Starting /dee2/code/volunteer_pipeline.sh SRR4237602 current disk space = 3051759661056 free memory = 1489795824 SRR4237602 SRAfilesize 311a0c5e6e4284d892703cfcaea7dde4 SRR4237602.sra SRR4237602.sra file validated SRR4237602 is paired end SRR4237602 is conventional basespace SRR4237602 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237602_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3635 34.0 33.0 34.0 33.0 34.0 2 33.387 34.0 33.0 34.0 33.0 34.0 3 33.44025 34.0 34.0 34.0 33.0 34.0 4 33.43975 34.0 34.0 34.0 33.0 34.0 5 33.42575 34.0 34.0 34.0 33.0 34.0 6 35.757 38.0 37.0 38.0 34.0 38.0 7 37.108 38.0 38.0 38.0 36.0 38.0 8 37.15625 38.0 38.0 38.0 36.0 38.0 9 37.4145 38.0 38.0 38.0 37.0 38.0 10-14 37.47035 38.0 38.0 38.0 37.6 38.0 15-19 37.48185 38.0 38.0 38.0 38.0 38.0 20-24 37.45915 38.0 38.0 38.0 37.6 38.0 25-29 37.49295 38.0 38.0 38.0 38.0 38.0 30-34 36.908550000000005 38.0 38.0 38.0 35.6 38.0 35-39 37.427299999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.37575 38.0 38.0 38.0 37.2 38.0 45-49 37.21085 38.0 38.0 38.0 36.6 38.0 50-54 37.202600000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.2911 38.0 38.0 38.0 37.0 38.0 60-64 37.23855 38.0 38.0 38.0 36.8 38.0 65-69 37.2345 38.0 38.0 38.0 37.0 38.0 70-74 37.21464999999999 38.0 38.0 38.0 36.6 38.0 75-79 37.131049999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.131600000000006 38.0 38.0 38.0 36.0 38.0 85-89 37.057 38.0 38.0 38.0 36.0 38.0 90-94 35.88565 38.0 35.8 38.0 30.4 38.0 95-99 36.72375 38.0 37.8 38.0 34.8 38.0 100-104 36.9078 38.0 38.0 38.0 35.8 38.0 105-109 36.96175 38.0 38.0 38.0 36.0 38.0 110-114 36.8483 38.0 38.0 38.0 35.6 38.0 115-119 36.680600000000005 38.0 38.0 38.0 35.0 38.0 120-124 36.681 38.0 38.0 38.0 34.8 38.0 125-129 36.52655 38.0 38.0 38.0 34.0 38.0 130-134 36.41495 38.0 38.0 38.0 34.0 38.0 135-139 35.1834 38.0 35.6 38.0 28.0 38.0 140-144 36.00855 38.0 37.8 38.0 33.0 38.0 145-149 35.793099999999995 38.0 38.0 38.0 33.0 38.0 150 30.8565 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 2.0 20 0.0 21 1.0 22 3.0 23 5.0 24 7.0 25 6.0 26 13.0 27 17.0 28 22.0 29 30.0 30 37.0 31 43.0 32 49.0 33 76.0 34 106.0 35 196.0 36 445.0 37 2938.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.45 12.75 8.6 32.2 2 24.062031015507753 15.132566283141571 32.94147073536769 27.863931965982992 3 19.2 20.674999999999997 26.674999999999997 33.45 4 22.35 29.9 23.125 24.625 5 23.325000000000003 33.800000000000004 23.7 19.175 6 16.85218741910432 36.31892311674864 25.498317369919754 21.330572094227286 7 14.174999999999999 26.174999999999997 41.675000000000004 17.974999999999998 8 17.8 26.275 30.2 25.724999999999998 9 17.424999999999997 25.75 33.125 23.7 10-14 20.335 29.975 26.765 22.925 15-19 19.99 28.335 27.58 24.095 20-24 20.62 28.395 27.505000000000003 23.48 25-29 20.330000000000002 29.255 27.16 23.255 30-34 19.689999999999998 29.165000000000003 27.66 23.485 35-39 19.470000000000002 29.775000000000002 26.884999999999998 23.87 40-44 20.215 28.904999999999998 27.16 23.72 45-49 19.46 29.34 27.11 24.09 50-54 20.165 29.220000000000002 27.150000000000002 23.465 55-59 19.85 29.145 26.995 24.01 60-64 20.495 27.900000000000002 27.875 23.73 65-69 19.72 28.68 27.54 24.060000000000002 70-74 20.135 28.915000000000003 27.29 23.66 75-79 19.885 28.77 27.38 23.965 80-84 20.09 28.74 27.800000000000004 23.369999999999997 85-89 20.645 28.735 27.72 22.900000000000002 90-94 19.759999999999998 29.03 27.605 23.605 95-99 20.23 28.155 27.485 24.13 100-104 20.65 28.360000000000003 27.334999999999997 23.655 105-109 20.674999999999997 28.665000000000003 27.345000000000002 23.315 110-114 20.31 28.565 27.38 23.745 115-119 20.47 28.565 27.54 23.425 120-124 20.845 28.225 27.605 23.325000000000003 125-129 20.735 28.595 27.389999999999997 23.28 130-134 20.985 28.83 26.784999999999997 23.400000000000002 135-139 20.244999999999997 28.405 27.224999999999998 24.125 140-144 20.285 28.52 27.295 23.9 145-149 21.135 28.720000000000002 27.18 22.965 150 20.272314674735252 27.40796772566818 27.00453857791225 25.315179021684315 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 2.0 26 4.0 27 5.5 28 7.5 29 16.0 30 27.5 31 27.5 32 25.0 33 43.5 34 58.5 35 68.0 36 87.0 37 102.0 38 121.0 39 155.5 40 187.5 41 211.5 42 242.5 43 257.0 44 266.5 45 290.0 46 286.5 47 272.5 48 250.0 49 206.5 50 166.5 51 138.5 52 127.0 53 97.5 54 63.5 55 44.0 56 35.0 57 30.5 58 20.0 59 13.5 60 7.5 61 6.0 62 7.0 63 5.5 64 3.0 65 1.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 3.4250000000000003 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8500000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.3625 0.0 0.0 0.0 0.0 134-135 4.5875 0.0 0.0 0.0 0.0 136-137 5.0 0.0 0.0 0.0 0.0 138 5.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCCTA 10 0.0069954093 143.85 8 >>END_MODULE SRR4237602 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237602_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52475 33.0 33.0 34.0 32.0 34.0 2 31.02975 33.0 32.0 34.0 18.0 34.0 3 32.35525 33.0 33.0 34.0 30.0 34.0 4 32.57075 33.0 33.0 34.0 32.0 34.0 5 32.7105 34.0 33.0 34.0 32.0 34.0 6 36.8735 38.0 38.0 38.0 36.0 38.0 7 36.97275 38.0 38.0 38.0 36.0 38.0 8 36.964 38.0 38.0 38.0 36.0 38.0 9 36.94125 38.0 38.0 38.0 37.0 38.0 10-14 36.8963 38.0 38.0 38.0 36.6 38.0 15-19 36.91015 38.0 38.0 38.0 37.0 38.0 20-24 36.872550000000004 38.0 38.0 38.0 36.6 38.0 25-29 36.872699999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.8528 38.0 38.0 38.0 36.6 38.0 35-39 36.807900000000004 38.0 38.0 38.0 36.6 38.0 40-44 36.7568 38.0 38.0 38.0 36.2 38.0 45-49 36.80415000000001 38.0 38.0 38.0 36.6 38.0 50-54 36.68320000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.72915 38.0 38.0 38.0 36.0 38.0 60-64 36.68155 38.0 38.0 38.0 36.0 38.0 65-69 36.5573 38.0 38.0 38.0 36.0 38.0 70-74 36.38835 38.0 37.8 38.0 34.6 38.0 75-79 36.47295 38.0 38.0 38.0 35.2 38.0 80-84 36.34495 38.0 38.0 38.0 34.8 38.0 85-89 35.29025 38.0 36.8 38.0 27.4 38.0 90-94 35.71945 38.0 37.6 38.0 31.0 38.0 95-99 36.166 38.0 38.0 38.0 34.4 38.0 100-104 36.20665 38.0 38.0 38.0 34.4 38.0 105-109 36.1268 38.0 38.0 38.0 34.0 38.0 110-114 36.1317 38.0 38.0 38.0 34.2 38.0 115-119 36.02825 38.0 38.0 38.0 34.0 38.0 120-124 36.022999999999996 38.0 38.0 38.0 34.0 38.0 125-129 35.692699999999995 38.0 38.0 38.0 33.2 38.0 130-134 35.6049 38.0 38.0 38.0 32.8 38.0 135-139 35.40429999999999 38.0 38.0 38.0 31.8 38.0 140-144 35.091899999999995 38.0 37.6 38.0 31.0 38.0 145-149 34.7011 38.0 37.2 38.0 31.0 38.0 150 28.22625 33.0 25.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 8.0 4 4.0 5 1.0 6 5.0 7 2.0 8 4.0 9 6.0 10 0.0 11 4.0 12 2.0 13 0.0 14 2.0 15 2.0 16 3.0 17 4.0 18 5.0 19 8.0 20 9.0 21 7.0 22 8.0 23 15.0 24 13.0 25 18.0 26 10.0 27 20.0 28 31.0 29 37.0 30 37.0 31 40.0 32 55.0 33 85.0 34 99.0 35 148.0 36 375.0 37 2916.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.824999999999996 21.65 11.1 21.425 2 27.700000000000003 24.3 31.85 16.150000000000002 3 21.325 27.975 32.225 18.475 4 25.75 34.050000000000004 23.275000000000002 16.925 5 24.95 37.55 22.2 15.299999999999999 6 21.275 37.0 24.8 16.925 7 21.175 20.5 39.625 18.7 8 20.525 24.099999999999998 30.5 24.875 9 21.7 23.925 31.225 23.150000000000002 10-14 23.0 28.185 27.634999999999998 21.18 15-19 23.52 27.655 28.199999999999996 20.625 20-24 23.580000000000002 27.650000000000002 28.194999999999997 20.575 25-29 23.225 28.23 27.915 20.630000000000003 30-34 23.455000000000002 28.035 27.794999999999998 20.715 35-39 22.66 28.144999999999996 28.139999999999997 21.055 40-44 23.01 27.889999999999997 28.194999999999997 20.905 45-49 23.575 27.279999999999998 28.494999999999997 20.65 50-54 22.689999999999998 28.02 28.38 20.91 55-59 23.31 27.925 28.435 20.330000000000002 60-64 23.325000000000003 27.37 28.660000000000004 20.645 65-69 23.185 28.015 28.23 20.57 70-74 23.119999999999997 27.295 28.79 20.794999999999998 75-79 23.125 27.950000000000003 28.439999999999998 20.485 80-84 23.155 27.68 28.455000000000002 20.71 85-89 23.47 27.605 28.59 20.335 90-94 23.330000000000002 27.26 28.544999999999998 20.865000000000002 95-99 23.275000000000002 27.91 27.955000000000002 20.86 100-104 23.715 27.865000000000002 28.189999999999998 20.23 105-109 23.794999999999998 26.674999999999997 28.98 20.549999999999997 110-114 23.974999999999998 26.790000000000003 28.660000000000004 20.575 115-119 24.14 28.1 27.279999999999998 20.48 120-124 23.995 27.705000000000002 27.58 20.72 125-129 23.84 27.82 28.125 20.215 130-134 24.099999999999998 27.58 27.925 20.395 135-139 24.585 27.045 28.249999999999996 20.119999999999997 140-144 24.775 27.32 27.884999999999998 20.02 145-149 24.94 27.810000000000002 27.985 19.265 150 24.25 27.0 29.049999999999997 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 0.5 21 1.5 22 1.5 23 3.5 24 3.5 25 3.0 26 4.0 27 4.0 28 9.0 29 10.0 30 10.5 31 20.5 32 33.0 33 42.5 34 53.5 35 66.0 36 83.5 37 100.5 38 125.5 39 165.0 40 202.5 41 229.5 42 241.5 43 267.5 44 279.5 45 272.5 46 277.5 47 273.5 48 244.0 49 200.5 50 166.0 51 142.0 52 121.0 53 91.0 54 60.5 55 41.0 56 34.0 57 33.5 58 25.5 59 14.5 60 9.0 61 7.5 62 6.0 63 3.0 64 2.5 65 2.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.6000000000000001 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.6749999999999998 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.9000000000000004 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 4.2375 0.0 0.0 0.0 0.0 134-135 4.4625 0.0 0.0 0.0 0.0 136-137 4.9 0.0 0.0 0.0 0.0 138 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra Read 2556865 spots for SRR4237602.sra Written 2556865 spots for SRR4237602.sra SRR ids: ['SRR4237602.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wj8_33wt SRR4237602.sra spots: 51137300 blocks: [[1, 2556865], [2556866, 5113730], [5113731, 7670595], [7670596, 10227460], [10227461, 12784325], [12784326, 15341190], [15341191, 17898055], [17898056, 20454920], [20454921, 23011785], [23011786, 25568650], [25568651, 28125515], [28125516, 30682380], [30682381, 33239245], [33239246, 35796110], [35796111, 38352975], [38352976, 40909840], [40909841, 43466705], [43466706, 46023570], [46023571, 48580435], [48580436, 51137300]] SRR4237602 file size 17207175 SRR4237602 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237602 SRR4237602_1.fastq SRR4237602_2.fastq Input file: SRR4237602_1.fastq Paired file: SRR4237602_2.fastq trimmed: SRR4237602-trimmed-pair1.fastq, SRR4237602-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:59:32 2025 >> started Wed Feb 12 15:00:30 2025 >> done (58.001s) 51137300 read pairs processed; of these: 105736 ( 0.21%) short read pairs filtered out after trimming by size control 47291 ( 0.09%) empty read pairs filtered out after trimming by size control 50984273 (99.70%) read pairs available; of these: 15845097 (31.08%) trimmed read pairs available after processing 35139176 (68.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 11 0.00% 20 8 0.00% 21 10 0.00% 22 12 0.00% 23 12 0.00% 24 14 0.00% 25 15 0.00% 26 19 0.00% 27 20 0.00% 28 21 0.00% 29 18 0.00% 30 30 0.00% 31 24 0.00% 32 28 0.00% 33 25 0.00% 34 28 0.00% 35 35 0.00% 36 24 0.00% 37 37 0.00% 38 29 0.00% 39 44 0.00% 40 50 0.00% 41 56 0.00% 42 65 0.00% 43 56 0.00% 44 53 0.00% 45 82 0.00% 46 76 0.00% 47 85 0.00% 48 120 0.00% 49 146 0.00% 50 146 0.00% 51 143 0.00% 52 172 0.00% 53 179 0.00% 54 221 0.00% 55 216 0.00% 56 273 0.00% 57 319 0.00% 58 303 0.00% 59 352 0.00% 60 479 0.00% 61 461 0.00% 62 544 0.00% 63 602 0.00% 64 651 0.00% 65 747 0.00% 66 963 0.00% 67 1025 0.00% 68 1469 0.00% 69 4095 0.01% 70 3673 0.01% 71 2206 0.00% 72 1983 0.00% 73 2210 0.00% 74 2375 0.00% 75 2638 0.01% 76 2935 0.01% 77 3177 0.01% 78 3669 0.01% 79 4051 0.01% 80 4713 0.01% 81 5369 0.01% 82 6225 0.01% 83 7901 0.02% 84 21007 0.04% 85 17270 0.03% 86 14490 0.03% 87 15166 0.03% 88 18368 0.04% 89 18450 0.04% 90 17858 0.04% 91 24719 0.05% 92 20625 0.04% 93 22607 0.04% 94 25828 0.05% 95 26245 0.05% 96 28008 0.05% 97 28856 0.06% 98 30319 0.06% 99 32293 0.06% 100 34036 0.07% 101 36584 0.07% 102 39352 0.08% 103 41985 0.08% 104 44765 0.09% 105 47232 0.09% 106 50523 0.10% 107 52908 0.10% 108 55805 0.11% 109 57513 0.11% 110 60493 0.12% 111 63623 0.12% 112 67346 0.13% 113 69434 0.14% 114 74296 0.15% 115 77182 0.15% 116 80103 0.16% 117 83447 0.16% 118 86482 0.17% 119 89146 0.17% 120 94151 0.18% 121 94762 0.19% 122 98689 0.19% 123 104038 0.20% 124 108508 0.21% 125 110799 0.22% 126 115058 0.23% 127 118430 0.23% 128 123631 0.24% 129 126909 0.25% 130 129500 0.25% 131 134287 0.26% 132 140250 0.28% 133 145169 0.28% 134 150453 0.30% 135 158474 0.31% 136 164744 0.32% 137 171989 0.34% 138 181857 0.36% 139 190020 0.37% 140 201207 0.39% 141 216808 0.43% 142 233252 0.46% 143 255196 0.50% 144 291344 0.57% 145 344208 0.68% 146 432731 0.85% 147 586079 1.15% 148 1072261 2.10% 149 7908182 15.51% 150 35139176 68.92% 50984273 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=35 prefix-density=0.17 prefix-fanout=2.3 sequence=GGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=170.32 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=6.0 sequence=AAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.0 sequence=TGCATTTCGATT criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=272.59 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=30.3 sequence=AAGAAGAAGAAA SRR4237602 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:01:23 Started mapping on | Feb 12 15:01:23 Finished on | Feb 12 15:06:10 Mapping speed, Million of reads per hour | 639.52 Number of input reads | 50984273 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 49098270 Uniquely mapped reads % | 96.30% Average mapped length | 293.51 Number of splices: Total | 44965362 Number of splices: Annotated (sjdb) | 44229039 Number of splices: GT/AG | 44308873 Number of splices: GC/AG | 519243 Number of splices: AT/AC | 38187 Number of splices: Non-canonical | 99059 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 905277 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 57670 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.78% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1052798 1052798 1052798 N_multimapping 905277 905277 905277 N_noFeature 1299396 48525068 1627719 N_ambiguous 468489 3530 220880 UnstrandedReadsAssigned:47330385 PositiveStrandReadsAssigned:569672 NegativeStrandReadsAssigned:47249671 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237602 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237602-trimmed-pair1.fastq SRR4237602-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 50,984,273 reads, 46,961,058 reads pseudoaligned [quant] estimated average fragment length: 242.531 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR4237602.ke.tsv 34699 SRR4237602.se.tsv 87100 total ==> SRR4237602.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.47 1022 13.8796 Potri.005G024800.1.v4.1 1035 793.469 79 2.40205 Potri.004G059700.1.v4.1 961 719.527 12 0.402363 Potri.007G009000.2.v4.1 1416 1174.47 0 0 Potri.003G141000.2.v4.1 2943 2701.47 866.369 7.73726 Potri.016G087400.1.v4.1 270 80.5589 3569.07 1068.87 Potri.015G069301.1.v4.1 564 328.123 0 0 Potri.010G195200.1.v4.1 1773 1531.47 73 1.15 Potri.012G127500.1.v4.1 977 735.498 11077 363.35 ==> SRR4237602.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 4807 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 500 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237602 completed mapping pipeline successfully