Starting /dee2/code/volunteer_pipeline.sh SRR4237601 current disk space = 3051774205952 free memory = 1577910244 SRR4237601 SRAfilesize b9807df9bdbd0965a96436c491ffe15a SRR4237601.sra SRR4237601.sra file validated SRR4237601 is paired end SRR4237601 is conventional basespace SRR4237601 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237601_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3705 34.0 33.0 34.0 33.0 34.0 2 33.36025 34.0 33.0 34.0 33.0 34.0 3 33.41125 34.0 33.0 34.0 33.0 34.0 4 33.37075 34.0 34.0 34.0 33.0 34.0 5 33.3875 34.0 33.0 34.0 33.0 34.0 6 35.207 38.0 37.0 38.0 31.0 38.0 7 36.72375 38.0 38.0 38.0 33.0 38.0 8 37.0395 38.0 38.0 38.0 36.0 38.0 9 37.381 38.0 38.0 38.0 37.0 38.0 10-14 37.40405 38.0 38.0 38.0 37.0 38.0 15-19 37.482350000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.43275 38.0 38.0 38.0 37.2 38.0 25-29 37.4524 38.0 38.0 38.0 37.2 38.0 30-34 37.4804 38.0 38.0 38.0 37.6 38.0 35-39 37.25465 38.0 38.0 38.0 36.8 38.0 40-44 37.35045 38.0 38.0 38.0 37.0 38.0 45-49 36.92585 38.0 38.0 38.0 35.4 38.0 50-54 37.27825 38.0 38.0 38.0 37.0 38.0 55-59 37.19565 38.0 38.0 38.0 36.4 38.0 60-64 37.2104 38.0 38.0 38.0 36.4 38.0 65-69 37.16674999999999 38.0 38.0 38.0 36.6 38.0 70-74 37.2063 38.0 38.0 38.0 36.4 38.0 75-79 37.10405 38.0 38.0 38.0 36.0 38.0 80-84 37.11755 38.0 38.0 38.0 36.0 38.0 85-89 37.0443 38.0 38.0 38.0 36.0 38.0 90-94 36.883849999999995 38.0 38.0 38.0 35.6 38.0 95-99 36.89945 38.0 38.0 38.0 36.0 38.0 100-104 36.63095 38.0 38.0 38.0 34.8 38.0 105-109 36.783 38.0 38.0 38.0 35.0 38.0 110-114 35.823699999999995 38.0 37.0 38.0 30.4 38.0 115-119 36.511199999999995 38.0 38.0 38.0 34.2 38.0 120-124 36.6346 38.0 38.0 38.0 34.8 38.0 125-129 36.38035 38.0 38.0 38.0 34.0 38.0 130-134 36.48270000000001 38.0 38.0 38.0 34.0 38.0 135-139 36.005250000000004 38.0 37.4 38.0 33.0 38.0 140-144 36.068349999999995 38.0 38.0 38.0 33.4 38.0 145-149 35.705349999999996 38.0 37.8 38.0 33.0 38.0 150 31.21 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 3.0 23 2.0 24 10.0 25 11.0 26 10.0 27 17.0 28 24.0 29 24.0 30 22.0 31 46.0 32 63.0 33 71.0 34 111.0 35 225.0 36 452.0 37 2899.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.536634158539634 12.07801950487622 8.077019254813704 33.30832708177044 2 22.275 14.524999999999999 34.775 28.425 3 20.349999999999998 20.349999999999998 26.25 33.050000000000004 4 22.975 29.075 22.45 25.5 5 23.549999999999997 32.875 23.35 20.225 6 17.840252233315816 36.25853914871256 25.249605885444037 20.65160273252759 7 13.825000000000001 26.525 41.65 18.0 8 16.7 25.15 31.5 26.650000000000002 9 17.275 24.65 33.425 24.65 10-14 19.855 30.709999999999997 27.465 21.97 15-19 19.265 29.84 27.400000000000002 23.494999999999997 20-24 19.265 29.835 27.88 23.02 25-29 19.015 29.935000000000002 27.37 23.68 30-34 19.155 29.955 27.584999999999997 23.305 35-39 19.89 29.65 26.810000000000002 23.65 40-44 19.615 29.854999999999997 27.250000000000004 23.28 45-49 20.005 30.009999999999998 27.229999999999997 22.755 50-54 20.235 29.615000000000002 26.935 23.215 55-59 20.225 29.080000000000002 27.155 23.54 60-64 19.64 29.56 27.279999999999998 23.52 65-69 19.805 29.635 27.015 23.544999999999998 70-74 19.475 29.67 27.584999999999997 23.27 75-79 20.015 29.57 26.905 23.51 80-84 19.685 28.799999999999997 27.625 23.89 85-89 19.439999999999998 29.520000000000003 27.015 24.025 90-94 19.68 29.799999999999997 26.93 23.59 95-99 19.355 29.12 27.43 24.095 100-104 20.3 29.49 26.605 23.605 105-109 20.135 29.189999999999998 26.91 23.765 110-114 19.950000000000003 29.425 26.685 23.94 115-119 20.7 29.07 26.784999999999997 23.445 120-124 19.7 29.15 26.52 24.63 125-129 20.835 28.754999999999995 26.495 23.915 130-134 20.555 28.660000000000004 27.224999999999998 23.56 135-139 20.474999999999998 27.944999999999997 27.01 24.57 140-144 20.305 28.645 26.935 24.115000000000002 145-149 20.380000000000003 28.775000000000002 26.405 24.44 150 20.45 28.15 27.500000000000004 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 2.5 24 3.0 25 3.5 26 7.5 27 11.0 28 14.0 29 19.0 30 23.0 31 35.5 32 45.5 33 57.5 34 77.0 35 85.0 36 100.5 37 121.5 38 153.0 39 167.5 40 187.0 41 222.5 42 235.0 43 264.0 44 279.5 45 262.5 46 227.5 47 215.5 48 225.5 49 192.0 50 154.0 51 140.5 52 116.5 53 90.5 54 71.0 55 46.0 56 31.0 57 25.0 58 23.0 59 19.0 60 10.0 61 7.5 62 5.0 63 5.0 64 5.0 65 2.0 66 1.0 67 2.0 68 1.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 4.8500000000000005 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.8375000000000004 0.0 0.0 0.0 0.0 116-117 3.1500000000000004 0.0 0.0 0.0 0.0 118-119 3.6 0.0 0.0 0.0 0.0 120-121 4.112500000000001 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.5875 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.512499999999999 0.0 0.0 0.0 0.0 132-133 7.0625 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138 8.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 50 6.0599858E-5 20.097 65-69 >>END_MODULE SRR4237601 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237601_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7865 33.0 33.0 34.0 32.0 34.0 2 32.865 34.0 33.0 34.0 32.0 34.0 3 32.864 34.0 33.0 34.0 32.0 34.0 4 32.87025 34.0 33.0 34.0 32.0 34.0 5 32.87075 34.0 33.0 34.0 32.0 34.0 6 36.94875 38.0 38.0 38.0 36.0 38.0 7 37.0275 38.0 38.0 38.0 37.0 38.0 8 36.97025 38.0 38.0 38.0 37.0 38.0 9 36.94475 38.0 38.0 38.0 36.0 38.0 10-14 36.93705 38.0 38.0 38.0 36.4 38.0 15-19 36.95495 38.0 38.0 38.0 36.6 38.0 20-24 36.90755 38.0 38.0 38.0 36.6 38.0 25-29 36.84705 38.0 38.0 38.0 36.0 38.0 30-34 36.8035 38.0 38.0 38.0 36.0 38.0 35-39 36.80650000000001 38.0 38.0 38.0 36.4 38.0 40-44 36.8168 38.0 38.0 38.0 36.2 38.0 45-49 36.8294 38.0 38.0 38.0 36.2 38.0 50-54 36.7957 38.0 38.0 38.0 36.4 38.0 55-59 36.63215 38.0 38.0 38.0 36.0 38.0 60-64 36.719049999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.65205 38.0 38.0 38.0 36.0 38.0 70-74 36.6398 38.0 38.0 38.0 36.0 38.0 75-79 36.64875 38.0 38.0 38.0 36.0 38.0 80-84 36.486599999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.4215 38.0 38.0 38.0 35.0 38.0 90-94 36.382999999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.27815 38.0 38.0 38.0 34.4 38.0 100-104 36.278000000000006 38.0 38.0 38.0 34.4 38.0 105-109 36.12235 38.0 38.0 38.0 34.0 38.0 110-114 36.15555 38.0 38.0 38.0 34.0 38.0 115-119 36.00285 38.0 38.0 38.0 34.0 38.0 120-124 35.95530000000001 38.0 38.0 38.0 33.8 38.0 125-129 35.8644 38.0 38.0 38.0 33.8 38.0 130-134 35.70399999999999 38.0 38.0 38.0 33.0 38.0 135-139 35.570899999999995 38.0 38.0 38.0 32.4 38.0 140-144 35.22935 38.0 37.6 38.0 31.0 38.0 145-149 34.79195 38.0 36.2 38.0 30.4 38.0 150 29.78775 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 11.0 4 6.0 5 2.0 6 3.0 7 3.0 8 3.0 9 0.0 10 1.0 11 3.0 12 4.0 13 2.0 14 4.0 15 2.0 16 2.0 17 1.0 18 6.0 19 6.0 20 6.0 21 10.0 22 10.0 23 8.0 24 9.0 25 11.0 26 15.0 27 17.0 28 25.0 29 34.0 30 28.0 31 57.0 32 59.0 33 84.0 34 103.0 35 153.0 36 312.0 37 2989.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.25 22.2 12.0 21.55 2 28.625 25.674999999999997 30.2 15.5 3 21.525 28.025 31.125000000000004 19.325 4 24.375 34.699999999999996 23.400000000000002 17.525 5 26.075 37.775 21.099999999999998 15.049999999999999 6 19.725 38.45 24.3 17.525 7 20.275000000000002 20.974999999999998 39.825 18.925 8 22.475 24.725 28.299999999999997 24.5 9 21.925 26.05 29.7 22.325 10-14 24.18 28.935 26.215 20.669999999999998 15-19 23.655 27.58 28.625 20.14 20-24 23.87 28.52 27.47 20.14 25-29 23.965 27.935 27.839999999999996 20.26 30-34 23.52 27.98 27.800000000000004 20.7 35-39 23.655 28.565 27.815 19.965 40-44 23.52 27.79 28.92 19.77 45-49 23.56 28.24 27.905 20.294999999999998 50-54 23.82 27.42 28.4 20.36 55-59 24.165 26.76 28.925 20.150000000000002 60-64 23.615 27.775 28.155 20.455000000000002 65-69 23.775 27.22 28.945 20.06 70-74 23.835 27.435 28.665000000000003 20.064999999999998 75-79 23.585 27.384999999999998 29.360000000000003 19.67 80-84 23.575 27.779999999999998 28.235 20.41 85-89 23.66 27.33 29.035 19.975 90-94 23.49 28.1 28.265 20.145 95-99 23.84 27.915 28.355000000000004 19.89 100-104 24.12 27.42 28.98 19.48 105-109 23.919999999999998 27.785 28.349999999999998 19.945 110-114 23.555 28.38 28.48 19.585 115-119 24.185000000000002 27.62 28.12 20.075000000000003 120-124 24.145 28.384999999999998 27.355 20.115 125-129 24.495 27.595 28.475 19.435 130-134 25.105 27.83 27.365000000000002 19.7 135-139 24.855 28.144999999999996 27.515 19.485 140-144 24.6 28.04 27.77 19.59 145-149 25.629999999999995 28.060000000000002 27.395000000000003 18.915000000000003 150 26.125 26.924999999999997 27.375 19.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 1.5 21 1.0 22 1.5 23 3.0 24 3.5 25 5.0 26 3.0 27 3.0 28 9.0 29 12.5 30 17.0 31 20.0 32 28.5 33 37.0 34 41.5 35 67.0 36 92.5 37 106.0 38 142.0 39 182.0 40 193.5 41 227.0 42 263.5 43 270.5 44 291.0 45 287.0 46 257.0 47 242.5 48 218.5 49 178.5 50 150.0 51 135.5 52 124.0 53 97.0 54 70.0 55 57.5 56 42.0 57 30.5 58 27.5 59 19.5 60 9.5 61 5.5 62 5.5 63 7.0 64 3.0 65 0.0 66 1.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.5 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.3875 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.275 0.0 0.0 0.0 0.0 132-133 6.8375 0.0 0.0 0.0 0.0 134-135 7.2625 0.0 0.0 0.0 0.0 136-137 7.7375 0.0 0.0 0.0 0.0 138 8.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGATCT 10 0.006973645 144.0 3 >>END_MODULE Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra Read 1896806 spots for SRR4237601.sra Written 1896806 spots for SRR4237601.sra Read 1896791 spots for SRR4237601.sra Written 1896791 spots for SRR4237601.sra SRR ids: ['SRR4237601.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_car5yc_v SRR4237601.sra spots: 37935835 blocks: [[1, 1896791], [1896792, 3793582], [3793583, 5690373], [5690374, 7587164], [7587165, 9483955], [9483956, 11380746], [11380747, 13277537], [13277538, 15174328], [15174329, 17071119], [17071120, 18967910], [18967911, 20864701], [20864702, 22761492], [22761493, 24658283], [24658284, 26555074], [26555075, 28451865], [28451866, 30348656], [30348657, 32245447], [32245448, 34142238], [34142239, 36039029], [36039030, 37935835]] SRR4237601 file size 12759415 SRR4237601 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237601 SRR4237601_1.fastq SRR4237601_2.fastq Input file: SRR4237601_1.fastq Paired file: SRR4237601_2.fastq trimmed: SRR4237601-trimmed-pair1.fastq, SRR4237601-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:21:00 2025 >> started Wed Feb 12 15:21:39 2025 >> done (38.776s) 37935835 read pairs processed; of these: 87329 ( 0.23%) short read pairs filtered out after trimming by size control 52652 ( 0.14%) empty read pairs filtered out after trimming by size control 37795854 (99.63%) read pairs available; of these: 12310175 (32.57%) trimmed read pairs available after processing 25485679 (67.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 12 0.00% 20 8 0.00% 21 8 0.00% 22 11 0.00% 23 10 0.00% 24 14 0.00% 25 5 0.00% 26 17 0.00% 27 19 0.00% 28 10 0.00% 29 18 0.00% 30 21 0.00% 31 17 0.00% 32 17 0.00% 33 23 0.00% 34 28 0.00% 35 30 0.00% 36 34 0.00% 37 29 0.00% 38 49 0.00% 39 32 0.00% 40 64 0.00% 41 43 0.00% 42 67 0.00% 43 72 0.00% 44 76 0.00% 45 81 0.00% 46 113 0.00% 47 113 0.00% 48 138 0.00% 49 158 0.00% 50 157 0.00% 51 166 0.00% 52 185 0.00% 53 245 0.00% 54 304 0.00% 55 295 0.00% 56 324 0.00% 57 352 0.00% 58 382 0.00% 59 463 0.00% 60 559 0.00% 61 616 0.00% 62 712 0.00% 63 797 0.00% 64 874 0.00% 65 1031 0.00% 66 1204 0.00% 67 1457 0.00% 68 1902 0.01% 69 5449 0.01% 70 5373 0.01% 71 2643 0.01% 72 2539 0.01% 73 2889 0.01% 74 3180 0.01% 75 3536 0.01% 76 3994 0.01% 77 4338 0.01% 78 4854 0.01% 79 5511 0.01% 80 6186 0.02% 81 7177 0.02% 82 8104 0.02% 83 9718 0.03% 84 21029 0.06% 85 16943 0.04% 86 18817 0.05% 87 18209 0.05% 88 17894 0.05% 89 18874 0.05% 90 20438 0.05% 91 21651 0.06% 92 23948 0.06% 93 26479 0.07% 94 33002 0.09% 95 32012 0.08% 96 31686 0.08% 97 35371 0.09% 98 35090 0.09% 99 37479 0.10% 100 39425 0.10% 101 41437 0.11% 102 44515 0.12% 103 46869 0.12% 104 50092 0.13% 105 52701 0.14% 106 55658 0.15% 107 57466 0.15% 108 60259 0.16% 109 63411 0.17% 110 65591 0.17% 111 67249 0.18% 112 70841 0.19% 113 73662 0.19% 114 77192 0.20% 115 80228 0.21% 116 83251 0.22% 117 85911 0.23% 118 88618 0.23% 119 90781 0.24% 120 93241 0.25% 121 96512 0.26% 122 98248 0.26% 123 102262 0.27% 124 105296 0.28% 125 108799 0.29% 126 112554 0.30% 127 115557 0.31% 128 119403 0.32% 129 123118 0.33% 130 125941 0.33% 131 126825 0.34% 132 132617 0.35% 133 136466 0.36% 134 139800 0.37% 135 145208 0.38% 136 151220 0.40% 137 157593 0.42% 138 164218 0.43% 139 170623 0.45% 140 178522 0.47% 141 189828 0.50% 142 203346 0.54% 143 219841 0.58% 144 247190 0.65% 145 284937 0.75% 146 348365 0.92% 147 476502 1.26% 148 823219 2.18% 149 5019984 13.28% 150 25485679 67.43% 37795854 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=42 prefix-density=0.14 prefix-fanout=2.0 sequence=CGCATTGGTTTGATCCAAGTGGAACATTTCCATACCTACACCCCCATTAGCATAACAATCCTTTATTAAACCACTAGCTAGACGTGCAAGATTCAACCTACACACAAGAACCCACTAGATAGACTTCCACTGGAACCATGCAGCATTCTCCCGTGATGACCTCATTACTCAGTCTTTTCTACTGGGGTTTCTGTTTCAACCTTCTCCTCTGTTTCAACAGGCTTCTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=159.31 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=15.9 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=7.07 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=4.6 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=277.46 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=29.9 sequence=AAGAAGAAGAAA SRR4237601 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:22:27 Started mapping on | Feb 12 15:22:27 Finished on | Feb 12 15:27:07 Mapping speed, Million of reads per hour | 485.95 Number of input reads | 37795854 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 35428602 Uniquely mapped reads % | 93.74% Average mapped length | 291.44 Number of splices: Total | 29384578 Number of splices: Annotated (sjdb) | 28817665 Number of splices: GT/AG | 28921933 Number of splices: GC/AG | 352997 Number of splices: AT/AC | 29809 Number of splices: Non-canonical | 79839 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 710276 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 88127 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1709215 1709215 1709215 N_multimapping 710276 710276 710276 N_noFeature 1155627 34944835 1415707 N_ambiguous 374735 2619 149394 UnstrandedReadsAssigned:33898240 PositiveStrandReadsAssigned:481148 NegativeStrandReadsAssigned:33863501 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237601 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237601-trimmed-pair1.fastq SRR4237601-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,795,854 reads, 33,767,371 reads pseudoaligned [quant] estimated average fragment length: 225.908 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52401 SRR4237601.ke.tsv 34699 SRR4237601.se.tsv 87100 total ==> SRR4237601.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.09 726 11.9178 Potri.005G024800.1.v4.1 1035 810.092 77 2.79781 Potri.004G059700.1.v4.1 961 736.116 51 2.03932 Potri.007G009000.2.v4.1 1416 1191.09 0 0 Potri.003G141000.2.v4.1 2943 2718.09 552.113 5.97896 Potri.016G087400.1.v4.1 270 86.1465 4868.05 1663.33 Potri.015G069301.1.v4.1 564 342.455 0 0 Potri.010G195200.1.v4.1 1773 1548.09 139 2.6429 Potri.012G127500.1.v4.1 977 752.102 9113 356.654 ==> SRR4237601.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5083 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 718 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237601 completed mapping pipeline successfully