Starting /dee2/code/volunteer_pipeline.sh SRR4237603 current disk space = 3051695644672 free memory = 1577897080 SRR4237603 SRAfilesize 1ff4cadd50f067ad0135413a48e383e9 SRR4237603.sra SRR4237603.sra file validated SRR4237603 is paired end SRR4237603 is conventional basespace SRR4237603 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237603_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5405 34.0 33.0 34.0 18.0 34.0 2 32.902 34.0 33.0 34.0 28.0 34.0 3 33.0815 34.0 33.0 34.0 32.0 34.0 4 33.3335 34.0 33.0 34.0 32.0 34.0 5 33.29175 34.0 33.0 34.0 33.0 34.0 6 37.098 38.0 37.0 38.0 36.0 38.0 7 37.39025 38.0 38.0 38.0 37.0 38.0 8 37.50875 38.0 38.0 38.0 37.0 38.0 9 37.587 38.0 38.0 38.0 38.0 38.0 10-14 37.455650000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.1372 38.0 38.0 38.0 36.0 38.0 20-24 37.46895 38.0 38.0 38.0 37.4 38.0 25-29 37.44535 38.0 38.0 38.0 37.2 38.0 30-34 37.10845 38.0 38.0 38.0 35.8 38.0 35-39 37.4512 38.0 38.0 38.0 37.0 38.0 40-44 37.37575 38.0 38.0 38.0 37.0 38.0 45-49 37.291549999999994 38.0 38.0 38.0 36.8 38.0 50-54 37.1827 38.0 38.0 38.0 36.2 38.0 55-59 36.854 38.0 38.0 38.0 35.2 38.0 60-64 37.16215 38.0 38.0 38.0 36.2 38.0 65-69 37.10095 38.0 38.0 38.0 36.0 38.0 70-74 37.03745 38.0 38.0 38.0 36.0 38.0 75-79 36.98715 38.0 38.0 38.0 36.0 38.0 80-84 35.7432 38.0 36.0 38.0 30.0 38.0 85-89 36.7194 38.0 37.8 38.0 34.8 38.0 90-94 36.861599999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.73395000000001 38.0 38.0 38.0 34.8 38.0 100-104 36.6499 38.0 38.0 38.0 34.6 38.0 105-109 36.565749999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.56805 38.0 38.0 38.0 34.2 38.0 115-119 36.4125 38.0 38.0 38.0 34.0 38.0 120-124 36.437599999999996 38.0 38.0 38.0 34.0 38.0 125-129 36.213499999999996 38.0 37.4 38.0 34.0 38.0 130-134 35.97055 38.0 36.8 38.0 32.6 38.0 135-139 35.7639 38.0 36.2 38.0 32.2 38.0 140-144 35.67895 38.0 36.4 38.0 32.2 38.0 145-149 35.10745 38.0 36.0 38.0 31.0 38.0 150 30.326 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 3.0 20 2.0 21 3.0 22 1.0 23 4.0 24 5.0 25 7.0 26 4.0 27 18.0 28 24.0 29 32.0 30 32.0 31 37.0 32 71.0 33 92.0 34 143.0 35 218.0 36 629.0 37 2667.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.374037403740374 10.891089108910892 8.800880088008801 39.93399339933993 2 22.75 15.9 35.825 25.525 3 20.825 21.349999999999998 25.074999999999996 32.75 4 23.849999999999998 30.525000000000002 21.5 24.125 5 23.51175587793897 33.516758379189596 23.81190595297649 19.15957978989495 6 18.525 36.925000000000004 24.4 20.150000000000002 7 13.625000000000002 25.724999999999998 43.4 17.25 8 17.2 24.125 32.775 25.900000000000002 9 16.400000000000002 24.95 33.475 25.174999999999997 10-14 19.509999999999998 30.25 26.91 23.330000000000002 15-19 19.81 28.74 27.72 23.73 20-24 19.23 29.345 27.345000000000002 24.08 25-29 19.525000000000002 29.665000000000003 27.48 23.330000000000002 30-34 19.485 29.299999999999997 27.515 23.7 35-39 20.185 29.315 26.915 23.585 40-44 19.72 29.575000000000003 26.845000000000002 23.86 45-49 20.145 29.375 27.025 23.455000000000002 50-54 19.86 29.705 27.465 22.97 55-59 19.91 29.34 27.16 23.59 60-64 19.325 29.005 27.439999999999998 24.23 65-69 19.925 29.805 26.915 23.355 70-74 20.005 28.93 27.275 23.79 75-79 20.14 28.744999999999997 27.224999999999998 23.89 80-84 19.865 29.07 26.979999999999997 24.085 85-89 20.11 29.060000000000002 27.33 23.5 90-94 20.19 28.375 27.515 23.919999999999998 95-99 20.005 28.665000000000003 27.61 23.72 100-104 19.925 28.765 27.555000000000003 23.755000000000003 105-109 20.69 28.7 27.63 22.98 110-114 20.29 28.48 27.145000000000003 24.085 115-119 20.385 28.625 27.05 23.94 120-124 20.395 27.96 27.834999999999997 23.810000000000002 125-129 20.36 28.860000000000003 27.16 23.62 130-134 20.674999999999997 28.444999999999997 27.060000000000002 23.82 135-139 20.595 28.515 27.07 23.82 140-144 21.33 28.76 25.95 23.96 145-149 21.310000000000002 28.910000000000004 25.869999999999997 23.91 150 21.05793450881612 28.085642317380355 26.42317380352645 24.43324937027708 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 5.0 24 7.5 25 5.5 26 7.0 27 9.0 28 12.0 29 16.5 30 24.0 31 33.5 32 37.5 33 52.0 34 63.0 35 80.0 36 104.0 37 106.0 38 120.5 39 159.0 40 190.5 41 223.5 42 251.0 43 254.5 44 265.5 45 268.0 46 269.5 47 254.5 48 210.5 49 178.5 50 163.5 51 141.5 52 112.0 53 87.0 54 68.0 55 57.0 56 39.0 57 23.0 58 19.0 59 20.0 60 16.5 61 11.0 62 7.5 63 7.5 64 6.0 65 2.5 66 1.0 67 1.5 68 1.5 69 1.5 70 2.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.1 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9500000000000002 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.6625 0.0 0.0 0.0 0.0 120-121 4.3125 0.0 0.0 0.0 0.0 122-123 4.8125 0.0 0.0 0.0 0.0 124-125 5.324999999999999 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.275 0.0 0.0 0.0 0.0 130-131 7.0625 0.0 0.0 0.0 0.0 132-133 7.775 0.0 0.0 0.0 0.0 134-135 8.5625 0.0 0.0 0.0 0.0 136-137 9.375 0.0 0.0 0.0 0.0 138 9.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATATTC 10 0.0069845165 143.925 5 ATATTCA 10 0.0069845165 143.925 6 TCATATT 10 0.0069845165 143.925 4 >>END_MODULE SRR4237603 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237603_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7465 33.0 33.0 34.0 32.0 34.0 2 33.00275 34.0 33.0 34.0 32.0 34.0 3 33.04675 34.0 33.0 34.0 32.0 34.0 4 32.928 34.0 33.0 34.0 32.0 34.0 5 32.98075 34.0 33.0 34.0 32.0 34.0 6 37.268 38.0 38.0 38.0 37.0 38.0 7 37.30425 38.0 38.0 38.0 37.0 38.0 8 37.334 38.0 38.0 38.0 37.0 38.0 9 37.27725 38.0 38.0 38.0 37.0 38.0 10-14 37.3368 38.0 38.0 38.0 37.0 38.0 15-19 37.2506 38.0 38.0 38.0 37.0 38.0 20-24 37.1993 38.0 38.0 38.0 37.0 38.0 25-29 37.2734 38.0 38.0 38.0 37.0 38.0 30-34 37.19945 38.0 38.0 38.0 37.0 38.0 35-39 37.143600000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.21125 38.0 38.0 38.0 37.0 38.0 45-49 37.16065 38.0 38.0 38.0 37.0 38.0 50-54 37.20805 38.0 38.0 38.0 37.0 38.0 55-59 37.14809999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.12949999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.0346 38.0 38.0 38.0 36.6 38.0 70-74 36.98785 38.0 38.0 38.0 36.6 38.0 75-79 36.98245 38.0 38.0 38.0 36.4 38.0 80-84 36.91325 38.0 38.0 38.0 36.0 38.0 85-89 36.8796 38.0 38.0 38.0 36.0 38.0 90-94 36.88935 38.0 38.0 38.0 36.0 38.0 95-99 36.791799999999995 38.0 38.0 38.0 35.4 38.0 100-104 36.7553 38.0 38.0 38.0 35.4 38.0 105-109 36.6774 38.0 38.0 38.0 34.8 38.0 110-114 36.5903 38.0 38.0 38.0 34.6 38.0 115-119 36.51215 38.0 38.0 38.0 34.2 38.0 120-124 36.42385 38.0 38.0 38.0 34.0 38.0 125-129 36.2451 38.0 38.0 38.0 33.8 38.0 130-134 35.992900000000006 38.0 38.0 38.0 33.2 38.0 135-139 35.9442 38.0 38.0 38.0 33.4 38.0 140-144 34.1228 37.2 32.8 38.0 28.6 38.0 145-149 33.673950000000005 37.4 33.6 38.0 25.8 38.0 150 29.51725 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 2.0 6 0.0 7 1.0 8 2.0 9 1.0 10 1.0 11 3.0 12 0.0 13 1.0 14 2.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 5.0 21 5.0 22 4.0 23 10.0 24 11.0 25 15.0 26 18.0 27 19.0 28 18.0 29 24.0 30 27.0 31 53.0 32 54.0 33 79.0 34 104.0 35 194.0 36 421.0 37 2916.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.613990941117265 18.79718168092602 13.261197785606441 27.327629592350277 2 27.763881940970485 23.261630815407706 32.89144572286143 16.08304152076038 3 20.930232558139537 27.00675168792198 32.808202050512634 19.254813703425857 4 25.833124530192936 32.974191931846654 23.37759959909797 17.815083938862443 5 25.832290362953692 37.07133917396746 21.32665832290363 15.76971214017522 6 19.400000000000002 39.324999999999996 23.925 17.349999999999998 7 20.775 20.349999999999998 40.325 18.55 8 21.825 23.425 29.625 25.124999999999996 9 22.05 25.7 29.525000000000002 22.725 10-14 23.985 28.535 26.41 21.07 15-19 23.825 27.67 27.860000000000003 20.645 20-24 23.985 27.815 27.765 20.435 25-29 22.994999999999997 28.360000000000003 28.025 20.62 30-34 23.945 27.815 27.575 20.665 35-39 22.96 27.97 28.435 20.635 40-44 23.685000000000002 28.360000000000003 27.915 20.04 45-49 23.74 27.415 28.54 20.305 50-54 23.025000000000002 27.91 28.07 20.995 55-59 23.615 27.339999999999996 28.32 20.724999999999998 60-64 23.225 27.46 28.87 20.445 65-69 23.615 28.005000000000003 28.07 20.31 70-74 23.73 27.884999999999998 27.625 20.76 75-79 23.32 27.315 28.810000000000002 20.555 80-84 23.625 28.175 28.155 20.044999999999998 85-89 23.711185559277965 27.551377568878443 28.42642132106605 20.31101555077754 90-94 23.715 27.08 28.994999999999997 20.21 95-99 23.580000000000002 27.42 28.215 20.785 100-104 24.154999999999998 27.625 28.18 20.04 105-109 24.03 27.955000000000002 27.97 20.044999999999998 110-114 24.065 28.115000000000002 27.51 20.31 115-119 24.125 27.689999999999998 28.18 20.005 120-124 24.875 28.42 27.46 19.245 125-129 25.230000000000004 27.67 27.485 19.615 130-134 25.005 27.76 27.37 19.865 135-139 25.435000000000002 28.110000000000003 26.974999999999998 19.48 140-144 25.88753692854639 27.700165239597418 27.03419958940464 19.378098242451554 145-149 26.26 28.155 26.634999999999998 18.95 150 25.151362260343085 27.447023208879916 27.699293642785065 19.702320887991927 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 3.0 25 3.0 26 1.5 27 4.5 28 9.0 29 11.0 30 16.5 31 23.5 32 30.5 33 36.5 34 51.0 35 65.0 36 81.5 37 97.0 38 122.5 39 168.5 40 195.0 41 219.5 42 259.5 43 282.0 44 267.0 45 274.5 46 288.0 47 259.5 48 223.5 49 200.0 50 169.0 51 138.5 52 113.5 53 89.5 54 68.0 55 49.0 56 38.5 57 33.0 58 29.0 59 25.5 60 17.5 61 5.5 62 7.0 63 6.0 64 2.0 65 2.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.05 3 0.025 4 0.22499999999999998 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.145 145-149 0.0 150 0.8999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.7000000000000002 0.0 0.0 0.0 0.0 108-109 1.9249999999999998 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.2125000000000004 0.0 0.0 0.0 0.0 118-119 3.6875 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.8375 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.25 0.0 0.0 0.0 0.0 130-131 7.0625 0.0 0.0 0.0 0.0 132-133 7.75 0.0 0.0 0.0 0.0 134-135 8.5 0.0 0.0 0.0 0.0 136-137 9.1375 0.0 0.0 0.0 0.0 138 9.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATCA 10 0.0069754543 143.9875 3 >>END_MODULE Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901523 spots for SRR4237603.sra Written 2901523 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra Read 2901513 spots for SRR4237603.sra Written 2901513 spots for SRR4237603.sra SRR ids: ['SRR4237603.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ngd_ux90 SRR4237603.sra spots: 58030270 blocks: [[1, 2901513], [2901514, 5803026], [5803027, 8704539], [8704540, 11606052], [11606053, 14507565], [14507566, 17409078], [17409079, 20310591], [20310592, 23212104], [23212105, 26113617], [26113618, 29015130], [29015131, 31916643], [31916644, 34818156], [34818157, 37719669], [37719670, 40621182], [40621183, 43522695], [43522696, 46424208], [46424209, 49325721], [49325722, 52227234], [52227235, 55128747], [55128748, 58030270]] SRR4237603 file size 19529513 SRR4237603 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237603 SRR4237603_1.fastq SRR4237603_2.fastq Input file: SRR4237603_1.fastq Paired file: SRR4237603_2.fastq trimmed: SRR4237603-trimmed-pair1.fastq, SRR4237603-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:45:29 2025 >> started Wed Feb 12 15:46:32 2025 >> done (62.709s) 58030270 read pairs processed; of these: 34013 ( 0.06%) short read pairs filtered out after trimming by size control 29989 ( 0.05%) empty read pairs filtered out after trimming by size control 57966268 (99.89%) read pairs available; of these: 20741227 (35.78%) trimmed read pairs available after processing 37225041 (64.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 19 0.00% 20 23 0.00% 21 15 0.00% 22 10 0.00% 23 13 0.00% 24 9 0.00% 25 19 0.00% 26 19 0.00% 27 22 0.00% 28 20 0.00% 29 19 0.00% 30 31 0.00% 31 22 0.00% 32 27 0.00% 33 32 0.00% 34 24 0.00% 35 38 0.00% 36 48 0.00% 37 51 0.00% 38 57 0.00% 39 60 0.00% 40 73 0.00% 41 65 0.00% 42 83 0.00% 43 88 0.00% 44 116 0.00% 45 119 0.00% 46 137 0.00% 47 135 0.00% 48 178 0.00% 49 206 0.00% 50 214 0.00% 51 249 0.00% 52 290 0.00% 53 330 0.00% 54 322 0.00% 55 379 0.00% 56 455 0.00% 57 549 0.00% 58 575 0.00% 59 651 0.00% 60 729 0.00% 61 844 0.00% 62 1007 0.00% 63 1106 0.00% 64 1252 0.00% 65 1501 0.00% 66 1709 0.00% 67 2042 0.00% 68 2596 0.00% 69 3732 0.01% 70 4831 0.01% 71 3850 0.01% 72 3832 0.01% 73 4259 0.01% 74 4831 0.01% 75 5414 0.01% 76 5980 0.01% 77 6639 0.01% 78 7457 0.01% 79 8506 0.01% 80 9553 0.02% 81 10682 0.02% 82 12452 0.02% 83 14065 0.02% 84 18140 0.03% 85 19892 0.03% 86 22200 0.04% 87 24137 0.04% 88 26729 0.05% 89 29861 0.05% 90 31076 0.05% 91 35314 0.06% 92 36992 0.06% 93 40137 0.07% 94 44112 0.08% 95 48304 0.08% 96 51812 0.09% 97 55721 0.10% 98 58758 0.10% 99 62243 0.11% 100 67005 0.12% 101 70943 0.12% 102 76285 0.13% 103 80780 0.14% 104 85988 0.15% 105 92415 0.16% 106 97942 0.17% 107 102312 0.18% 108 106337 0.18% 109 110838 0.19% 110 115088 0.20% 111 120392 0.21% 112 125715 0.22% 113 130521 0.23% 114 138109 0.24% 115 144584 0.25% 116 150209 0.26% 117 156347 0.27% 118 162713 0.28% 119 165392 0.29% 120 170706 0.29% 121 176902 0.31% 122 180754 0.31% 123 185578 0.32% 124 193004 0.33% 125 198997 0.34% 126 206340 0.36% 127 213082 0.37% 128 217701 0.38% 129 224674 0.39% 130 230231 0.40% 131 233674 0.40% 132 241329 0.42% 133 248284 0.43% 134 255425 0.44% 135 265725 0.46% 136 274585 0.47% 137 286998 0.50% 138 299589 0.52% 139 312323 0.54% 140 321647 0.55% 141 338327 0.58% 142 360554 0.62% 143 384160 0.66% 144 425318 0.73% 145 487441 0.84% 146 578584 1.00% 147 776933 1.34% 148 1388936 2.40% 149 8033409 13.86% 150 37225041 64.22% 57966268 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=11.00 fanout-score-rank=17 prefix-density=0.25 prefix-fanout=5.9 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAAAGCACAGCTGGGATACAAAAGAAAACTGTAAGAAGCAAAAAGGTAGGAGTGATTATCACAGAAGAGGATGAAGAAAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=187.60 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=17.2 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.27 fanout-score-rank=28 prefix-density=0.34 prefix-fanout=2.2 sequence=TGTTGAGGTTGTGTCAGCGCAGAATGCACTTGTAGAGGAAAAAAATGAACAACCAATCAAGGTTGAGACCACCACAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=2765.20 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=30.9 sequence=AAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGTCATCACGGGAGAATGCTGCATGGTTCCAGTGGAAGTCTATCTAGTGGGTTCTTGTGTGTAGGTTGAATCTTGCACGTCTAGCTAGTGGTTTAATAAAGGATTGTTATGCTAATGGGGGTGTAGGTATGGAAATGTTCCACTTGGATCAAACCAATGCG SRR4237603 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:47:16 Started mapping on | Feb 12 15:47:17 Finished on | Feb 12 15:53:31 Mapping speed, Million of reads per hour | 557.96 Number of input reads | 57966268 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 55021778 Uniquely mapped reads % | 94.92% Average mapped length | 290.61 Number of splices: Total | 48036825 Number of splices: Annotated (sjdb) | 47155799 Number of splices: GT/AG | 47267268 Number of splices: GC/AG | 595635 Number of splices: AT/AC | 47704 Number of splices: Non-canonical | 126218 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1089512 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 128251 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1891626 1891626 1891626 N_multimapping 1089512 1089512 1089512 N_noFeature 1687478 54192566 2202749 N_ambiguous 553841 4790 236467 UnstrandedReadsAssigned:52780459 PositiveStrandReadsAssigned:824422 NegativeStrandReadsAssigned:52582562 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR4237603 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237603-trimmed-pair1.fastq SRR4237603-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,966,268 reads, 52,317,730 reads pseudoaligned [quant] estimated average fragment length: 219.843 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,299 rounds 52401 SRR4237603.ke.tsv 34699 SRR4237603.se.tsv 87100 total ==> SRR4237603.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.16 1375 15.5309 Potri.005G024800.1.v4.1 1035 816.157 155 3.85942 Potri.004G059700.1.v4.1 961 742.172 147 4.0251 Potri.007G009000.2.v4.1 1416 1197.16 0 0 Potri.003G141000.2.v4.1 2943 2724.16 882.176 6.58092 Potri.016G087400.1.v4.1 270 90.6543 5923.18 1327.79 Potri.015G069301.1.v4.1 564 348.688 0 0 Potri.010G195200.1.v4.1 1773 1554.16 400 5.23033 Potri.012G127500.1.v4.1 977 758.162 21037 563.878 ==> SRR4237603.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8719 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 1237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 28 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237603 completed mapping pipeline successfully