Starting /dee2/code/volunteer_pipeline.sh SRR4237599 current disk space = 3051763265536 free memory = 1581951772 SRR4237599 SRAfilesize 30fbb0708cc4d3a83216d2cab19f9524 SRR4237599.sra SRR4237599.sra file validated SRR4237599 is paired end SRR4237599 is conventional basespace SRR4237599 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237599_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.87475 34.0 33.0 34.0 2.0 34.0 2 32.685 34.0 33.0 34.0 28.0 34.0 3 32.936 34.0 33.0 34.0 31.0 34.0 4 33.23775 34.0 33.0 34.0 32.0 34.0 5 33.28175 34.0 33.0 34.0 33.0 34.0 6 37.0645 38.0 37.0 38.0 36.0 38.0 7 37.339 38.0 38.0 38.0 37.0 38.0 8 37.52125 38.0 38.0 38.0 37.0 38.0 9 37.5545 38.0 38.0 38.0 37.0 38.0 10-14 37.0815 38.0 38.0 38.0 35.6 38.0 15-19 37.430949999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.48185 38.0 38.0 38.0 37.6 38.0 25-29 37.4387 38.0 38.0 38.0 37.2 38.0 30-34 37.4019 38.0 38.0 38.0 37.0 38.0 35-39 37.427 38.0 38.0 38.0 37.0 38.0 40-44 37.26225 38.0 38.0 38.0 37.0 38.0 45-49 37.2459 38.0 38.0 38.0 37.0 38.0 50-54 37.1646 38.0 38.0 38.0 36.0 38.0 55-59 37.10155 38.0 38.0 38.0 36.0 38.0 60-64 37.056349999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.9854 38.0 38.0 38.0 35.8 38.0 70-74 37.04155 38.0 38.0 38.0 36.0 38.0 75-79 36.974 38.0 38.0 38.0 35.8 38.0 80-84 36.96614999999999 38.0 38.0 38.0 35.8 38.0 85-89 35.68125 38.0 35.6 38.0 29.4 38.0 90-94 36.83245 38.0 38.0 38.0 35.2 38.0 95-99 36.82125 38.0 38.0 38.0 35.2 38.0 100-104 36.65705 38.0 38.0 38.0 34.6 38.0 105-109 36.402699999999996 38.0 37.8 38.0 34.0 38.0 110-114 36.4045 38.0 38.0 38.0 34.0 38.0 115-119 36.36794999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.1912 38.0 37.6 38.0 33.6 38.0 125-129 35.97625 38.0 37.0 38.0 33.0 38.0 130-134 35.81679999999999 38.0 37.0 38.0 32.6 38.0 135-139 35.51515 38.0 36.2 38.0 31.4 38.0 140-144 35.353449999999995 38.0 36.0 38.0 31.0 38.0 145-149 34.98479999999999 38.0 36.0 38.0 30.4 38.0 150 29.9155 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 3.0 18 2.0 19 2.0 20 3.0 21 3.0 22 8.0 23 3.0 24 11.0 25 11.0 26 12.0 27 15.0 28 27.0 29 30.0 30 44.0 31 54.0 32 66.0 33 69.0 34 124.0 35 246.0 36 582.0 37 2683.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.06606691031768 11.4422265954456 8.63086870958673 34.86083778464998 2 23.980995248812203 14.703675918979744 33.033258314578646 28.28207051762941 3 19.525000000000002 19.125 27.250000000000004 34.1 4 23.5 28.999999999999996 22.8 24.7 5 22.108162243365047 34.57686529794692 23.585378067100653 19.729594391587383 6 17.724999999999998 36.075 23.875 22.325 7 13.5 27.05 41.25 18.2 8 17.549999999999997 25.8 30.825000000000003 25.825 9 17.625 24.725 33.575 24.075 10-14 19.869999999999997 29.505 27.365000000000002 23.26 15-19 19.835 28.78 27.765 23.62 20-24 19.625 29.32 26.924999999999997 24.13 25-29 20.150000000000002 29.175 27.02 23.655 30-34 20.28 28.505000000000003 27.515 23.7 35-39 19.42 29.215000000000003 27.125 24.240000000000002 40-44 20.135 29.165000000000003 27.185 23.515 45-49 19.64 29.48 26.724999999999998 24.154999999999998 50-54 20.145 29.409999999999997 27.305 23.14 55-59 19.77 29.415000000000003 27.139999999999997 23.674999999999997 60-64 20.395 28.98 26.66 23.965 65-69 20.05 28.505000000000003 27.38 24.065 70-74 20.145 29.349999999999998 27.12 23.385 75-79 20.1 28.785 27.72 23.395 80-84 20.5 28.355000000000004 26.979999999999997 24.165 85-89 19.675 28.939999999999998 27.505000000000003 23.880000000000003 90-94 20.415 29.42 26.69 23.474999999999998 95-99 20.435 29.455 27.355 22.755 100-104 20.315 28.815 26.900000000000002 23.97 105-109 20.375 28.53 27.200000000000003 23.895 110-114 20.125 28.939999999999998 27.215 23.72 115-119 20.32 28.975 27.07 23.635 120-124 20.585 28.63 27.255000000000003 23.53 125-129 20.39 28.705000000000002 27.255000000000003 23.65 130-134 20.125 28.705000000000002 27.22 23.95 135-139 20.5 28.735 27.11 23.655 140-144 20.465 28.439999999999998 27.08 24.015 145-149 21.0 28.645 26.46 23.895 150 20.404040404040405 28.98989898989899 26.994949494949495 23.61111111111111 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 0.5 22 0.5 23 1.5 24 3.5 25 5.5 26 9.0 27 8.5 28 7.5 29 13.0 30 19.5 31 25.0 32 35.5 33 52.0 34 56.5 35 70.0 36 87.0 37 95.5 38 126.0 39 158.0 40 176.5 41 212.5 42 252.0 43 269.0 44 273.5 45 269.5 46 253.5 47 257.5 48 244.5 49 213.5 50 177.5 51 139.5 52 116.0 53 89.5 54 81.0 55 59.5 56 31.5 57 23.0 58 19.5 59 14.5 60 12.5 61 10.5 62 5.5 63 2.5 64 5.5 65 7.0 66 3.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.075 2 0.025 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 1.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.7125 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.6875 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237599 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237599_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92325 33.0 33.0 34.0 32.0 34.0 2 33.07425 34.0 33.0 34.0 32.0 34.0 3 33.007 34.0 33.0 34.0 32.0 34.0 4 32.974 34.0 33.0 34.0 32.0 34.0 5 33.05825 34.0 33.0 34.0 32.0 34.0 6 37.1715 38.0 38.0 38.0 37.0 38.0 7 37.26475 38.0 38.0 38.0 37.0 38.0 8 37.20825 38.0 38.0 38.0 37.0 38.0 9 37.1995 38.0 38.0 38.0 37.0 38.0 10-14 37.126349999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.131899999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.066700000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.0912 38.0 38.0 38.0 37.0 38.0 30-34 37.0689 38.0 38.0 38.0 37.0 38.0 35-39 37.106399999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.1092 38.0 38.0 38.0 37.0 38.0 45-49 37.079750000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.013549999999995 38.0 38.0 38.0 37.0 38.0 55-59 36.975 38.0 38.0 38.0 36.8 38.0 60-64 36.936550000000004 38.0 38.0 38.0 36.4 38.0 65-69 36.96665 38.0 38.0 38.0 36.4 38.0 70-74 36.9058 38.0 38.0 38.0 36.0 38.0 75-79 36.8689 38.0 38.0 38.0 36.0 38.0 80-84 36.86985 38.0 38.0 38.0 36.0 38.0 85-89 36.77905 38.0 38.0 38.0 36.0 38.0 90-94 36.77965 38.0 38.0 38.0 36.0 38.0 95-99 36.66754999999999 38.0 38.0 38.0 35.6 38.0 100-104 36.478899999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.48870000000001 38.0 38.0 38.0 34.8 38.0 110-114 36.547799999999995 38.0 38.0 38.0 35.0 38.0 115-119 36.44445 38.0 38.0 38.0 34.8 38.0 120-124 36.267450000000004 38.0 38.0 38.0 34.2 38.0 125-129 36.102850000000004 38.0 38.0 38.0 34.0 38.0 130-134 35.9864 38.0 38.0 38.0 33.8 38.0 135-139 35.89545 38.0 38.0 38.0 33.4 38.0 140-144 35.5849 38.0 38.0 38.0 33.0 38.0 145-149 35.26415 38.0 37.2 38.0 32.0 38.0 150 30.25325 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 5.0 4 1.0 5 1.0 6 2.0 7 0.0 8 3.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 5.0 15 5.0 16 2.0 17 6.0 18 4.0 19 4.0 20 7.0 21 7.0 22 11.0 23 6.0 24 11.0 25 13.0 26 11.0 27 16.0 28 22.0 29 28.0 30 38.0 31 42.0 32 59.0 33 64.0 34 88.0 35 143.0 36 349.0 37 3042.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.7 23.35 10.75 22.2 2 28.675 26.200000000000003 29.625 15.5 3 20.225 27.35 31.825 20.599999999999998 4 24.125 35.425000000000004 22.525000000000002 17.925 5 25.25 38.275 20.95 15.525 6 20.95 38.725 23.724999999999998 16.6 7 19.625 21.475 39.6 19.3 8 20.724999999999998 24.349999999999998 29.825000000000003 25.1 9 22.2 24.675 29.975 23.150000000000002 10-14 23.995 28.84 26.715 20.45 15-19 23.73974794958992 27.930586117223445 28.050610122024406 20.279055811162234 20-24 23.244999999999997 28.155 27.98 20.62 25-29 23.368505275791367 28.20423063459519 27.574136120418064 20.853127969195377 30-34 23.123468520278042 28.674301145171775 27.53413011951793 20.668100215032254 35-39 23.285 28.435 27.61 20.669999999999998 40-44 23.59 27.805000000000003 28.000000000000004 20.605 45-49 23.662366236623665 27.632763276327633 28.05780578057806 20.647064706470648 50-54 23.86954781912765 28.031212484994 27.946178471388556 20.153061224489797 55-59 23.793569035355304 27.784167625143773 28.064209631444715 20.358053708056207 60-64 23.34 28.060000000000002 28.58 20.02 65-69 23.42234223422342 27.63776377637764 28.267826782678267 20.672067206720673 70-74 24.07620381019051 27.67638381919096 28.171408570428518 20.07600380019001 75-79 22.975 27.51 28.77 20.745 80-84 24.08120406020301 27.42137106855343 27.94139706985349 20.55602780139007 85-89 23.66855028254238 27.01905285792869 28.3842576386458 20.928139220883132 90-94 24.082041020510257 27.318659329664836 28.47423711855928 20.125062531265634 95-99 23.62826989446306 27.899764917721203 27.52463362176762 20.947331566048117 100-104 23.45 27.750000000000004 28.799999999999997 20.0 105-109 23.533530029504426 28.174226133920087 27.809171375706356 20.48307246086913 110-114 23.57 27.655 28.405 20.369999999999997 115-119 23.853578036705507 28.399259888983348 27.644146621993297 20.103015452317848 120-124 23.65354803220483 27.764164624693706 28.42926438965845 20.153022953443017 125-129 23.935000000000002 27.3 28.005000000000003 20.76 130-134 23.951197559877993 27.68638431921596 27.966398319915996 20.39601980099005 135-139 24.47 27.405 28.125 20.0 140-144 24.33204671913379 27.906160709810013 27.63045766705098 20.131334904005215 145-149 24.312431243124312 27.8977897789779 27.642764276427645 20.147014701470148 150 24.227848101265824 27.67088607594937 27.51898734177215 20.582278481012658 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 2.5 25 4.5 26 5.0 27 4.0 28 5.0 29 9.5 30 16.0 31 13.5 32 19.0 33 37.0 34 50.0 35 60.0 36 82.5 37 102.5 38 131.5 39 179.0 40 218.0 41 238.0 42 250.5 43 273.0 44 284.5 45 281.5 46 264.5 47 236.0 48 221.0 49 204.0 50 181.0 51 153.0 52 115.5 53 83.5 54 66.0 55 53.0 56 38.5 57 32.5 58 25.5 59 17.5 60 11.0 61 6.0 62 4.5 63 4.0 64 3.0 65 1.5 66 1.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.0 25-29 0.015 30-34 0.015 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.04 55-59 0.015 60-64 0.0 65-69 0.01 70-74 0.005 75-79 0.0 80-84 0.005 85-89 0.015 90-94 0.05 95-99 0.034999999999999996 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.015 120-124 0.015 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.255 145-149 0.01 150 1.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.8625 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.6625 0.0 0.0 0.0 0.0 138 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATGCA 10 0.006973645 144.0 6 TTTTTTA 10 0.006973645 144.0 2 GTTTTTT 10 0.006973645 144.0 1 >>END_MODULE Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433280 spots for SRR4237599.sra Written 2433280 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra Read 2433270 spots for SRR4237599.sra Written 2433270 spots for SRR4237599.sra SRR ids: ['SRR4237599.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_909lf4wy SRR4237599.sra spots: 48665410 blocks: [[1, 2433270], [2433271, 4866540], [4866541, 7299810], [7299811, 9733080], [9733081, 12166350], [12166351, 14599620], [14599621, 17032890], [17032891, 19466160], [19466161, 21899430], [21899431, 24332700], [24332701, 26765970], [26765971, 29199240], [29199241, 31632510], [31632511, 34065780], [34065781, 36499050], [36499051, 38932320], [38932321, 41365590], [41365591, 43798860], [43798861, 46232130], [46232131, 48665410]] SRR4237599 file size 16374360 SRR4237599 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237599 SRR4237599_1.fastq SRR4237599_2.fastq Input file: SRR4237599_1.fastq Paired file: SRR4237599_2.fastq trimmed: SRR4237599-trimmed-pair1.fastq, SRR4237599-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:59:31 2025 >> started Wed Feb 12 15:00:25 2025 >> done (53.956s) 48665410 read pairs processed; of these: 42732 ( 0.09%) short read pairs filtered out after trimming by size control 27346 ( 0.06%) empty read pairs filtered out after trimming by size control 48595332 (99.86%) read pairs available; of these: 16411383 (33.77%) trimmed read pairs available after processing 32183949 (66.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 16 0.00% 20 11 0.00% 21 5 0.00% 22 11 0.00% 23 20 0.00% 24 94 0.00% 25 7 0.00% 26 14 0.00% 27 19 0.00% 28 16 0.00% 29 11 0.00% 30 25 0.00% 31 25 0.00% 32 31 0.00% 33 20 0.00% 34 23 0.00% 35 26 0.00% 36 17 0.00% 37 42 0.00% 38 28 0.00% 39 28 0.00% 40 32 0.00% 41 43 0.00% 42 42 0.00% 43 33 0.00% 44 40 0.00% 45 77 0.00% 46 56 0.00% 47 76 0.00% 48 92 0.00% 49 79 0.00% 50 83 0.00% 51 90 0.00% 52 105 0.00% 53 110 0.00% 54 150 0.00% 55 139 0.00% 56 159 0.00% 57 167 0.00% 58 226 0.00% 59 184 0.00% 60 266 0.00% 61 307 0.00% 62 320 0.00% 63 334 0.00% 64 394 0.00% 65 432 0.00% 66 535 0.00% 67 703 0.00% 68 1124 0.00% 69 2043 0.00% 70 1765 0.00% 71 1048 0.00% 72 967 0.00% 73 1069 0.00% 74 1120 0.00% 75 1256 0.00% 76 1297 0.00% 77 1623 0.00% 78 1819 0.00% 79 1994 0.00% 80 2158 0.00% 81 2500 0.01% 82 2904 0.01% 83 3404 0.01% 84 6380 0.01% 85 6690 0.01% 86 7351 0.02% 87 7907 0.02% 88 8315 0.02% 89 8741 0.02% 90 9299 0.02% 91 9965 0.02% 92 10582 0.02% 93 11475 0.02% 94 12472 0.03% 95 13474 0.03% 96 14409 0.03% 97 15415 0.03% 98 16057 0.03% 99 17168 0.04% 100 18455 0.04% 101 19551 0.04% 102 20807 0.04% 103 22595 0.05% 104 23843 0.05% 105 25857 0.05% 106 27557 0.06% 107 28674 0.06% 108 30502 0.06% 109 32120 0.07% 110 34038 0.07% 111 35759 0.07% 112 38297 0.08% 113 40149 0.08% 114 42585 0.09% 115 45044 0.09% 116 47351 0.10% 117 49816 0.10% 118 51858 0.11% 119 54059 0.11% 120 56108 0.12% 121 59714 0.12% 122 62278 0.13% 123 66030 0.14% 124 69373 0.14% 125 72923 0.15% 126 76422 0.16% 127 80600 0.17% 128 84715 0.17% 129 89497 0.18% 130 94189 0.19% 131 98682 0.20% 132 104283 0.21% 133 110357 0.23% 134 116448 0.24% 135 124567 0.26% 136 132485 0.27% 137 142154 0.29% 138 152947 0.31% 139 164858 0.34% 140 178672 0.37% 141 197709 0.41% 142 219924 0.45% 143 250141 0.51% 144 294520 0.61% 145 366584 0.75% 146 464624 0.96% 147 691284 1.42% 148 1387593 2.86% 149 9503223 19.56% 150 32183949 66.23% 48595332 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=384.36 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=20.7 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.2 sequence=AGTTCCAATGGCCACTGTTGAGGTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=398.18 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=20.7 sequence=ACAAGAAGATCAACTGTCTCTCTGCCTGGTTTGTATTCCAAGAAATGGAGAAAGTCCAAAAGCTCTTTTGTGTGGCTCTATTGCTTGCAGTACTAGCCATAGCAAGCAATATTGCGAATGCCCAGAGTACCATATGCAAAATGCCTGTTGCTGGCCTAATGTCATGCAAGCCTTCTGTAACTCCTCCTAACCCTACCGCACCCTCGGCAGACTGCTGCTCGGCACTTTCGCATGCTGACATAAACTGCCTTTGCTCCTACAAAAATTCCAACCTGCTCCCTTCCCTTGGAATCGACCCAAAACTTGCCATGCAGCTCCCTGGCAAGTGCAAGCTTCCTCACCCTGCTAATTGCTAGACTACCGATCGTAATCGATCCAAGGGTTTTCCTCTACATATATGTATCATGTCATAAACGTC SRR4237599 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:01:10 Started mapping on | Feb 12 15:01:11 Finished on | Feb 12 15:05:04 Mapping speed, Million of reads per hour | 750.83 Number of input reads | 48595332 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 46856847 Uniquely mapped reads % | 96.42% Average mapped length | 295.18 Number of splices: Total | 43678686 Number of splices: Annotated (sjdb) | 42912344 Number of splices: GT/AG | 43025506 Number of splices: GC/AG | 516255 Number of splices: AT/AC | 36961 Number of splices: Non-canonical | 99964 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 901409 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 63350 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.56% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 882481 882481 882481 N_multimapping 901409 901409 901409 N_noFeature 1284586 46313150 1563540 N_ambiguous 479646 2493 213393 UnstrandedReadsAssigned:45092615 PositiveStrandReadsAssigned:541204 NegativeStrandReadsAssigned:45079914 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237599 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237599-trimmed-pair1.fastq SRR4237599-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,595,332 reads, 44,777,954 reads pseudoaligned [quant] estimated average fragment length: 255.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,288 rounds 52401 SRR4237599.ke.tsv 34699 SRR4237599.se.tsv 87100 total ==> SRR4237599.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.52 1236 15.4402 Potri.005G024800.1.v4.1 1035 780.525 194 5.47559 Potri.004G059700.1.v4.1 961 706.567 12 0.374149 Potri.007G009000.2.v4.1 1416 1161.52 0 0 Potri.003G141000.2.v4.1 2943 2688.52 1001.09 8.20308 Potri.016G087400.1.v4.1 270 71.6436 4298 1321.62 Potri.015G069301.1.v4.1 564 315.676 0 0 Potri.010G195200.1.v4.1 1773 1518.52 172 2.4953 Potri.012G127500.1.v4.1 977 722.549 13531 412.552 ==> SRR4237599.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5160 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 755 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR4237599 completed mapping pipeline successfully