Starting /dee2/code/volunteer_pipeline.sh SRR4237597 current disk space = 3051358765056 free memory = 1500799084 SRR4237597 SRAfilesize 01ea597d386b2129423cf821afa67308 SRR4237597.sra SRR4237597.sra file validated SRR4237597 is paired end SRR4237597 is conventional basespace SRR4237597 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237597_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2545 34.0 33.0 34.0 33.0 34.0 2 33.304 34.0 33.0 34.0 33.0 34.0 3 33.3955 34.0 33.0 34.0 33.0 34.0 4 33.3695 34.0 33.0 34.0 33.0 34.0 5 33.26275 34.0 33.0 34.0 33.0 34.0 6 36.8075 38.0 37.0 38.0 35.0 38.0 7 36.55725 38.0 38.0 38.0 36.0 38.0 8 37.16125 38.0 38.0 38.0 36.0 38.0 9 37.3005 38.0 38.0 38.0 37.0 38.0 10-14 37.40885 38.0 38.0 38.0 37.0 38.0 15-19 37.449200000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.423 38.0 38.0 38.0 37.0 38.0 25-29 37.385299999999994 38.0 38.0 38.0 37.2 38.0 30-34 37.34060000000001 38.0 38.0 38.0 37.0 38.0 35-39 36.9516 38.0 37.8 38.0 35.2 38.0 40-44 37.23945 38.0 38.0 38.0 36.6 38.0 45-49 37.22475 38.0 38.0 38.0 37.0 38.0 50-54 37.10945 38.0 38.0 38.0 36.0 38.0 55-59 37.055699999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.03435 38.0 38.0 38.0 36.0 38.0 65-69 36.0632 38.0 36.0 38.0 32.0 38.0 70-74 36.465050000000005 38.0 37.4 38.0 33.6 38.0 75-79 36.9461 38.0 38.0 38.0 35.8 38.0 80-84 36.81595 38.0 38.0 38.0 35.0 38.0 85-89 36.0585 38.0 37.0 38.0 31.4 38.0 90-94 36.433550000000004 38.0 37.4 38.0 33.4 38.0 95-99 36.589549999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.6669 38.0 38.0 38.0 34.6 38.0 105-109 36.13675 38.0 37.4 38.0 32.4 38.0 110-114 36.41495 38.0 38.0 38.0 34.0 38.0 115-119 35.79945 38.0 37.0 38.0 30.8 38.0 120-124 36.1768 38.0 37.8 38.0 33.8 38.0 125-129 36.138999999999996 38.0 38.0 38.0 33.6 38.0 130-134 35.904700000000005 38.0 37.2 38.0 32.6 38.0 135-139 35.66205 38.0 36.2 38.0 31.8 38.0 140-144 35.57395 38.0 36.4 38.0 32.4 38.0 145-149 35.07905 38.0 36.0 38.0 31.0 38.0 150 29.2225 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 1.0 19 1.0 20 4.0 21 4.0 22 3.0 23 5.0 24 17.0 25 7.0 26 16.0 27 23.0 28 22.0 29 37.0 30 47.0 31 62.0 32 66.0 33 79.0 34 124.0 35 259.0 36 544.0 37 2672.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.475 12.174999999999999 8.1 42.25 2 21.280320080020005 16.054013503375845 36.55913978494624 26.106526631657918 3 19.475 20.025000000000002 26.1 34.4 4 23.875 28.799999999999997 21.7 25.624999999999996 5 22.7 34.725 22.95 19.625 6 17.849999999999998 35.8 25.900000000000002 20.45 7 13.815957175630894 25.89854703033393 42.79887840938058 17.4866173846546 8 17.349999999999998 24.099999999999998 32.525 26.025 9 17.2 23.7 34.725 24.375 10-14 19.735 30.020000000000003 26.715 23.53 15-19 20.02 28.575 27.775 23.630000000000003 20-24 19.955000000000002 29.205 26.845000000000002 23.995 25-29 19.495 29.409999999999997 27.794999999999998 23.3 30-34 19.655 28.945 27.595 23.805 35-39 20.14 28.92 27.49 23.45 40-44 20.275000000000002 28.725 27.134999999999998 23.865 45-49 19.925 29.4 27.58 23.095 50-54 19.869999999999997 29.134999999999998 27.52 23.474999999999998 55-59 19.613922784556912 29.58591718343669 27.010402080416085 23.789757951590317 60-64 20.080000000000002 29.515 26.66 23.745 65-69 20.294999999999998 29.21 26.900000000000002 23.595 70-74 20.36 29.080000000000002 26.945000000000004 23.615 75-79 20.635 29.025000000000002 26.945000000000004 23.395 80-84 20.155 28.87 27.310000000000002 23.665 85-89 20.825 28.939999999999998 26.905 23.330000000000002 90-94 20.57 28.76 27.36 23.31 95-99 20.04 28.27 27.925 23.765 100-104 20.169999999999998 29.325000000000003 26.745 23.76 105-109 20.575 28.405 27.115000000000002 23.905 110-114 20.445 28.67 27.029999999999998 23.855 115-119 20.28 28.65 27.075 23.995 120-124 20.635 28.89 26.865 23.61 125-129 20.505000000000003 28.175 27.395000000000003 23.925 130-134 20.452045204520452 28.14281428142814 27.627762776277624 23.77737773777378 135-139 20.885 28.89 26.875 23.35 140-144 21.09054527263632 28.36418209104552 26.943471735867934 23.601800900450225 145-149 20.875 29.125 26.424999999999997 23.575 150 20.575612219136584 28.629134057056298 26.43271901035092 24.3625347134562 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 2.0 24 2.0 25 2.5 26 5.5 27 7.0 28 9.0 29 13.0 30 18.5 31 27.5 32 38.5 33 48.0 34 61.0 35 83.5 36 97.0 37 109.5 38 129.5 39 147.5 40 179.0 41 215.0 42 246.0 43 254.5 44 271.0 45 276.0 46 258.5 47 255.5 48 231.0 49 204.0 50 182.0 51 142.5 52 106.0 53 87.0 54 75.0 55 59.5 56 42.0 57 27.0 58 19.0 59 18.0 60 12.0 61 6.0 62 5.0 63 4.5 64 5.5 65 4.0 66 1.0 67 0.5 68 2.0 69 3.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 1.925 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.02 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.0 140-144 0.05 145-149 0.0 150 0.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.2249999999999996 0.0 0.0 0.0 0.0 120-121 2.5 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.5 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 6.0625 0.0 0.0 0.0 0.0 138 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCGTA 10 0.0064824508 147.51282 1 TCCGTAT 10 0.0064824508 147.51282 2 >>END_MODULE SRR4237597 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237597_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34475 33.0 33.0 34.0 31.0 34.0 2 32.793 33.0 33.0 34.0 32.0 34.0 3 32.86025 34.0 33.0 34.0 32.0 34.0 4 31.11075 33.0 32.0 34.0 25.0 34.0 5 32.302 33.0 33.0 34.0 31.0 34.0 6 36.878 38.0 38.0 38.0 36.0 38.0 7 36.9995 38.0 38.0 38.0 36.0 38.0 8 37.023 38.0 38.0 38.0 36.0 38.0 9 37.06 38.0 38.0 38.0 36.0 38.0 10-14 37.07335 38.0 38.0 38.0 36.8 38.0 15-19 37.0721 38.0 38.0 38.0 36.6 38.0 20-24 37.063900000000004 38.0 38.0 38.0 36.8 38.0 25-29 37.0407 38.0 38.0 38.0 36.8 38.0 30-34 37.0603 38.0 38.0 38.0 36.8 38.0 35-39 37.082100000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.057050000000004 38.0 38.0 38.0 36.6 38.0 45-49 37.04065 38.0 38.0 38.0 37.0 38.0 50-54 36.612700000000004 38.0 38.0 38.0 34.8 38.0 55-59 36.812599999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.919349999999994 38.0 38.0 38.0 36.2 38.0 65-69 36.5653 38.0 37.8 38.0 34.8 38.0 70-74 36.79295 38.0 38.0 38.0 35.8 38.0 75-79 36.77995 38.0 38.0 38.0 36.0 38.0 80-84 36.71025 38.0 38.0 38.0 35.6 38.0 85-89 36.68155 38.0 38.0 38.0 35.6 38.0 90-94 36.6379 38.0 38.0 38.0 35.0 38.0 95-99 36.559450000000005 38.0 38.0 38.0 34.6 38.0 100-104 36.51090000000001 38.0 38.0 38.0 34.4 38.0 105-109 36.50125 38.0 38.0 38.0 35.0 38.0 110-114 36.419349999999994 38.0 38.0 38.0 34.2 38.0 115-119 36.32975 38.0 38.0 38.0 34.0 38.0 120-124 36.1507 38.0 38.0 38.0 34.0 38.0 125-129 35.97 38.0 38.0 38.0 33.6 38.0 130-134 35.84349999999999 38.0 38.0 38.0 33.0 38.0 135-139 35.7726 38.0 38.0 38.0 33.0 38.0 140-144 35.44655 38.0 37.6 38.0 32.0 38.0 145-149 34.9506 38.0 36.4 38.0 31.0 38.0 150 28.90925 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 1.0 5 2.0 6 0.0 7 3.0 8 1.0 9 0.0 10 2.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 2.0 17 6.0 18 5.0 19 3.0 20 8.0 21 7.0 22 4.0 23 6.0 24 10.0 25 20.0 26 22.0 27 27.0 28 22.0 29 39.0 30 39.0 31 42.0 32 62.0 33 79.0 34 117.0 35 165.0 36 373.0 37 2920.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.045397542011536 19.588663155254576 13.744670178078755 29.621269124655132 2 28.375 23.974999999999998 33.074999999999996 14.575 3 21.075 28.125 31.15 19.650000000000002 4 25.35 34.4 23.599999999999998 16.650000000000002 5 25.35 36.675000000000004 21.05 16.925 6 19.575 38.574999999999996 23.95 17.9 7 20.25 20.3 40.2 19.25 8 21.95 24.275 29.4 24.375 9 22.650000000000002 24.85 30.375000000000004 22.125 10-14 23.7 28.835 26.645000000000003 20.82 15-19 23.380000000000003 28.17 28.000000000000004 20.45 20-24 23.155 28.134999999999998 27.834999999999997 20.875 25-29 23.866193309665483 27.92139606980349 27.556377818890944 20.65603280164008 30-34 23.189999999999998 28.249999999999996 27.48 21.08 35-39 23.355838959739934 28.047011752938232 28.077019254813703 20.520130032508128 40-44 23.694477791116448 28.51640656262505 27.345938375350144 20.443177270908365 45-49 23.582358235823584 27.917791779177918 27.747774777477748 20.75207520752075 50-54 23.889639977968052 27.840368534374843 27.945521005457913 20.32447048219919 55-59 24.028021015761823 27.745809357017766 27.645734300725543 20.58043532649487 60-64 24.075649171961775 27.3827988192325 28.37344273777956 20.168109271026164 65-69 23.50175087543772 27.598799399699853 28.029014507253624 20.870435217608804 70-74 23.99439663798279 27.491494896938164 28.231939163498097 20.28216930158095 75-79 23.27409261576971 27.99499374217772 28.120150187734666 20.610763454317897 80-84 23.338168358925625 27.779722903016058 27.744710648727057 21.137398089331267 85-89 23.437890839961977 27.565160838461157 28.5006753714543 20.496272950122567 90-94 23.703036670168594 27.08489669318125 28.900895492520885 20.31117114412927 95-99 23.976988494247124 27.158579289644823 28.724362181090545 20.14007003501751 100-104 23.861930965482742 27.66383191595798 28.59929964982491 19.874937468734366 105-109 23.83930358214929 27.426455873524112 28.38202921753052 20.352211326796077 110-114 23.14624743403595 28.112952485855907 28.338256646472736 20.402543433635408 115-119 24.259407526020816 27.77722177742194 27.797237790232188 20.16613290632506 120-124 24.04005006257822 27.173967459324157 28.235294117647058 20.550688360450565 125-129 24.602062268495345 27.40514566022625 27.550305335869457 20.44248673540895 130-134 24.63862351823138 27.63967388586005 27.879757915270343 19.841944680638225 135-139 24.595987391804673 27.55290939110422 27.72802321508981 20.123080002001302 140-144 25.09134591320887 27.659041994093798 27.77916812653286 19.47044396616447 145-149 25.172759138708063 27.711567351026538 27.491236855282924 19.624436654982475 150 25.651302605210418 28.281563126252507 26.50300601202405 19.564128256513026 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 3.0 26 5.0 27 6.5 28 7.5 29 9.0 30 13.5 31 21.0 32 20.5 33 28.5 34 47.0 35 72.0 36 93.0 37 99.5 38 118.0 39 158.5 40 188.0 41 217.0 42 252.5 43 267.5 44 268.5 45 284.0 46 301.0 47 288.0 48 242.0 49 198.5 50 176.5 51 151.5 52 118.5 53 84.0 54 69.5 55 55.0 56 36.5 57 27.0 58 19.0 59 14.0 60 12.5 61 7.0 62 3.5 63 4.0 64 3.0 65 1.5 66 1.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.025 40-44 0.04 45-49 0.01 50-54 0.145 55-59 0.075 60-64 0.065 65-69 0.05 70-74 0.06 75-79 0.125 80-84 0.034999999999999996 85-89 0.055 90-94 0.055 95-99 0.05 100-104 0.05 105-109 0.06 110-114 0.135 115-119 0.08 120-124 0.125 125-129 0.11 130-134 0.034999999999999996 135-139 0.065 140-144 0.105 145-149 0.15 150 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 3.075 0.0 0.0 0.0 0.0 124-125 3.4124999999999996 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 4.25 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.8375 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138 6.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562034 spots for SRR4237597.sra Written 2562034 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra Read 2562031 spots for SRR4237597.sra Written 2562031 spots for SRR4237597.sra SRR ids: ['SRR4237597.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__acmi5i1 SRR4237597.sra spots: 51240623 blocks: [[1, 2562031], [2562032, 5124062], [5124063, 7686093], [7686094, 10248124], [10248125, 12810155], [12810156, 15372186], [15372187, 17934217], [17934218, 20496248], [20496249, 23058279], [23058280, 25620310], [25620311, 28182341], [28182342, 30744372], [30744373, 33306403], [33306404, 35868434], [35868435, 38430465], [38430466, 40992496], [40992497, 43554527], [43554528, 46116558], [46116559, 48678589], [48678590, 51240623]] SRR4237597 file size 17241986 SRR4237597 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237597 SRR4237597_1.fastq SRR4237597_2.fastq Input file: SRR4237597_1.fastq Paired file: SRR4237597_2.fastq trimmed: SRR4237597-trimmed-pair1.fastq, SRR4237597-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:50:50 2025 >> started Wed Feb 12 13:51:43 2025 >> done (53.052s) 51240623 read pairs processed; of these: 69217 ( 0.14%) short read pairs filtered out after trimming by size control 33795 ( 0.07%) empty read pairs filtered out after trimming by size control 51137611 (99.80%) read pairs available; of these: 17176608 (33.59%) trimmed read pairs available after processing 33961003 (66.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 15 0.00% 20 15 0.00% 21 5 0.00% 22 10 0.00% 23 9 0.00% 24 11 0.00% 25 6 0.00% 26 14 0.00% 27 19 0.00% 28 22 0.00% 29 20 0.00% 30 21 0.00% 31 21 0.00% 32 18 0.00% 33 35 0.00% 34 33 0.00% 35 30 0.00% 36 36 0.00% 37 47 0.00% 38 55 0.00% 39 47 0.00% 40 44 0.00% 41 61 0.00% 42 64 0.00% 43 72 0.00% 44 78 0.00% 45 91 0.00% 46 100 0.00% 47 127 0.00% 48 121 0.00% 49 134 0.00% 50 168 0.00% 51 180 0.00% 52 186 0.00% 53 245 0.00% 54 256 0.00% 55 263 0.00% 56 318 0.00% 57 336 0.00% 58 423 0.00% 59 468 0.00% 60 532 0.00% 61 602 0.00% 62 690 0.00% 63 784 0.00% 64 881 0.00% 65 1046 0.00% 66 1189 0.00% 67 1294 0.00% 68 1477 0.00% 69 2441 0.00% 70 2720 0.01% 71 2324 0.00% 72 2485 0.00% 73 2625 0.01% 74 3060 0.01% 75 3344 0.01% 76 3946 0.01% 77 4345 0.01% 78 4789 0.01% 79 5367 0.01% 80 6105 0.01% 81 6989 0.01% 82 7940 0.02% 83 9598 0.02% 84 24556 0.05% 85 24102 0.05% 86 15322 0.03% 87 16799 0.03% 88 18020 0.04% 89 22629 0.04% 90 23776 0.05% 91 24258 0.05% 92 35546 0.07% 93 25717 0.05% 94 30597 0.06% 95 31646 0.06% 96 33436 0.07% 97 34568 0.07% 98 36774 0.07% 99 39204 0.08% 100 41456 0.08% 101 44021 0.09% 102 46829 0.09% 103 49997 0.10% 104 53042 0.10% 105 56729 0.11% 106 60435 0.12% 107 64278 0.13% 108 67135 0.13% 109 69485 0.14% 110 72683 0.14% 111 75572 0.15% 112 79808 0.16% 113 83775 0.16% 114 87335 0.17% 115 91063 0.18% 116 95810 0.19% 117 100177 0.20% 118 105594 0.21% 119 109876 0.21% 120 109629 0.21% 121 115369 0.23% 122 117937 0.23% 123 122780 0.24% 124 126932 0.25% 125 131539 0.26% 126 136633 0.27% 127 143658 0.28% 128 148892 0.29% 129 152691 0.30% 130 157451 0.31% 131 161082 0.31% 132 166007 0.32% 133 173633 0.34% 134 178401 0.35% 135 186585 0.36% 136 193796 0.38% 137 202911 0.40% 138 213598 0.42% 139 224164 0.44% 140 237212 0.46% 141 252451 0.49% 142 273663 0.54% 143 298181 0.58% 144 333994 0.65% 145 393702 0.77% 146 486732 0.95% 147 667670 1.31% 148 1199612 2.35% 149 7896848 15.44% 150 33961003 66.41% 51137611 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=13 fanout-score=93.75 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=17.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=42 prefix-density=0.18 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=96.19 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.3 sequence=AAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR4237597 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:52:25 Started mapping on | Feb 12 13:52:25 Finished on | Feb 12 13:57:05 Mapping speed, Million of reads per hour | 657.48 Number of input reads | 51137611 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 49130645 Uniquely mapped reads % | 96.08% Average mapped length | 292.55 Number of splices: Total | 44064030 Number of splices: Annotated (sjdb) | 43320443 Number of splices: GT/AG | 43415129 Number of splices: GC/AG | 504657 Number of splices: AT/AC | 40370 Number of splices: Non-canonical | 103874 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 924918 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 69646 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.95% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1119696 1119696 1119696 N_multimapping 924918 924918 924918 N_noFeature 1394823 48450011 1747533 N_ambiguous 526106 3269 195636 UnstrandedReadsAssigned:47209716 PositiveStrandReadsAssigned:677365 NegativeStrandReadsAssigned:47187476 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237597 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237597-trimmed-pair1.fastq SRR4237597-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,137,611 reads, 46,891,057 reads pseudoaligned [quant] estimated average fragment length: 230.926 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR4237597.ke.tsv 34699 SRR4237597.se.tsv 87100 total ==> SRR4237597.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.07 1140 13.7024 Potri.005G024800.1.v4.1 1035 805.074 134 3.57721 Potri.004G059700.1.v4.1 961 731.096 33 0.970098 Potri.007G009000.2.v4.1 1416 1186.07 1 0.0181203 Potri.003G141000.2.v4.1 2943 2713.07 897.151 7.1069 Potri.016G087400.1.v4.1 270 84.3896 4308.55 1097.28 Potri.015G069301.1.v4.1 564 337.689 0 0 Potri.010G195200.1.v4.1 1773 1543.07 82 1.1421 Potri.012G127500.1.v4.1 977 747.08 16376 471.104 ==> SRR4237597.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4942 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 622 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237597 completed mapping pipeline successfully