Starting /dee2/code/volunteer_pipeline.sh SRR4237604 current disk space = 3051770609664 free memory = 1488020724 SRR4237604 SRAfilesize b1413de6e85aa89ba5672e6ed148588d SRR4237604.sra SRR4237604.sra file validated SRR4237604 is paired end SRR4237604 is conventional basespace SRR4237604 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237604_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.27 34.0 33.0 34.0 31.0 34.0 2 32.93775 34.0 33.0 34.0 31.0 34.0 3 33.129 34.0 33.0 34.0 32.0 34.0 4 33.25775 34.0 33.0 34.0 32.0 34.0 5 33.12525 34.0 33.0 34.0 33.0 34.0 6 36.9935 38.0 37.0 38.0 35.0 38.0 7 37.33 38.0 38.0 38.0 37.0 38.0 8 37.49525 38.0 38.0 38.0 37.0 38.0 9 37.5225 38.0 38.0 38.0 38.0 38.0 10-14 37.5087 38.0 38.0 38.0 37.6 38.0 15-19 37.39790000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.29725 38.0 38.0 38.0 37.0 38.0 25-29 37.405350000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.36255 38.0 38.0 38.0 37.0 38.0 35-39 37.28 38.0 38.0 38.0 37.0 38.0 40-44 37.06994999999999 38.0 38.0 38.0 36.2 38.0 45-49 37.1181 38.0 38.0 38.0 36.0 38.0 50-54 37.10835 38.0 38.0 38.0 36.0 38.0 55-59 37.0578 38.0 38.0 38.0 36.0 38.0 60-64 37.06725 38.0 38.0 38.0 36.0 38.0 65-69 36.9849 38.0 38.0 38.0 36.0 38.0 70-74 36.5358 38.0 37.6 38.0 33.8 38.0 75-79 36.979150000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.9019 38.0 38.0 38.0 35.6 38.0 85-89 36.950149999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.8493 38.0 38.0 38.0 35.2 38.0 95-99 36.76845 38.0 38.0 38.0 35.0 38.0 100-104 36.60465000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.49425 38.0 38.0 38.0 34.0 38.0 110-114 36.35295 38.0 38.0 38.0 34.0 38.0 115-119 36.259750000000004 38.0 37.4 38.0 33.4 38.0 120-124 36.20475 38.0 37.8 38.0 33.8 38.0 125-129 36.0025 38.0 37.0 38.0 33.0 38.0 130-134 35.9688 38.0 37.2 38.0 33.0 38.0 135-139 35.434799999999996 38.0 36.0 38.0 30.6 38.0 140-144 35.3678 38.0 36.0 38.0 31.0 38.0 145-149 33.944900000000004 38.0 35.0 38.0 22.4 38.0 150 29.784 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 3.0 16 0.0 17 1.0 18 4.0 19 1.0 20 5.0 21 3.0 22 5.0 23 9.0 24 6.0 25 10.0 26 13.0 27 19.0 28 21.0 29 33.0 30 44.0 31 58.0 32 69.0 33 104.0 34 125.0 35 218.0 36 537.0 37 2711.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.20438151215602 10.980496927598184 8.923323537269571 34.891798022976225 2 24.975 14.075 35.225 25.724999999999998 3 20.925 19.15 24.325 35.6 4 23.599999999999998 29.175 23.025000000000002 24.2 5 23.023023023023022 32.30730730730731 25.125125125125123 19.544544544544546 6 18.475 34.75 24.875 21.9 7 14.224999999999998 27.55 39.6 18.625 8 17.150000000000002 25.1 32.525 25.224999999999998 9 16.900000000000002 25.575 32.95 24.575 10-14 20.225 30.705 26.605 22.465 15-19 20.119999999999997 29.09 27.265 23.525 20-24 19.835 28.985 27.33 23.849999999999998 25-29 19.835 28.815 27.57 23.78 30-34 19.67 29.044999999999998 27.49 23.794999999999998 35-39 20.195 28.84 27.355 23.61 40-44 20.34 29.294999999999998 26.765 23.599999999999998 45-49 19.61 29.325000000000003 27.500000000000004 23.565 50-54 19.785 29.049999999999997 27.62 23.544999999999998 55-59 20.625 28.78 27.250000000000004 23.345 60-64 20.155 28.37 27.644999999999996 23.830000000000002 65-69 20.385 28.675 27.415 23.525 70-74 19.965 28.970000000000002 27.57 23.494999999999997 75-79 19.855 28.88 27.650000000000002 23.615 80-84 19.92599629981499 28.87644382219111 27.456372818640933 23.741187059352967 85-89 20.200000000000003 28.58 27.54 23.68 90-94 20.044999999999998 28.749999999999996 26.935 24.27 95-99 20.25 28.415000000000003 27.750000000000004 23.585 100-104 20.395 28.515 27.48 23.61 105-109 20.165 28.15 27.93 23.755000000000003 110-114 20.18 28.605000000000004 27.584999999999997 23.630000000000003 115-119 20.62 28.605000000000004 27.405 23.369999999999997 120-124 20.51 28.415000000000003 27.37 23.705000000000002 125-129 20.01 28.689999999999998 27.284999999999997 24.015 130-134 20.355 28.449999999999996 27.105 24.09 135-139 21.145 28.505000000000003 26.905 23.445 140-144 20.945 28.575 27.04 23.44 145-149 20.919999999999998 29.34 26.22 23.52 150 20.361990950226243 27.50125691302162 28.15485168426345 23.981900452488688 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 1.5 20 3.0 21 2.0 22 1.5 23 1.0 24 0.5 25 1.5 26 2.5 27 4.5 28 8.5 29 14.5 30 17.5 31 25.5 32 34.0 33 40.0 34 57.0 35 77.0 36 93.5 37 104.0 38 120.0 39 155.0 40 194.5 41 222.0 42 245.5 43 263.5 44 271.0 45 280.5 46 278.0 47 260.0 48 238.0 49 205.0 50 179.0 51 137.0 52 93.0 53 83.5 54 70.5 55 58.0 56 42.0 57 28.0 58 24.0 59 17.0 60 9.5 61 8.0 62 7.5 63 4.0 64 3.5 65 3.0 66 3.5 67 2.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.425 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.1375 0.0 0.0 0.0 0.0 124-125 1.3875000000000002 0.0 0.0 0.0 0.0 126-127 1.5625 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 2.0875 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.7 0.0 0.0 0.0 0.0 138 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237604 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237604_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.46825 33.0 32.0 33.0 27.0 34.0 2 31.70075 33.0 32.0 33.0 28.0 34.0 3 31.88325 33.0 32.0 33.0 28.0 34.0 4 31.78175 33.0 32.0 33.0 30.0 34.0 5 31.68725 33.0 32.0 33.0 28.0 34.0 6 35.79125 38.0 37.0 38.0 31.0 38.0 7 35.9135 38.0 37.0 38.0 31.0 38.0 8 35.93175 38.0 37.0 38.0 31.0 38.0 9 35.9425 38.0 37.0 38.0 31.0 38.0 10-14 35.7894 38.0 36.8 38.0 30.6 38.0 15-19 35.461299999999994 38.0 36.2 38.0 29.4 38.0 20-24 35.61885 38.0 36.4 38.0 29.4 38.0 25-29 35.725849999999994 38.0 36.4 38.0 29.8 38.0 30-34 35.6091 38.0 36.2 38.0 29.0 38.0 35-39 35.4997 38.0 36.0 38.0 29.4 38.0 40-44 35.331100000000006 38.0 36.0 38.0 29.0 38.0 45-49 35.410999999999994 38.0 36.0 38.0 29.0 38.0 50-54 35.461 38.0 36.0 38.0 29.0 38.0 55-59 34.1077 37.6 33.6 38.0 25.0 38.0 60-64 35.19185 38.0 36.0 38.0 28.8 38.0 65-69 35.109950000000005 38.0 35.8 38.0 28.6 38.0 70-74 34.994150000000005 38.0 35.6 38.0 27.8 38.0 75-79 34.90095000000001 38.0 35.2 38.0 27.8 38.0 80-84 34.92595 38.0 35.4 38.0 27.6 38.0 85-89 34.80075 38.0 35.2 38.0 27.4 38.0 90-94 34.620799999999996 38.0 34.8 38.0 27.0 38.0 95-99 34.39215 38.0 34.4 38.0 25.8 38.0 100-104 34.18920000000001 38.0 34.0 38.0 24.2 38.0 105-109 33.8575 38.0 34.0 38.0 21.8 38.0 110-114 33.544349999999994 38.0 34.0 38.0 19.2 38.0 115-119 32.86465 37.6 32.6 38.0 15.0 38.0 120-124 32.697649999999996 37.2 32.4 38.0 15.0 38.0 125-129 32.613350000000004 37.2 33.0 38.0 15.0 38.0 130-134 31.7091 36.4 30.6 38.0 14.2 38.0 135-139 31.4911 36.0 31.0 38.0 14.0 38.0 140-144 30.8194 36.0 29.4 38.0 8.8 38.0 145-149 29.340449999999997 35.8 27.6 38.0 2.0 38.0 150 22.8025 31.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 2.0 5 2.0 6 4.0 7 1.0 8 3.0 9 3.0 10 0.0 11 0.0 12 2.0 13 5.0 14 5.0 15 4.0 16 11.0 17 11.0 18 13.0 19 11.0 20 19.0 21 31.0 22 24.0 23 31.0 24 28.0 25 42.0 26 62.0 27 74.0 28 79.0 29 106.0 30 123.0 31 118.0 32 190.0 33 228.0 34 315.0 35 491.0 36 878.0 37 1072.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.349999999999994 22.400000000000002 12.15 24.099999999999998 2 27.375 26.55 30.099999999999998 15.975 3 21.675 28.075 31.025000000000002 19.225 4 23.674999999999997 35.375 23.849999999999998 17.1 5 26.0 35.949999999999996 21.6 16.45 6 18.85 39.125 23.775 18.25 7 20.200000000000003 19.925 40.45 19.425 8 20.724999999999998 25.324999999999996 28.825 25.124999999999996 9 22.225 25.624999999999996 30.2 21.95 10-14 23.554710942188436 29.43088617723545 26.13522704540908 20.879175835167032 15-19 22.78569642410603 28.46211552888222 27.93198299574894 20.820205051262818 20-24 22.91072768192048 28.072018004501125 28.127031757939484 20.89022255563891 25-29 23.22696809042713 27.668300490147047 28.663599079723916 20.441132339701912 30-34 22.8245649129826 28.490698139627924 28.040608121624327 20.644128825765154 35-39 22.75068767191798 27.97199299824956 28.43710927731933 20.84021005251313 40-44 23.453208623018057 27.564647626669338 28.484969739408793 20.497174010903816 45-49 23.492921106608637 27.905347941367754 27.480114062734508 21.121616889289108 50-54 23.178907344406642 27.366419851911143 28.547128276966177 20.90754452671603 55-59 23.61416850110066 27.316389833900338 28.5671402841705 20.5023013808285 60-64 23.280820205051263 28.172043010752688 28.00200050012503 20.545136284071017 65-69 23.330832708177045 28.132033008252062 27.796949237309327 20.740185046261566 70-74 23.349669933986796 27.970594118823765 28.045609121824366 20.634126825365072 75-79 23.57353603040456 27.46912036805521 28.4142621393209 20.543081462219334 80-84 22.890722680670166 28.08702175543886 28.29707426856714 20.72518129532383 85-89 23.524409763905563 28.396358543417367 28.216286514605844 19.86294517807123 90-94 23.455245909841395 27.40781507980187 28.48851753639866 20.648421473958074 95-99 23.31082770692673 28.16704176044011 27.691922980745186 20.830207551887973 100-104 23.7 27.655 28.1 20.544999999999998 105-109 23.745 28.115000000000002 27.46 20.68 110-114 23.661183059152957 27.571378568928445 28.106405320266013 20.661033051652584 115-119 24.17741774177418 27.642764276427645 28.112811281128113 20.067006700670067 120-124 24.015 27.815 27.985 20.185 125-129 24.132413241324134 27.872787278727873 27.86278627862786 20.13201320132013 130-134 23.50735073507351 27.83278327832783 28.337833783378336 20.32203220322032 135-139 24.335 27.150000000000002 27.98 20.535 140-144 23.686714407331362 27.948319895838548 27.95833541990085 20.406630276929242 145-149 24.33730119035711 27.27818345503651 27.9183755126538 20.466139841952586 150 23.517537219278324 28.43805198082261 28.13525107241988 19.909159727479185 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.5 21 2.0 22 2.0 23 1.5 24 1.0 25 3.0 26 4.0 27 7.0 28 8.0 29 10.0 30 16.5 31 22.0 32 28.0 33 32.5 34 45.5 35 62.0 36 84.0 37 120.5 38 141.0 39 161.0 40 208.5 41 226.5 42 243.5 43 288.0 44 294.0 45 273.0 46 257.0 47 246.5 48 237.5 49 210.0 50 176.5 51 134.0 52 101.5 53 91.0 54 76.0 55 61.0 56 36.0 57 21.0 58 19.0 59 12.0 60 8.0 61 7.0 62 5.5 63 5.0 64 2.0 65 0.5 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.025 20-24 0.025 25-29 0.03 30-34 0.02 35-39 0.025 40-44 0.034999999999999996 45-49 0.055 50-54 0.06 55-59 0.06 60-64 0.025 65-69 0.025 70-74 0.02 75-79 0.015 80-84 0.025 85-89 0.04 90-94 0.065 95-99 0.025 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.01 120-124 0.0 125-129 0.01 130-134 0.01 135-139 0.0 140-144 0.155 145-149 0.03 150 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.7625000000000002 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.3375000000000004 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra Read 2292475 spots for SRR4237604.sra Written 2292475 spots for SRR4237604.sra Read 2292463 spots for SRR4237604.sra Written 2292463 spots for SRR4237604.sra SRR ids: ['SRR4237604.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u_6x47tt SRR4237604.sra spots: 45849272 blocks: [[1, 2292463], [2292464, 4584926], [4584927, 6877389], [6877390, 9169852], [9169853, 11462315], [11462316, 13754778], [13754779, 16047241], [16047242, 18339704], [18339705, 20632167], [20632168, 22924630], [22924631, 25217093], [25217094, 27509556], [27509557, 29802019], [29802020, 32094482], [32094483, 34386945], [34386946, 36679408], [36679409, 38971871], [38971872, 41264334], [41264335, 43556797], [43556798, 45849272]] SRR4237604 file size 15425564 SRR4237604 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237604 SRR4237604_1.fastq SRR4237604_2.fastq Input file: SRR4237604_1.fastq Paired file: SRR4237604_2.fastq trimmed: SRR4237604-trimmed-pair1.fastq, SRR4237604-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:07:55 2025 >> started Wed Feb 12 15:08:44 2025 >> done (49.816s) 45849272 read pairs processed; of these: 72119 ( 0.16%) short read pairs filtered out after trimming by size control 69819 ( 0.15%) empty read pairs filtered out after trimming by size control 45707334 (99.69%) read pairs available; of these: 19649144 (42.99%) trimmed read pairs available after processing 26058190 (57.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 12 0.00% 21 12 0.00% 22 11 0.00% 23 10 0.00% 24 14 0.00% 25 15 0.00% 26 10 0.00% 27 15 0.00% 28 17 0.00% 29 17 0.00% 30 27 0.00% 31 24 0.00% 32 21 0.00% 33 27 0.00% 34 26 0.00% 35 40 0.00% 36 38 0.00% 37 33 0.00% 38 30 0.00% 39 40 0.00% 40 41 0.00% 41 60 0.00% 42 64 0.00% 43 68 0.00% 44 62 0.00% 45 91 0.00% 46 122 0.00% 47 115 0.00% 48 118 0.00% 49 122 0.00% 50 126 0.00% 51 158 0.00% 52 162 0.00% 53 159 0.00% 54 181 0.00% 55 187 0.00% 56 198 0.00% 57 218 0.00% 58 245 0.00% 59 253 0.00% 60 318 0.00% 61 327 0.00% 62 345 0.00% 63 405 0.00% 64 450 0.00% 65 553 0.00% 66 567 0.00% 67 682 0.00% 68 800 0.00% 69 1274 0.00% 70 1593 0.00% 71 1347 0.00% 72 1291 0.00% 73 1310 0.00% 74 1327 0.00% 75 1474 0.00% 76 1612 0.00% 77 1823 0.00% 78 2026 0.00% 79 2390 0.01% 80 2582 0.01% 81 3147 0.01% 82 3612 0.01% 83 4618 0.01% 84 9096 0.02% 85 9414 0.02% 86 9672 0.02% 87 10178 0.02% 88 10583 0.02% 89 11038 0.02% 90 11703 0.03% 91 13119 0.03% 92 14661 0.03% 93 14202 0.03% 94 14764 0.03% 95 16280 0.04% 96 17421 0.04% 97 17730 0.04% 98 18764 0.04% 99 19912 0.04% 100 21411 0.05% 101 22572 0.05% 102 23935 0.05% 103 25457 0.06% 104 27420 0.06% 105 29025 0.06% 106 30929 0.07% 107 32892 0.07% 108 34645 0.08% 109 36282 0.08% 110 38359 0.08% 111 40724 0.09% 112 43059 0.09% 113 45983 0.10% 114 49354 0.11% 115 52171 0.11% 116 55991 0.12% 117 60659 0.13% 118 62598 0.14% 119 65827 0.14% 120 69416 0.15% 121 73737 0.16% 122 78332 0.17% 123 82591 0.18% 124 88124 0.19% 125 94248 0.21% 126 99764 0.22% 127 105822 0.23% 128 112562 0.25% 129 120521 0.26% 130 130113 0.28% 131 137918 0.30% 132 146628 0.32% 133 158858 0.35% 134 171779 0.38% 135 185918 0.41% 136 202373 0.44% 137 218836 0.48% 138 242690 0.53% 139 265684 0.58% 140 291658 0.64% 141 324954 0.71% 142 366315 0.80% 143 427151 0.93% 144 518510 1.13% 145 654657 1.43% 146 807486 1.77% 147 1228449 2.69% 148 2176135 4.76% 149 9011004 19.71% 150 26058190 57.01% 45707334 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=44 prefix-density=0.20 prefix-fanout=1.9 sequence=GCTAGACATGCAAGATTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=302.55 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=30.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=32 prefix-density=0.22 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=247.95 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=29.6 sequence=AAGAAGAAGAAA SRR4237604 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:09:28 Started mapping on | Feb 12 15:09:29 Finished on | Feb 12 15:14:14 Mapping speed, Million of reads per hour | 577.36 Number of input reads | 45707334 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 43628939 Uniquely mapped reads % | 95.45% Average mapped length | 293.46 Number of splices: Total | 41328723 Number of splices: Annotated (sjdb) | 40636250 Number of splices: GT/AG | 40694933 Number of splices: GC/AG | 504853 Number of splices: AT/AC | 37337 Number of splices: Non-canonical | 91600 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 881480 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 65195 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.44% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1262544 1262544 1262544 N_multimapping 881480 881480 881480 N_noFeature 1185821 43143572 1447028 N_ambiguous 425224 4703 197012 UnstrandedReadsAssigned:42017894 PositiveStrandReadsAssigned:480664 NegativeStrandReadsAssigned:41984899 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237604 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237604-trimmed-pair1.fastq SRR4237604-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,707,334 reads, 41,752,361 reads pseudoaligned [quant] estimated average fragment length: 258.082 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR4237604.ke.tsv 34699 SRR4237604.se.tsv 87100 total ==> SRR4237604.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.92 939 12.6484 Potri.005G024800.1.v4.1 1035 777.918 186 5.67137 Potri.004G059700.1.v4.1 961 703.993 32 1.07818 Potri.007G009000.2.v4.1 1416 1158.92 0 0 Potri.003G141000.2.v4.1 2943 2685.92 677.101 5.97956 Potri.016G087400.1.v4.1 270 71.9619 3887.54 1281.39 Potri.015G069301.1.v4.1 564 313.799 0 0 Potri.010G195200.1.v4.1 1773 1515.92 101 1.58035 Potri.012G127500.1.v4.1 977 719.972 21699 714.879 ==> SRR4237604.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3394 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 516 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237604 completed mapping pipeline successfully