Starting /dee2/code/volunteer_pipeline.sh SRR4237598 current disk space = 3051807092736 free memory = 1578815176 SRR4237598 SRAfilesize d9eb9f90a94e92b6aa4badf0ac8fd407 SRR4237598.sra SRR4237598.sra file validated SRR4237598 is paired end SRR4237598 is conventional basespace SRR4237598 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237598_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.23075 34.0 33.0 34.0 31.0 34.0 2 32.94075 34.0 33.0 34.0 30.0 34.0 3 33.106 34.0 33.0 34.0 32.0 34.0 4 33.20375 34.0 33.0 34.0 32.0 34.0 5 33.139 34.0 33.0 34.0 32.0 34.0 6 36.95425 38.0 37.0 38.0 35.0 38.0 7 37.35975 38.0 38.0 38.0 37.0 38.0 8 37.46 38.0 38.0 38.0 37.0 38.0 9 37.5085 38.0 38.0 38.0 37.0 38.0 10-14 37.5141 38.0 38.0 38.0 37.8 38.0 15-19 37.40345000000001 38.0 38.0 38.0 37.2 38.0 20-24 37.359899999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.407349999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.35105 38.0 38.0 38.0 37.0 38.0 35-39 37.34570000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.1218 38.0 38.0 38.0 36.2 38.0 45-49 37.18845 38.0 38.0 38.0 36.4 38.0 50-54 37.1421 38.0 38.0 38.0 36.0 38.0 55-59 37.162 38.0 38.0 38.0 36.0 38.0 60-64 37.10165 38.0 38.0 38.0 36.0 38.0 65-69 36.9972 38.0 38.0 38.0 36.0 38.0 70-74 36.621700000000004 38.0 37.8 38.0 34.2 38.0 75-79 37.012649999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.92325 38.0 38.0 38.0 35.6 38.0 85-89 36.9819 38.0 38.0 38.0 36.0 38.0 90-94 36.93325 38.0 38.0 38.0 35.8 38.0 95-99 36.8121 38.0 38.0 38.0 35.2 38.0 100-104 36.7186 38.0 38.0 38.0 35.0 38.0 105-109 36.560249999999996 38.0 38.0 38.0 34.4 38.0 110-114 36.407500000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.39640000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.3164 38.0 38.0 38.0 33.8 38.0 125-129 35.9828 38.0 37.0 38.0 33.0 38.0 130-134 36.02525 38.0 37.6 38.0 33.0 38.0 135-139 35.446799999999996 38.0 36.2 38.0 30.4 38.0 140-144 35.5215 38.0 36.0 38.0 31.6 38.0 145-149 34.01805 38.0 35.0 38.0 23.0 38.0 150 30.231 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 3.0 20 5.0 21 1.0 22 4.0 23 4.0 24 8.0 25 12.0 26 13.0 27 21.0 28 32.0 29 32.0 30 43.0 31 47.0 32 72.0 33 76.0 34 95.0 35 232.0 36 506.0 37 2787.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.163090128755364 11.802575107296137 7.618025751072961 41.41630901287554 2 22.45 16.35 35.9 25.3 3 20.875 19.650000000000002 26.325 33.15 4 23.150000000000002 28.549999999999997 22.425 25.874999999999996 5 22.13032581453634 34.26065162907268 24.335839598997495 19.273182957393484 6 17.7 34.075 25.874999999999996 22.35 7 13.600000000000001 26.8 41.65 17.95 8 16.0 25.85 32.675 25.474999999999998 9 17.125 23.974999999999998 34.375 24.525 10-14 19.155 30.520000000000003 27.07 23.255 15-19 19.650000000000002 29.104999999999997 27.46 23.785 20-24 19.075 29.805 27.66 23.46 25-29 19.115 29.38 27.96 23.544999999999998 30-34 19.25 29.315 27.060000000000002 24.375 35-39 20.119999999999997 29.509999999999998 26.755000000000003 23.615 40-44 19.310965548277416 29.481474073703684 27.01635081754088 24.191209560478026 45-49 19.55 28.865000000000002 27.279999999999998 24.305 50-54 19.435 29.195 27.33 24.04 55-59 19.56 29.330000000000002 27.084999999999997 24.025 60-64 19.265 28.79 27.73 24.215 65-69 19.405 28.62 27.61 24.365000000000002 70-74 19.325 29.535 27.279999999999998 23.86 75-79 19.93 29.65 26.700000000000003 23.72 80-84 19.702955443316498 29.38440766114917 26.76401460219033 24.148622293344 85-89 19.885 29.235 27.229999999999997 23.65 90-94 19.925 28.405 27.93 23.74 95-99 20.16 28.095 27.839999999999996 23.905 100-104 19.68 28.970000000000002 27.35 24.0 105-109 20.395 28.485 27.275 23.845 110-114 20.435 28.155 27.634999999999998 23.775 115-119 19.585 28.575 27.794999999999998 24.044999999999998 120-124 20.26 28.194999999999997 27.22 24.325 125-129 20.226011300565027 28.356417820891046 27.60138006900345 23.816190809540476 130-134 20.49 27.884999999999998 27.884999999999998 23.74 135-139 20.544999999999998 28.1 27.435 23.919999999999998 140-144 20.94 27.715 28.16 23.185 145-149 19.84 28.4 26.905 24.855 150 19.73816717019134 28.675730110775426 27.064451158106746 24.521651560926486 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.5 24 3.5 25 3.5 26 7.5 27 10.5 28 10.5 29 13.5 30 19.5 31 34.0 32 51.0 33 59.5 34 62.0 35 75.5 36 95.5 37 112.0 38 128.0 39 152.5 40 198.0 41 231.0 42 246.0 43 260.0 44 263.5 45 259.5 46 253.5 47 242.0 48 217.0 49 193.5 50 171.5 51 145.5 52 118.0 53 84.5 54 65.5 55 54.5 56 38.5 57 29.5 58 23.5 59 15.5 60 9.5 61 7.0 62 5.5 63 5.5 64 5.5 65 4.5 66 2.0 67 1.5 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.800000000000001 2 0.0 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.5125 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.7 0.0 0.0 0.0 0.0 130-131 2.9625000000000004 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.925 0.0 0.0 0.0 0.0 138 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAGCAG 10 0.0069808904 143.95 8 >>END_MODULE SRR4237598 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237598_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98175 33.0 33.0 34.0 32.0 34.0 2 33.08125 34.0 33.0 34.0 32.0 34.0 3 33.12175 34.0 33.0 34.0 33.0 34.0 4 33.04925 34.0 33.0 34.0 33.0 34.0 5 33.0825 34.0 33.0 34.0 33.0 34.0 6 37.3105 38.0 38.0 38.0 37.0 38.0 7 37.33125 38.0 38.0 38.0 37.0 38.0 8 37.28925 38.0 38.0 38.0 37.0 38.0 9 37.22675 38.0 38.0 38.0 37.0 38.0 10-14 37.21945 38.0 38.0 38.0 37.0 38.0 15-19 36.997699999999995 38.0 38.0 38.0 36.4 38.0 20-24 37.1306 38.0 38.0 38.0 37.0 38.0 25-29 37.19285 38.0 38.0 38.0 37.0 38.0 30-34 37.26775 38.0 38.0 38.0 37.4 38.0 35-39 37.22965000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.12355 38.0 38.0 38.0 37.0 38.0 45-49 37.1546 38.0 38.0 38.0 37.0 38.0 50-54 37.13945 38.0 38.0 38.0 37.0 38.0 55-59 36.2119 38.0 37.0 38.0 31.0 38.0 60-64 37.10165 38.0 38.0 38.0 37.0 38.0 65-69 37.101 38.0 38.0 38.0 37.0 38.0 70-74 37.05145 38.0 38.0 38.0 36.8 38.0 75-79 37.01375 38.0 38.0 38.0 37.0 38.0 80-84 37.04685 38.0 38.0 38.0 36.6 38.0 85-89 36.9793 38.0 38.0 38.0 36.4 38.0 90-94 36.9057 38.0 38.0 38.0 36.2 38.0 95-99 36.878750000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.838049999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.75425 38.0 38.0 38.0 35.6 38.0 110-114 36.676750000000006 38.0 38.0 38.0 35.4 38.0 115-119 36.3898 38.0 38.0 38.0 34.2 38.0 120-124 36.3926 38.0 38.0 38.0 34.4 38.0 125-129 36.37735 38.0 38.0 38.0 34.2 38.0 130-134 35.9572 38.0 37.8 38.0 32.6 38.0 135-139 36.067099999999996 38.0 38.0 38.0 34.0 38.0 140-144 35.7713 38.0 38.0 38.0 33.4 38.0 145-149 35.362399999999994 38.0 38.0 38.0 33.0 38.0 150 30.0685 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 3.0 6 0.0 7 2.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 2.0 17 2.0 18 6.0 19 3.0 20 2.0 21 4.0 22 8.0 23 8.0 24 15.0 25 12.0 26 17.0 27 22.0 28 22.0 29 45.0 30 30.0 31 34.0 32 44.0 33 55.0 34 87.0 35 153.0 36 336.0 37 3078.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.325 20.3 12.65 26.724999999999998 2 29.5 23.75 32.475 14.274999999999999 3 21.375 27.825 30.975 19.825 4 25.3 35.05 22.525000000000002 17.125 5 26.900000000000002 35.375 21.65 16.075 6 20.150000000000002 39.175 23.1 17.575 7 19.725 21.45 41.525 17.299999999999997 8 22.225 23.925 29.5 24.349999999999998 9 22.0 24.775 30.55 22.675 10-14 23.66564954229403 28.782952328547847 27.01715772097444 20.53424040818368 15-19 23.778077942868578 27.675221371754468 27.990394717094404 20.556305968282558 20-24 23.366683341670836 28.67433716858429 27.46873436718359 20.490245122561284 25-29 23.103862317390433 28.602161296778068 27.516509905943565 20.77746647988793 30-34 24.068423948381934 28.114840194067924 27.44460561196419 20.372130245585954 35-39 23.676838419209606 27.423711855927962 28.034017008504254 20.86543271635818 40-44 23.572679509632223 28.3112334250688 27.75081310983237 20.365273955466602 45-49 23.500850936029632 28.33116428070878 28.075883471819 20.092101311442587 50-54 23.36687190268809 27.74690894528708 28.332582469840318 20.55363668218451 55-59 23.684605757196493 28.38548185231539 27.714643304130167 20.21526908635795 60-64 23.688028415628594 27.55515533543449 28.00040022012107 20.75641602881585 65-69 23.723047676221924 27.92535894742108 28.440642353294308 19.910951023062683 70-74 23.599439775910362 27.96618647458984 27.861144457783116 20.573229291716686 75-79 23.528234882208775 27.719701895663484 28.870104536587803 19.88195868553994 80-84 23.597978888388614 27.33503426884787 28.365601080594327 20.701385762169195 85-89 24.120502427063002 27.848671370665066 27.858679877896215 20.17214632437572 90-94 23.459324155193993 27.699624530663332 28.245306633291616 20.595744680851062 95-99 23.446723361680842 28.044022011005502 28.51425712856428 19.994997498749374 100-104 24.22 27.534999999999997 28.46 19.785 105-109 24.191209560478026 27.936396819840994 27.66638331916596 20.206010300515025 110-114 23.50852627894184 28.369255388308247 28.3842576386458 19.737960694104114 115-119 24.141035258814703 27.631907976994246 28.11702925731433 20.11002750687672 120-124 24.51 28.105000000000004 27.6 19.785 125-129 24.0886132919938 27.679151872780917 28.259238885832875 19.97299594939241 130-134 24.5336800520078 27.734160124018604 27.554133119967993 20.1780267040056 135-139 23.966198309915494 27.69138456922846 28.061403070153506 20.281014050702534 140-144 24.834702464435985 28.255860548988178 27.158885994790623 19.75055099178521 145-149 24.69481689013408 28.10186111667 27.91675005003002 19.2865719431659 150 24.261550113607676 27.240595809139105 28.502903307245646 19.994950770007573 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.5 24 2.5 25 4.0 26 4.5 27 3.5 28 5.0 29 9.0 30 15.5 31 23.0 32 32.0 33 38.5 34 48.5 35 67.0 36 85.0 37 107.0 38 135.0 39 165.5 40 188.0 41 208.5 42 242.0 43 275.5 44 280.0 45 277.5 46 286.5 47 274.5 48 250.0 49 216.0 50 172.0 51 136.0 52 107.5 53 81.5 54 63.0 55 51.0 56 43.0 57 30.5 58 19.5 59 13.0 60 9.5 61 8.0 62 4.0 63 3.0 64 2.0 65 1.0 66 1.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.045 15-19 0.055 20-24 0.05 25-29 0.06 30-34 0.034999999999999996 35-39 0.05 40-44 0.075 45-49 0.11 50-54 0.11499999999999999 55-59 0.125 60-64 0.055 65-69 0.055 70-74 0.04 75-79 0.034999999999999996 80-84 0.055 85-89 0.08499999999999999 90-94 0.125 95-99 0.05 100-104 0.0 105-109 0.005 110-114 0.015 115-119 0.025 120-124 0.0 125-129 0.015 130-134 0.015 135-139 0.005 140-144 0.18 145-149 0.06 150 0.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.5125 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.225 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.7125000000000004 0.0 0.0 0.0 0.0 130-131 3.0125 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.575 0.0 0.0 0.0 0.0 136-137 3.9749999999999996 0.0 0.0 0.0 0.0 138 4.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568906 spots for SRR4237598.sra Written 2568906 spots for SRR4237598.sra Read 2568925 spots for SRR4237598.sra Written 2568925 spots for SRR4237598.sra SRR ids: ['SRR4237598.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9bs0g3tp SRR4237598.sra spots: 51378139 blocks: [[1, 2568906], [2568907, 5137812], [5137813, 7706718], [7706719, 10275624], [10275625, 12844530], [12844531, 15413436], [15413437, 17982342], [17982343, 20551248], [20551249, 23120154], [23120155, 25689060], [25689061, 28257966], [28257967, 30826872], [30826873, 33395778], [33395779, 35964684], [35964685, 38533590], [38533591, 41102496], [41102497, 43671402], [43671403, 46240308], [46240309, 48809214], [48809215, 51378139]] SRR4237598 file size 17288317 SRR4237598 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237598 SRR4237598_1.fastq SRR4237598_2.fastq Input file: SRR4237598_1.fastq Paired file: SRR4237598_2.fastq trimmed: SRR4237598-trimmed-pair1.fastq, SRR4237598-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:12:51 2025 >> started Wed Feb 12 15:13:43 2025 >> done (52.090s) 51378139 read pairs processed; of these: 35460 ( 0.07%) short read pairs filtered out after trimming by size control 40943 ( 0.08%) empty read pairs filtered out after trimming by size control 51301736 (99.85%) read pairs available; of these: 15273575 (29.77%) trimmed read pairs available after processing 36028161 (70.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 15 0.00% 20 10 0.00% 21 15 0.00% 22 12 0.00% 23 7 0.00% 24 12 0.00% 25 8 0.00% 26 16 0.00% 27 28 0.00% 28 15 0.00% 29 16 0.00% 30 24 0.00% 31 23 0.00% 32 14 0.00% 33 19 0.00% 34 23 0.00% 35 57 0.00% 36 39 0.00% 37 31 0.00% 38 35 0.00% 39 53 0.00% 40 59 0.00% 41 50 0.00% 42 41 0.00% 43 65 0.00% 44 53 0.00% 45 75 0.00% 46 74 0.00% 47 87 0.00% 48 78 0.00% 49 117 0.00% 50 115 0.00% 51 122 0.00% 52 142 0.00% 53 147 0.00% 54 179 0.00% 55 194 0.00% 56 219 0.00% 57 200 0.00% 58 243 0.00% 59 306 0.00% 60 288 0.00% 61 344 0.00% 62 360 0.00% 63 447 0.00% 64 481 0.00% 65 564 0.00% 66 646 0.00% 67 697 0.00% 68 816 0.00% 69 1636 0.00% 70 2061 0.00% 71 1355 0.00% 72 1294 0.00% 73 1397 0.00% 74 1618 0.00% 75 1809 0.00% 76 2044 0.00% 77 2198 0.00% 78 2426 0.00% 79 2830 0.01% 80 3161 0.01% 81 3520 0.01% 82 4037 0.01% 83 4860 0.01% 84 7419 0.01% 85 7902 0.02% 86 8742 0.02% 87 9540 0.02% 88 10188 0.02% 89 10851 0.02% 90 11833 0.02% 91 13080 0.03% 92 15354 0.03% 93 15265 0.03% 94 16170 0.03% 95 17715 0.03% 96 19808 0.04% 97 20394 0.04% 98 21165 0.04% 99 23111 0.05% 100 24645 0.05% 101 26010 0.05% 102 28084 0.05% 103 30137 0.06% 104 32127 0.06% 105 34937 0.07% 106 37013 0.07% 107 39384 0.08% 108 41361 0.08% 109 43433 0.08% 110 45416 0.09% 111 48268 0.09% 112 50589 0.10% 113 53663 0.10% 114 56332 0.11% 115 60228 0.12% 116 63110 0.12% 117 67931 0.13% 118 69317 0.14% 119 71488 0.14% 120 74028 0.14% 121 77711 0.15% 122 80603 0.16% 123 83660 0.16% 124 87970 0.17% 125 92353 0.18% 126 96082 0.19% 127 100474 0.20% 128 105187 0.21% 129 109854 0.21% 130 114692 0.22% 131 118428 0.23% 132 123381 0.24% 133 128619 0.25% 134 133972 0.26% 135 141997 0.28% 136 150360 0.29% 137 158848 0.31% 138 168850 0.33% 139 178896 0.35% 140 193031 0.38% 141 208141 0.41% 142 229066 0.45% 143 255796 0.50% 144 305662 0.60% 145 382874 0.75% 146 444149 0.87% 147 691857 1.35% 148 1251629 2.44% 149 7789454 15.18% 150 36028161 70.23% 51301736 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=41 prefix-density=0.17 prefix-fanout=2.0 sequence=GCTAGACATGCAAGATTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=284.72 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=29.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.7 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=291.72 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=28.0 sequence=AAGAAGAAGAAG SRR4237598 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:14:28 Started mapping on | Feb 12 15:14:28 Finished on | Feb 12 15:19:46 Mapping speed, Million of reads per hour | 580.77 Number of input reads | 51301736 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 48957692 Uniquely mapped reads % | 95.43% Average mapped length | 294.66 Number of splices: Total | 45490377 Number of splices: Annotated (sjdb) | 44681728 Number of splices: GT/AG | 44790645 Number of splices: GC/AG | 550695 Number of splices: AT/AC | 42522 Number of splices: Non-canonical | 106515 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 952408 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 79080 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.52% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1426412 1426412 1426412 N_multimapping 952408 952408 952408 N_noFeature 1365150 48358386 1693463 N_ambiguous 480964 2665 208365 UnstrandedReadsAssigned:47111578 PositiveStrandReadsAssigned:596641 NegativeStrandReadsAssigned:47055864 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237598 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237598-trimmed-pair1.fastq SRR4237598-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,301,736 reads, 46,729,087 reads pseudoaligned [quant] estimated average fragment length: 246.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52401 SRR4237598.ke.tsv 34699 SRR4237598.se.tsv 87100 total ==> SRR4237598.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.01 945 10.59 Potri.005G024800.1.v4.1 1035 789.009 157 3.95136 Potri.004G059700.1.v4.1 961 715.075 46 1.27742 Potri.007G009000.2.v4.1 1416 1170.01 0 0 Potri.003G141000.2.v4.1 2943 2697.01 841.071 6.19269 Potri.016G087400.1.v4.1 270 75.9167 6178 1615.99 Potri.015G069301.1.v4.1 564 323.208 0 0 Potri.010G195200.1.v4.1 1773 1527.01 96 1.24841 Potri.012G127500.1.v4.1 977 731.05 25662 697.064 ==> SRR4237598.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3626 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 992 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR4237598 completed mapping pipeline successfully