0 32 60.0 33 76.0 34 121.0 35 190.0 36 484.0 37 2764.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.65 20.0 13.125 29.225 2 27.175 24.925 32.4 15.5 3 21.0 26.650000000000002 32.225 20.125 4 23.599999999999998 34.325 23.7 18.375 5 26.674999999999997 36.175000000000004 22.8 14.35 6 19.525000000000002 38.95 24.025 17.5 7 19.05 20.45 41.3 19.2 8 20.375 23.9 29.349999999999998 26.375 9 22.075 24.775 30.0 23.150000000000002 10-14 23.635 28.985 26.56 20.82 15-19 23.13 27.900000000000002 28.410000000000004 20.560000000000002 20-24 23.285 27.925 28.225 20.565 25-29 23.29 28.215 28.185 20.31 30-34 23.105 27.779999999999998 28.34 20.775 35-39 23.96 27.384999999999998 27.96 20.695 40-44 24.05 27.889999999999997 27.55 20.51 45-49 22.945 28.035 27.79 21.23 50-54 22.99 28.54 28.08 20.39 55-59 24.11 27.61 28.04 20.24 60-64 23.845 27.395000000000003 28.16 20.599999999999998 65-69 23.345 27.615000000000002 28.32 20.72 70-74 23.849999999999998 27.26 28.46 20.43 75-79 23.325000000000003 26.779999999999998 29.134999999999998 20.76 80-84 23.765 27.685 28.194999999999997 20.355 85-89 23.555 27.834999999999997 28.044999999999998 20.565 90-94 23.44 28.084999999999997 28.22 20.255000000000003 95-99 23.47 27.915 27.805000000000003 20.810000000000002 100-104 23.785 27.735 28.005000000000003 20.474999999999998 105-109 24.13 27.450000000000003 28.235 20.185 110-114 23.635 28.27 27.805000000000003 20.29 115-119 24.185000000000002 27.485 28.515 19.814999999999998 120-124 24.435000000000002 27.189999999999998 27.860000000000003 20.515 125-129 23.91 27.67 27.694999999999997 20.724999999999998 130-134 24.735 27.994999999999997 27.644999999999996 19.625 135-139 24.515 27.355 28.360000000000003 19.77 140-144 24.345 27.935 27.944999999999997 19.775000000000002 145-149 24.775 27.894999999999996 27.439999999999998 19.89 150 25.174999999999997 27.500000000000004 27.474999999999998 19.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 1.0 24 1.0 25 1.5 26 2.0 27 5.0 28 7.0 29 11.0 30 14.5 31 14.0 32 20.0 33 34.0 34 44.5 35 59.0 36 86.0 37 115.5 38 132.5 39 152.0 40 191.0 41 227.0 42 258.0 43 294.0 44 296.5 45 276.5 46 274.0 47 277.0 48 239.0 49 196.5 50 177.5 51 133.5 52 104.5 53 96.0 54 66.0 55 40.5 56 41.0 57 33.0 58 19.0 59 15.0 60 11.5 61 6.0 62 4.0 63 5.0 64 4.5 65 3.0 66 1.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.4124999999999996 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 3.9625 0.0 0.0 0.0 0.0 132-133 4.275 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 4.9875 0.0 0.0 0.0 0.0 138 5.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAAAT 10 0.006973645 144.0 7 >>END_MODULE Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743486 spots for SRR4237596.sra Written 2743486 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra Read 2743469 spots for SRR4237596.sra Written 2743469 spots for SRR4237596.sra SRR ids: ['SRR4237596.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_924qf8il SRR4237596.sra spots: 54869397 blocks: [[1, 2743469], [2743470, 5486938], [5486939, 8230407], [8230408, 10973876], [10973877, 13717345], [13717346, 16460814], [16460815, 19204283], [19204284, 21947752], [21947753, 24691221], [24691222, 27434690], [27434691, 30178159], [30178160, 32921628], [32921629, 35665097], [35665098, 38408566], [38408567, 41152035], [41152036, 43895504], [43895505, 46638973], [46638974, 49382442], [49382443, 52125911], [52125912, 54869397]] SRR4237596 file size 18464571 SRR4237596 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237596 SRR4237596_1.fastq SRR4237596_2.fastq Input file: SRR4237596_1.fastq Paired file: SRR4237596_2.fastq trimmed: SRR4237596-trimmed-pair1.fastq, SRR4237596-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:37:09 2025 >> started Wed Feb 12 14:38:09 2025 >> done (60.256s) 54869397 read pairs processed; of these: 65188 ( 0.12%) short read pairs filtered out after trimming by size control 36882 ( 0.07%) empty read pairs filtered out after trimming by size control 54767327 (99.81%) read pairs available; of these: 18119641 (33.08%) trimmed read pairs available after processing 36647686 (66.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 7 0.00% 21 8 0.00% 22 2 0.00% 23 10 0.00% 24 11 0.00% 25 10 0.00% 26 13 0.00% 27 22 0.00% 28 11 0.00% 29 18 0.00% 30 17 0.00% 31 16 0.00% 32 24 0.00% 33 31 0.00% 34 28 0.00% 35 24 0.00% 36 35 0.00% 37 32 0.00% 38 37 0.00% 39 54 0.00% 40 61 0.00% 41 68 0.00% 42 57 0.00% 43 80 0.00% 44 74 0.00% 45 104 0.00% 46 96 0.00% 47 105 0.00% 48 136 0.00% 49 127 0.00% 50 148 0.00% 51 199 0.00% 52 217 0.00% 53 204 0.00% 54 276 0.00% 55 270 0.00% 56 324 0.00% 57 353 0.00% 58 416 0.00% 59 494 0.00% 60 508 0.00% 61 648 0.00% 62 676 0.00% 63 740 0.00% 64 844 0.00% 65 935 0.00% 66 1093 0.00% 67 1314 0.00% 68 1906 0.00% 69 3384 0.01% 70 3310 0.01% 71 2179 0.00% 72 2319 0.00% 73 2599 0.00% 74 2881 0.01% 75 3333 0.01% 76 3620 0.01% 77 4001 0.01% 78 4452 0.01% 79 5083 0.01% 80 5752 0.01% 81 6544 0.01% 82 7549 0.01% 83 9981 0.02% 84 32103 0.06% 85 14770 0.03% 86 14593 0.03% 87 16252 0.03% 88 17232 0.03% 89 19017 0.03% 90 20555 0.04% 91 24768 0.05% 92 26133 0.05% 93 25310 0.05% 94 29279 0.05% 95 29995 0.05% 96 32826 0.06% 97 34743 0.06% 98 36169 0.07% 99 37595 0.07% 100 40902 0.07% 101 43261 0.08% 102 45934 0.08% 103 49080 0.09% 104 51222 0.09% 105 55677 0.10% 106 58969 0.11% 107 62332 0.11% 108 65890 0.12% 109 69139 0.13% 110 71428 0.13% 111 74199 0.14% 112 78706 0.14% 113 82261 0.15% 114 86292 0.16% 115 91726 0.17% 116 94910 0.17% 117 98202 0.18% 118 101468 0.19% 119 105334 0.19% 120 107083 0.20% 121 111597 0.20% 122 116193 0.21% 123 120090 0.22% 124 124096 0.23% 125 129573 0.24% 126 132819 0.24% 127 138496 0.25% 128 142851 0.26% 129 147929 0.27% 130 153427 0.28% 131 158847 0.29% 132 163469 0.30% 133 169374 0.31% 134 175410 0.32% 135 183004 0.33% 136 193022 0.35% 137 202450 0.37% 138 212885 0.39% 139 225184 0.41% 140 238965 0.44% 141 257421 0.47% 142 279260 0.51% 143 309508 0.57% 144 354346 0.65% 145 420468 0.77% 146 529687 0.97% 147 747833 1.37% 148 1348448 2.46% 149 8607748 15.72% 150 36647686 66.92% 54767327 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=2.6 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=181.43 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=16.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=44 prefix-density=0.17 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=8 fanout-score=43.42 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=12.0 sequence=TGTTGGTGGTGG SRR4237596 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:38:54 Started mapping on | Feb 12 14:38:54 Finished on | Feb 12 14:44:19 Mapping speed, Million of reads per hour | 606.65 Number of input reads | 54767327 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 52246563 Uniquely mapped reads % | 95.40% Average mapped length | 293.14 Number of splices: Total | 45575811 Number of splices: Annotated (sjdb) | 44802128 Number of splices: GT/AG | 44911966 Number of splices: GC/AG | 518410 Number of splices: AT/AC | 41358 Number of splices: Non-canonical | 104077 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1072824 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 72570 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1497500 1497500 1497500 N_multimapping 1072824 1072824 1072824 N_noFeature 1446960 51620472 1732614 N_ambiguous 563782 2802 221274 UnstrandedReadsAssigned:50235821 PositiveStrandReadsAssigned:623289 NegativeStrandReadsAssigned:50292675 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237596 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237596-trimmed-pair1.fastq SRR4237596-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 54,767,327 reads, 50,003,159 reads pseudoaligned [quant] estimated average fragment length: 235.013 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR4237596.ke.tsv 34699 SRR4237596.se.tsv 87100 total ==> SRR4237596.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.99 1133 13.6036 Potri.005G024800.1.v4.1 1035 800.987 92 2.46024 Potri.004G059700.1.v4.1 961 727.003 27 0.795505 Potri.007G009000.2.v4.1 1416 1181.99 0 0 Potri.003G141000.2.v4.1 2943 2708.99 816.139 6.45316 Potri.016G087400.1.v4.1 270 81.1039 5442.28 1437.32 Potri.015G069301.1.v4.1 564 333.425 0 0 Potri.010G195200.1.v4.1 1773 1538.99 215 2.99239 Potri.012G127500.1.v4.1 977 743.003 7396 213.217 ==> SRR4237596.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8733 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 739 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 57 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR4237596 completed mapping pipeline successfully