Starting /dee2/code/volunteer_pipeline.sh SRR4237600 current disk space = 3051740127232 free memory = 1579636764 SRR4237600 SRAfilesize 489b7807b1d53772b5afb09ed2262b0f SRR4237600.sra SRR4237600.sra file validated SRR4237600 is paired end SRR4237600 is conventional basespace SRR4237600 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237600_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.49 34.0 33.0 34.0 33.0 34.0 2 33.448 34.0 34.0 34.0 33.0 34.0 3 33.54225 34.0 34.0 34.0 33.0 34.0 4 33.52825 34.0 34.0 34.0 33.0 34.0 5 33.06175 34.0 34.0 34.0 33.0 34.0 6 37.01225 38.0 37.0 38.0 35.0 38.0 7 37.3505 38.0 38.0 38.0 36.0 38.0 8 37.484 38.0 38.0 38.0 37.0 38.0 9 37.58175 38.0 38.0 38.0 38.0 38.0 10-14 37.573249999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.54085 38.0 38.0 38.0 37.8 38.0 20-24 37.517399999999995 38.0 38.0 38.0 37.6 38.0 25-29 37.483999999999995 38.0 38.0 38.0 37.4 38.0 30-34 37.361149999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.390699999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.32030000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.3106 38.0 38.0 38.0 37.0 38.0 50-54 37.21445 38.0 38.0 38.0 36.8 38.0 55-59 37.1412 38.0 38.0 38.0 36.4 38.0 60-64 37.065999999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.50135 38.0 37.4 38.0 32.8 38.0 70-74 36.977599999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.9719 38.0 38.0 38.0 35.8 38.0 80-84 36.8861 38.0 37.8 38.0 35.4 38.0 85-89 36.72165 38.0 38.0 38.0 35.0 38.0 90-94 36.9419 38.0 38.0 38.0 35.6 38.0 95-99 36.7721 38.0 38.0 38.0 35.0 38.0 100-104 35.5464 38.0 36.4 38.0 29.2 38.0 105-109 36.271 38.0 37.4 38.0 32.6 38.0 110-114 36.64795 38.0 38.0 38.0 34.8 38.0 115-119 36.612199999999994 38.0 38.0 38.0 34.2 38.0 120-124 36.535450000000004 38.0 38.0 38.0 34.2 38.0 125-129 35.813100000000006 38.0 36.8 38.0 31.4 38.0 130-134 35.96525 38.0 37.0 38.0 33.0 38.0 135-139 35.858050000000006 38.0 36.8 38.0 32.6 38.0 140-144 35.7208 38.0 36.0 38.0 33.0 38.0 145-149 34.69675 38.0 35.6 38.0 27.6 38.0 150 29.79675 35.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 2.0 21 5.0 22 2.0 23 6.0 24 11.0 25 7.0 26 16.0 27 17.0 28 22.0 29 23.0 30 35.0 31 38.0 32 65.0 33 85.0 34 136.0 35 250.0 36 582.0 37 2694.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.125 11.35 9.4 41.125 2 23.767825869402053 15.961971478608957 35.72679509632224 24.54340755566675 3 20.525 19.975 25.924999999999997 33.575 4 24.4 29.25 21.7 24.65 5 22.264437689969604 34.70111448834853 23.2016210739615 19.832826747720365 6 17.625 36.275 25.224999999999998 20.875 7 14.475 25.3 41.825 18.4 8 17.675 24.825 32.800000000000004 24.7 9 18.175 23.0 34.425 24.4 10-14 19.845 30.385 26.834999999999997 22.935 15-19 20.055 29.225 27.075 23.645 20-24 20.305 29.14 27.400000000000002 23.155 25-29 20.07 29.299999999999997 26.99 23.64 30-34 19.24 28.95 27.794999999999998 24.015 35-39 19.919999999999998 28.925 27.525 23.630000000000003 40-44 20.26 29.04 27.215 23.485 45-49 20.285 29.065 26.91 23.74 50-54 19.38 28.785 27.474999999999998 24.36 55-59 20.0 29.28 26.889999999999997 23.830000000000002 60-64 19.794999999999998 29.195 27.05 23.96 65-69 20.39 28.435 27.51 23.665 70-74 20.365 28.425 27.650000000000002 23.56 75-79 20.435 28.71 26.985 23.87 80-84 20.01 28.465 27.42 24.104999999999997 85-89 20.34 28.025 27.534999999999997 24.099999999999998 90-94 20.05 28.87 27.325 23.755000000000003 95-99 19.89 28.689999999999998 27.47 23.95 100-104 20.415 28.535 27.450000000000003 23.599999999999998 105-109 20.18 28.804999999999996 27.27 23.745 110-114 20.185 28.59 27.37 23.855 115-119 20.68 28.794999999999998 26.974999999999998 23.549999999999997 120-124 20.369999999999997 28.465 27.634999999999998 23.53 125-129 20.378056708506275 28.889333400010003 27.084062609391406 23.648547282092313 130-134 20.525 28.835 27.195000000000004 23.445 135-139 20.580145036259065 28.68217054263566 27.286821705426355 23.45086271567892 140-144 20.602060206020603 28.36283628362836 27.06770677067707 23.96739673967397 145-149 20.13 28.305000000000003 26.945000000000004 24.62 150 20.79779227295534 28.4746613146011 27.395885599598596 23.331660812844955 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 2.5 27 4.0 28 8.0 29 12.5 30 17.0 31 21.0 32 33.0 33 39.0 34 44.5 35 69.0 36 88.5 37 107.0 38 136.5 39 164.5 40 189.0 41 211.0 42 248.0 43 278.0 44 278.5 45 279.0 46 276.5 47 265.5 48 245.0 49 206.0 50 154.0 51 133.5 52 123.5 53 92.0 54 71.0 55 53.0 56 40.0 57 29.0 58 18.5 59 18.0 60 11.5 61 4.5 62 5.0 63 5.5 64 3.5 65 3.0 66 2.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 1.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.025 140-144 0.01 145-149 0.0 150 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.025 0.0 0.0 0.0 0.0 120-121 2.2375 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.9 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.375 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138 5.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAACA 10 0.006973645 144.0 7 AAAAAAA 55 1.2304276E-4 18.327272 30-34 >>END_MODULE SRR4237600 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237600_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9455 33.0 33.0 34.0 32.0 34.0 2 33.1335 34.0 33.0 34.0 33.0 34.0 3 33.1335 34.0 33.0 34.0 32.0 34.0 4 33.18875 34.0 33.0 34.0 33.0 34.0 5 33.10175 34.0 33.0 34.0 33.0 34.0 6 37.22525 38.0 38.0 38.0 37.0 38.0 7 37.26525 38.0 38.0 38.0 37.0 38.0 8 37.18925 38.0 38.0 38.0 37.0 38.0 9 37.08325 38.0 38.0 38.0 37.0 38.0 10-14 37.045100000000005 38.0 38.0 38.0 36.4 38.0 15-19 37.1267 38.0 38.0 38.0 37.0 38.0 20-24 36.81675 38.0 38.0 38.0 35.0 38.0 25-29 35.6436 38.0 36.0 38.0 29.0 38.0 30-34 37.0372 38.0 38.0 38.0 36.4 38.0 35-39 36.69905 38.0 37.8 38.0 34.8 38.0 40-44 36.992399999999996 38.0 38.0 38.0 36.2 38.0 45-49 36.998650000000005 38.0 38.0 38.0 36.4 38.0 50-54 37.07435 38.0 38.0 38.0 37.0 38.0 55-59 37.1584 38.0 38.0 38.0 37.0 38.0 60-64 36.65065 38.0 38.0 38.0 34.8 38.0 65-69 36.16330000000001 38.0 37.4 38.0 32.2 38.0 70-74 36.6021 38.0 37.8 38.0 34.2 38.0 75-79 36.016 38.0 37.0 38.0 30.4 38.0 80-84 37.00065 38.0 38.0 38.0 36.4 38.0 85-89 36.45485 38.0 37.8 38.0 34.0 38.0 90-94 36.8346 38.0 38.0 38.0 35.8 38.0 95-99 36.8566 38.0 38.0 38.0 36.0 38.0 100-104 36.73495 38.0 38.0 38.0 35.8 38.0 105-109 35.626599999999996 38.0 36.4 38.0 29.4 38.0 110-114 36.60935 38.0 38.0 38.0 35.0 38.0 115-119 36.44825 38.0 38.0 38.0 34.6 38.0 120-124 36.46055 38.0 38.0 38.0 34.6 38.0 125-129 36.33165 38.0 38.0 38.0 34.2 38.0 130-134 36.2676 38.0 38.0 38.0 34.0 38.0 135-139 35.9844 38.0 38.0 38.0 33.6 38.0 140-144 35.783699999999996 38.0 38.0 38.0 33.2 38.0 145-149 35.4422 38.0 37.8 38.0 32.6 38.0 150 29.784 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 9.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 2.0 13 1.0 14 1.0 15 2.0 16 2.0 17 1.0 18 3.0 19 3.0 20 2.0 21 1.0 22 9.0 23 5.0 24 9.0 25 13.0 26 14.0 27 20.0 28 28.0 29 32.0 30 37.0 31 39.0 32 56.0 33 82.0 34 118.0 35 207.0 36 582.0 37 2714.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.45 20.075000000000003 12.8 27.675 2 28.775000000000002 24.2 32.574999999999996 14.45 3 21.775 27.700000000000003 31.424999999999997 19.1 4 25.1 34.575 22.875 17.45 5 25.900000000000002 36.925000000000004 21.7 15.475 6 20.165330661322646 39.078156312625254 23.672344689378757 17.084168336673347 7 19.59949937421777 20.200250312891114 41.226533166458076 18.973717146433042 8 22.158237356034054 24.586880320480724 29.218828242363543 24.036054081121684 9 21.849160611375595 24.65547481834127 30.719118015534953 22.776246554748184 10-14 23.200681635926223 29.00962309542903 27.17522052927025 20.6144747393745 15-19 23.37857464816948 28.016226774177394 28.206540792307305 20.39865778534582 20-24 23.614240648940964 28.346101847679133 27.81533223173602 20.224325271643885 25-29 23.494066396274597 27.835361273847077 28.235942116068298 20.434630213810024 30-34 23.38955903698884 27.68406827168527 28.28970418939887 20.636668501927026 35-39 23.521162033558728 28.119208615076385 27.918858001502628 20.440771349862256 40-44 23.284240056106604 27.762749223524697 28.41899609257589 20.534014627792807 45-49 23.663892509776396 27.519302115712424 28.0657775995187 20.75102777499248 50-54 23.35722520174427 27.92341236028269 28.75043857450754 19.96892386346549 55-59 23.21276275523002 27.22620779611699 29.06235890232278 20.498670546330207 60-64 23.357078358583326 27.907093408247214 28.46393097220829 20.271897260961172 65-69 23.265838011226943 28.408179631114677 27.856856455493183 20.469125902165196 70-74 23.652949726830734 28.174026364593253 28.259235126058847 19.913788782517166 75-79 23.61640264688189 27.937637858431923 28.253458993382797 20.19250050130339 80-84 23.962925851703407 27.349699398797593 28.181362725450903 20.506012024048097 85-89 23.481050731902947 27.83737718066974 28.408863043914177 20.272709043513135 90-94 23.909118266626542 27.515297422008228 28.327816230313974 20.24776808105126 95-99 23.773206221776217 27.74711490215755 28.40441545408931 20.07526342197692 100-104 24.104234527687296 27.286394387371587 28.263593084439993 20.345778000501127 105-109 24.06312625250501 27.875751503006015 28.14128256513026 19.919839679358716 110-114 23.621139189731245 28.12876052948255 28.108704372242276 20.141395908543924 115-119 24.044729716176914 27.434560224651488 28.392337779560727 20.128372279610872 120-124 24.216909737884027 27.594847892547484 27.730165889841125 20.45807647972736 125-129 24.343160850381068 27.466907340553547 27.50200561572403 20.687926193341355 130-134 24.7769870702616 27.593464969429686 27.533326651297983 20.096221309010726 135-139 25.16051364365971 27.66352327447833 27.673555377207066 19.502407704654896 140-144 24.705114691562517 27.636400140541085 27.671535411333636 19.986949756562765 145-149 25.272079843522743 27.925171773910428 27.107678419178495 19.695069963388335 150 24.78589420654912 29.74811083123426 26.02015113350126 19.445843828715365 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 2.0 5 1.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.5 24 2.5 25 4.5 26 3.0 27 4.5 28 10.0 29 11.0 30 16.0 31 22.5 32 28.0 33 33.0 34 41.5 35 59.5 36 85.0 37 115.5 38 144.0 39 165.0 40 187.5 41 228.0 42 274.5 43 292.5 44 293.5 45 282.5 46 266.5 47 259.0 48 234.0 49 189.5 50 158.0 51 144.0 52 115.0 53 81.0 54 59.5 55 46.0 56 34.0 57 23.5 58 16.5 59 13.5 60 11.5 61 9.5 62 5.0 63 3.5 64 4.5 65 2.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.125 8 0.15 9 0.22499999999999998 10-14 0.24 15-19 0.165 20-24 0.145 25-29 0.145 30-34 0.105 35-39 0.17500000000000002 40-44 0.19 45-49 0.27 50-54 0.245 55-59 0.335 60-64 0.33 65-69 0.24 70-74 0.245 75-79 0.26 80-84 0.2 85-89 0.26 90-94 0.31 95-99 0.35000000000000003 100-104 0.22499999999999998 105-109 0.2 110-114 0.27999999999999997 115-119 0.29 120-124 0.23500000000000001 125-129 0.27999999999999997 130-134 0.22999999999999998 135-139 0.32 140-144 0.385 145-149 0.305 150 0.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.2249999999999996 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.85 0.0 0.0 0.0 0.0 126-127 3.2125 0.0 0.0 0.0 0.0 128-129 3.5375 0.0 0.0 0.0 0.0 130-131 3.9625 0.0 0.0 0.0 0.0 132-133 4.3 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.550000000000001 0.0 0.0 0.0 0.0 138 5.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCTC 60 2.3964225E-4 16.798542 20-24 TCTCTCT 65 0.007999954 13.291155 20-24 >>END_MODULE Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162069 spots for SRR4237600.sra Written 2162069 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra Read 2162064 spots for SRR4237600.sra Written 2162064 spots for SRR4237600.sra SRR ids: ['SRR4237600.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gl3u0k6h SRR4237600.sra spots: 43241285 blocks: [[1, 2162064], [2162065, 4324128], [4324129, 6486192], [6486193, 8648256], [8648257, 10810320], [10810321, 12972384], [12972385, 15134448], [15134449, 17296512], [17296513, 19458576], [19458577, 21620640], [21620641, 23782704], [23782705, 25944768], [25944769, 28106832], [28106833, 30268896], [30268897, 32430960], [32430961, 34593024], [34593025, 36755088], [36755089, 38917152], [38917153, 41079216], [41079217, 43241285]] SRR4237600 file size 14546896 SRR4237600 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237600 SRR4237600_1.fastq SRR4237600_2.fastq Input file: SRR4237600_1.fastq Paired file: SRR4237600_2.fastq trimmed: SRR4237600-trimmed-pair1.fastq, SRR4237600-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:22:20 2025 >> started Wed Feb 12 15:23:08 2025 >> done (47.271s) 43241285 read pairs processed; of these: 32408 ( 0.07%) short read pairs filtered out after trimming by size control 27501 ( 0.06%) empty read pairs filtered out after trimming by size control 43181376 (99.86%) read pairs available; of these: 14102742 (32.66%) trimmed read pairs available after processing 29078634 (67.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 8 0.00% 21 7 0.00% 22 12 0.00% 23 11 0.00% 24 9 0.00% 25 8 0.00% 26 11 0.00% 27 15 0.00% 28 9 0.00% 29 16 0.00% 30 18 0.00% 31 22 0.00% 32 26 0.00% 33 15 0.00% 34 21 0.00% 35 21 0.00% 36 22 0.00% 37 30 0.00% 38 27 0.00% 39 43 0.00% 40 53 0.00% 41 38 0.00% 42 36 0.00% 43 63 0.00% 44 70 0.00% 45 71 0.00% 46 64 0.00% 47 84 0.00% 48 95 0.00% 49 117 0.00% 50 113 0.00% 51 143 0.00% 52 130 0.00% 53 149 0.00% 54 177 0.00% 55 219 0.00% 56 218 0.00% 57 242 0.00% 58 265 0.00% 59 296 0.00% 60 347 0.00% 61 371 0.00% 62 451 0.00% 63 507 0.00% 64 568 0.00% 65 611 0.00% 66 741 0.00% 67 850 0.00% 68 1100 0.00% 69 1965 0.00% 70 2045 0.00% 71 1507 0.00% 72 1593 0.00% 73 1728 0.00% 74 1912 0.00% 75 2185 0.01% 76 2579 0.01% 77 2745 0.01% 78 3037 0.01% 79 3580 0.01% 80 3881 0.01% 81 4299 0.01% 82 5005 0.01% 83 5816 0.01% 84 7881 0.02% 85 8421 0.02% 86 9742 0.02% 87 10973 0.03% 88 11546 0.03% 89 12592 0.03% 90 14144 0.03% 91 14831 0.03% 92 15555 0.04% 93 17135 0.04% 94 19166 0.04% 95 23084 0.05% 96 23595 0.05% 97 25441 0.06% 98 24879 0.06% 99 26468 0.06% 100 28838 0.07% 101 30167 0.07% 102 32450 0.08% 103 34806 0.08% 104 36942 0.09% 105 39584 0.09% 106 42198 0.10% 107 44505 0.10% 108 47054 0.11% 109 49244 0.11% 110 50963 0.12% 111 53683 0.12% 112 57242 0.13% 113 59219 0.14% 114 62687 0.15% 115 65511 0.15% 116 69121 0.16% 117 73583 0.17% 118 74217 0.17% 119 76688 0.18% 120 78908 0.18% 121 82127 0.19% 122 84875 0.20% 123 87817 0.20% 124 91913 0.21% 125 95025 0.22% 126 99037 0.23% 127 102704 0.24% 128 106545 0.25% 129 110594 0.26% 130 115230 0.27% 131 118852 0.28% 132 122710 0.28% 133 127305 0.29% 134 132035 0.31% 135 137940 0.32% 136 144421 0.33% 137 151802 0.35% 138 160267 0.37% 139 168798 0.39% 140 179282 0.42% 141 194943 0.45% 142 214058 0.50% 143 232360 0.54% 144 268202 0.62% 145 319420 0.74% 146 392673 0.91% 147 564176 1.31% 148 1221984 2.83% 149 6850145 15.86% 150 29078634 67.34% 43181376 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=173.87 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=18.4 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=44 prefix-density=0.14 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=233.76 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=25.9 sequence=GAAGAAGAAGAAA SRR4237600 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:23:48 Started mapping on | Feb 12 15:23:48 Finished on | Feb 12 15:27:23 Mapping speed, Million of reads per hour | 723.04 Number of input reads | 43181376 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 41646474 Uniquely mapped reads % | 96.45% Average mapped length | 293.60 Number of splices: Total | 37500955 Number of splices: Annotated (sjdb) | 36889679 Number of splices: GT/AG | 36953833 Number of splices: GC/AG | 430605 Number of splices: AT/AC | 30473 Number of splices: Non-canonical | 86044 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 780387 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 64684 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.56% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 785500 785500 785500 N_multimapping 780387 780387 780387 N_noFeature 1179930 41156754 1436387 N_ambiguous 422550 2188 187901 UnstrandedReadsAssigned:40043994 PositiveStrandReadsAssigned:487532 NegativeStrandReadsAssigned:40022186 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237600 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237600-trimmed-pair1.fastq SRR4237600-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,181,376 reads, 39,783,115 reads pseudoaligned [quant] estimated average fragment length: 240.183 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR4237600.ke.tsv 34699 SRR4237600.se.tsv 87100 total ==> SRR4237600.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.82 804 12.7349 Potri.005G024800.1.v4.1 1035 795.817 94 3.32801 Potri.004G059700.1.v4.1 961 721.858 10 0.390317 Potri.007G009000.2.v4.1 1416 1176.82 0 0 Potri.003G141000.2.v4.1 2943 2703.82 842.194 8.77616 Potri.016G087400.1.v4.1 270 80.276 3266.6 1146.51 Potri.015G069301.1.v4.1 564 329.545 0 0 Potri.010G195200.1.v4.1 1773 1533.82 66 1.21238 Potri.012G127500.1.v4.1 977 737.824 13275 506.934 ==> SRR4237600.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4051 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 539 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR4237600 completed mapping pipeline successfully