Starting /dee2/code/volunteer_pipeline.sh SRR4237605 current disk space = 3051707359232 free memory = 1578527404 SRR4237605 SRAfilesize 0e77d61632c40a8f47d85e80da7fb621 SRR4237605.sra SRR4237605.sra file validated SRR4237605 is paired end SRR4237605 is conventional basespace SRR4237605 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237605_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.515 34.0 33.0 34.0 18.0 34.0 2 32.929 34.0 33.0 34.0 28.0 34.0 3 33.084 34.0 33.0 34.0 32.0 34.0 4 33.35125 34.0 33.0 34.0 33.0 34.0 5 33.4265 34.0 33.0 34.0 33.0 34.0 6 37.1465 38.0 37.0 38.0 36.0 38.0 7 37.4005 38.0 38.0 38.0 37.0 38.0 8 37.56475 38.0 38.0 38.0 37.0 38.0 9 37.6315 38.0 38.0 38.0 38.0 38.0 10-14 37.25855 38.0 38.0 38.0 36.6 38.0 15-19 37.5046 38.0 38.0 38.0 37.6 38.0 20-24 37.51805 38.0 38.0 38.0 38.0 38.0 25-29 37.50635 38.0 38.0 38.0 38.0 38.0 30-34 37.50834999999999 38.0 38.0 38.0 37.4 38.0 35-39 37.5165 38.0 38.0 38.0 37.8 38.0 40-44 37.38035 38.0 38.0 38.0 37.0 38.0 45-49 37.35045 38.0 38.0 38.0 37.0 38.0 50-54 37.2519 38.0 38.0 38.0 36.4 38.0 55-59 37.2251 38.0 38.0 38.0 36.4 38.0 60-64 37.23065 38.0 38.0 38.0 36.6 38.0 65-69 37.0988 38.0 38.0 38.0 36.2 38.0 70-74 37.12945 38.0 38.0 38.0 36.0 38.0 75-79 37.0653 38.0 38.0 38.0 36.0 38.0 80-84 37.03685 38.0 38.0 38.0 36.0 38.0 85-89 35.8777 38.0 36.6 38.0 29.8 38.0 90-94 36.939 38.0 38.0 38.0 36.0 38.0 95-99 36.927049999999994 38.0 38.0 38.0 35.6 38.0 100-104 36.812599999999996 38.0 38.0 38.0 34.8 38.0 105-109 36.5086 38.0 38.0 38.0 34.2 38.0 110-114 36.5274 38.0 38.0 38.0 34.0 38.0 115-119 36.518100000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.364999999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.193349999999995 38.0 37.6 38.0 33.6 38.0 130-134 36.1233 38.0 37.6 38.0 33.4 38.0 135-139 35.84905 38.0 36.8 38.0 32.4 38.0 140-144 35.6473 38.0 36.0 38.0 32.4 38.0 145-149 35.2761 38.0 36.0 38.0 31.4 38.0 150 30.37375 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 0.0 20 1.0 21 6.0 22 6.0 23 2.0 24 9.0 25 7.0 26 6.0 27 19.0 28 13.0 29 32.0 30 29.0 31 50.0 32 51.0 33 79.0 34 110.0 35 213.0 36 546.0 37 2814.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.31754337648031 10.906086477554393 8.895621041035527 42.88074910492977 2 22.836418209104554 14.282141070535268 38.14407203601801 24.73736868434217 3 20.8 19.6 24.675 34.925 4 23.974999999999998 28.875 21.3 25.85 5 23.56178089044522 33.11655827913957 22.98649324662331 20.335167583791897 6 18.224999999999998 34.55 24.925 22.3 7 13.200000000000001 27.200000000000003 42.025 17.575 8 17.775 24.0 32.574999999999996 25.650000000000002 9 17.349999999999998 23.175 35.325 24.15 10-14 20.119999999999997 29.92 26.669999999999998 23.29 15-19 20.175 28.1 28.000000000000004 23.724999999999998 20-24 20.14 28.415000000000003 27.834999999999997 23.61 25-29 19.755 28.715000000000003 28.060000000000002 23.47 30-34 19.715 28.62 28.08 23.585 35-39 19.384999999999998 28.725 28.015 23.875 40-44 20.16 28.994999999999997 27.400000000000002 23.445 45-49 20.4 28.62 27.57 23.41 50-54 19.735 28.999999999999996 27.255000000000003 24.01 55-59 19.71 28.79 27.685 23.815 60-64 20.225 28.970000000000002 27.22 23.585 65-69 20.625 28.7 27.51 23.165 70-74 20.025000000000002 28.025 27.905 24.044999999999998 75-79 20.255000000000003 28.000000000000004 27.529999999999998 24.215 80-84 20.365 28.189999999999998 27.884999999999998 23.56 85-89 19.965 28.57 27.529999999999998 23.935000000000002 90-94 20.205000000000002 28.560000000000002 27.62 23.615 95-99 20.01 28.68 27.51 23.799999999999997 100-104 20.34 28.345 28.27 23.044999999999998 105-109 20.89 28.33 27.505000000000003 23.275000000000002 110-114 20.61 28.360000000000003 27.235 23.794999999999998 115-119 20.474999999999998 28.505000000000003 27.12 23.9 120-124 20.84 28.68 27.215 23.265 125-129 21.01 28.285 26.729999999999997 23.974999999999998 130-134 20.735 28.660000000000004 26.93 23.674999999999997 135-139 21.0 29.04 26.724999999999998 23.235 140-144 20.830000000000002 28.560000000000002 26.57 24.04 145-149 20.855 29.439999999999998 26.265 23.44 150 20.03027245206862 27.976791120080723 27.27043390514632 24.72250252270434 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 2.0 24 2.5 25 3.5 26 4.0 27 4.0 28 7.0 29 13.5 30 22.0 31 25.5 32 36.5 33 46.5 34 54.5 35 74.0 36 84.5 37 103.5 38 136.0 39 168.0 40 198.0 41 212.5 42 236.5 43 261.5 44 258.5 45 268.5 46 280.5 47 265.5 48 227.5 49 194.0 50 178.0 51 146.0 52 112.0 53 87.0 54 68.5 55 57.0 56 43.0 57 30.5 58 23.0 59 17.0 60 11.5 61 7.5 62 6.0 63 4.5 64 4.0 65 5.0 66 3.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.225 2 0.05 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.275 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.3125 0.0 0.0 0.0 0.0 120-121 3.7125 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.0 124-125 4.65 0.0 0.0 0.0 0.0 126-127 5.1125 0.0 0.0 0.0 0.0 128-129 5.6 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.925000000000001 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 8.175 0.0 0.0 0.0 0.0 138 8.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237605 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237605_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9935 33.0 33.0 34.0 32.0 34.0 2 33.1685 34.0 33.0 34.0 33.0 34.0 3 33.15125 34.0 33.0 34.0 33.0 34.0 4 33.10375 34.0 33.0 34.0 33.0 34.0 5 33.19 34.0 33.0 34.0 33.0 34.0 6 37.3395 38.0 38.0 38.0 37.0 38.0 7 37.34275 38.0 38.0 38.0 38.0 38.0 8 37.32725 38.0 38.0 38.0 37.0 38.0 9 37.314 38.0 38.0 38.0 37.0 38.0 10-14 37.30705 38.0 38.0 38.0 37.0 38.0 15-19 37.2967 38.0 38.0 38.0 37.2 38.0 20-24 37.2731 38.0 38.0 38.0 37.0 38.0 25-29 37.2678 38.0 38.0 38.0 37.0 38.0 30-34 37.2736 38.0 38.0 38.0 37.0 38.0 35-39 37.2768 38.0 38.0 38.0 37.0 38.0 40-44 37.24025 38.0 38.0 38.0 37.0 38.0 45-49 37.182 38.0 38.0 38.0 37.0 38.0 50-54 37.21285 38.0 38.0 38.0 37.0 38.0 55-59 37.21325 38.0 38.0 38.0 37.0 38.0 60-64 37.142450000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.161 38.0 38.0 38.0 37.0 38.0 70-74 37.0932 38.0 38.0 38.0 37.0 38.0 75-79 37.01285 38.0 38.0 38.0 36.2 38.0 80-84 37.0374 38.0 38.0 38.0 36.4 38.0 85-89 36.92715 38.0 38.0 38.0 36.0 38.0 90-94 36.930899999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.8473 38.0 38.0 38.0 35.8 38.0 100-104 36.69345 38.0 38.0 38.0 35.4 38.0 105-109 36.663 38.0 38.0 38.0 35.4 38.0 110-114 36.62769999999999 38.0 38.0 38.0 35.2 38.0 115-119 36.636849999999995 38.0 38.0 38.0 35.0 38.0 120-124 36.40365 38.0 38.0 38.0 34.6 38.0 125-129 36.346500000000006 38.0 38.0 38.0 34.0 38.0 130-134 36.138400000000004 38.0 38.0 38.0 34.0 38.0 135-139 35.90205 38.0 38.0 38.0 33.4 38.0 140-144 35.55145 38.0 38.0 38.0 33.0 38.0 145-149 35.32445 38.0 37.6 38.0 32.8 38.0 150 29.80725 35.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 2.0 9 1.0 10 1.0 11 2.0 12 2.0 13 3.0 14 2.0 15 3.0 16 3.0 17 2.0 18 3.0 19 6.0 20 1.0 21 7.0 22 6.0 23 4.0 24 14.0 25 9.0 26 15.0 27 13.0 28 27.0 29 16.0 30 34.0 31 31.0 32 48.0 33 67.0 34 99.0 35 149.0 36 339.0 37 3087.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.0 18.275 14.124999999999998 29.599999999999998 2 27.975 23.25 33.725 15.049999999999999 3 20.45 27.450000000000003 31.424999999999997 20.674999999999997 4 24.5 34.699999999999996 22.85 17.95 5 25.05 36.775000000000006 21.925 16.25 6 20.7 37.85 23.799999999999997 17.65 7 19.15 20.200000000000003 40.9 19.75 8 20.925 24.4 30.5 24.175 9 23.225 23.125 30.625000000000004 23.025000000000002 10-14 23.599999999999998 29.275000000000002 26.400000000000002 20.724999999999998 15-19 23.11 28.199999999999996 28.09 20.599999999999998 20-24 23.25 28.23 27.725 20.794999999999998 25-29 23.386169308465423 27.736386819340968 28.05140257012851 20.826041302065104 30-34 23.011150557527877 27.9813990699535 28.026401320066004 20.981049052452622 35-39 23.305 28.37 27.965 20.36 40-44 23.435 28.470000000000002 27.650000000000002 20.445 45-49 23.46 28.03 27.810000000000002 20.7 50-54 23.667366736673667 28.5028502850285 27.39273927392739 20.437043704370435 55-59 23.575 28.015 27.800000000000004 20.61 60-64 22.86 28.095 28.67 20.375 65-69 23.825 27.185 29.104999999999997 19.885 70-74 23.025000000000002 28.199999999999996 28.599999999999998 20.175 75-79 23.685000000000002 27.295 28.51 20.51 80-84 23.505000000000003 28.384999999999998 27.46 20.65 85-89 23.50617530876544 28.081404070203508 27.956397819890995 20.456022801140055 90-94 23.183477521628244 27.509126368955343 28.54428164224634 20.763114467170077 95-99 24.051202560128008 28.15640782039102 27.821391069553474 19.970998549927497 100-104 23.575 27.810000000000002 28.265 20.349999999999998 105-109 23.549999999999997 28.505000000000003 27.36 20.585 110-114 24.099999999999998 27.97 27.855 20.075000000000003 115-119 23.745 28.015 28.449999999999996 19.79 120-124 24.235 27.525 27.82 20.419999999999998 125-129 24.44 28.084999999999997 27.765 19.71 130-134 24.755 28.305000000000003 27.175 19.765 135-139 24.97 27.605 27.595 19.830000000000002 140-144 24.864729458917836 28.622244488977955 27.15931863727455 19.35370741482966 145-149 25.605 27.975 26.900000000000002 19.52 150 26.250631632137445 28.347650328448708 26.60434562910561 18.797372410308235 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.5 24 2.0 25 3.5 26 3.0 27 5.0 28 7.5 29 5.5 30 12.0 31 18.5 32 24.5 33 33.0 34 46.0 35 62.5 36 90.0 37 118.5 38 143.5 39 175.5 40 200.5 41 223.5 42 264.5 43 298.0 44 287.5 45 277.0 46 278.5 47 250.5 48 223.0 49 199.5 50 163.0 51 134.5 52 105.5 53 80.5 54 62.5 55 50.5 56 39.5 57 31.0 58 21.5 59 14.5 60 14.0 61 7.5 62 4.0 63 4.0 64 3.5 65 3.0 66 1.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.015 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.2 145-149 0.0 150 1.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5375 0.0 0.0 0.0 0.0 114-115 2.8 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.7 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.9 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 8.1875 0.0 0.0 0.0 0.0 138 8.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177542 spots for SRR4237605.sra Written 2177542 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra Read 2177530 spots for SRR4237605.sra Written 2177530 spots for SRR4237605.sra SRR ids: ['SRR4237605.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wpu_o8mw SRR4237605.sra spots: 43550612 blocks: [[1, 2177530], [2177531, 4355060], [4355061, 6532590], [6532591, 8710120], [8710121, 10887650], [10887651, 13065180], [13065181, 15242710], [15242711, 17420240], [17420241, 19597770], [19597771, 21775300], [21775301, 23952830], [23952831, 26130360], [26130361, 28307890], [28307891, 30485420], [30485421, 32662950], [32662951, 34840480], [34840481, 37018010], [37018011, 39195540], [39195541, 41373070], [41373071, 43550612]] SRR4237605 file size 14651113 SRR4237605 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237605 SRR4237605_1.fastq SRR4237605_2.fastq Input file: SRR4237605_1.fastq Paired file: SRR4237605_2.fastq trimmed: SRR4237605-trimmed-pair1.fastq, SRR4237605-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:10:19 2025 >> started Wed Feb 12 16:11:07 2025 >> done (47.782s) 43550612 read pairs processed; of these: 19957 ( 0.05%) short read pairs filtered out after trimming by size control 18931 ( 0.04%) empty read pairs filtered out after trimming by size control 43511724 (99.91%) read pairs available; of these: 16570266 (38.08%) trimmed read pairs available after processing 26941458 (61.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 7 0.00% 21 6 0.00% 22 6 0.00% 23 18 0.00% 24 15 0.00% 25 17 0.00% 26 16 0.00% 27 13 0.00% 28 16 0.00% 29 22 0.00% 30 20 0.00% 31 31 0.00% 32 35 0.00% 33 34 0.00% 34 55 0.00% 35 43 0.00% 36 55 0.00% 37 72 0.00% 38 61 0.00% 39 76 0.00% 40 86 0.00% 41 97 0.00% 42 105 0.00% 43 99 0.00% 44 105 0.00% 45 132 0.00% 46 171 0.00% 47 187 0.00% 48 215 0.00% 49 235 0.00% 50 251 0.00% 51 276 0.00% 52 364 0.00% 53 348 0.00% 54 391 0.00% 55 451 0.00% 56 472 0.00% 57 533 0.00% 58 609 0.00% 59 682 0.00% 60 839 0.00% 61 886 0.00% 62 1015 0.00% 63 1152 0.00% 64 1291 0.00% 65 1467 0.00% 66 1633 0.00% 67 1865 0.00% 68 2342 0.01% 69 3184 0.01% 70 3459 0.01% 71 3092 0.01% 72 3383 0.01% 73 3921 0.01% 74 4218 0.01% 75 4858 0.01% 76 5357 0.01% 77 5729 0.01% 78 6482 0.01% 79 7170 0.02% 80 7944 0.02% 81 9042 0.02% 82 10457 0.02% 83 11528 0.03% 84 14065 0.03% 85 15574 0.04% 86 16887 0.04% 87 18608 0.04% 88 19833 0.05% 89 21458 0.05% 90 23128 0.05% 91 24987 0.06% 92 27550 0.06% 93 29466 0.07% 94 31939 0.07% 95 34762 0.08% 96 37130 0.09% 97 39928 0.09% 98 41478 0.10% 99 43879 0.10% 100 46480 0.11% 101 48571 0.11% 102 51844 0.12% 103 54207 0.12% 104 57479 0.13% 105 61089 0.14% 106 64705 0.15% 107 67646 0.16% 108 69188 0.16% 109 72056 0.17% 110 74378 0.17% 111 77144 0.18% 112 80637 0.19% 113 83149 0.19% 114 86726 0.20% 115 90795 0.21% 116 93760 0.22% 117 97565 0.22% 118 100993 0.23% 119 103053 0.24% 120 105021 0.24% 121 108362 0.25% 122 111337 0.26% 123 114180 0.26% 124 119203 0.27% 125 122199 0.28% 126 127234 0.29% 127 131073 0.30% 128 135111 0.31% 129 138953 0.32% 130 143012 0.33% 131 147116 0.34% 132 150508 0.35% 133 156282 0.36% 134 159960 0.37% 135 166480 0.38% 136 174262 0.40% 137 180941 0.42% 138 190175 0.44% 139 199563 0.46% 140 211437 0.49% 141 225016 0.52% 142 241606 0.56% 143 264113 0.61% 144 297308 0.68% 145 352104 0.81% 146 427968 0.98% 147 602951 1.39% 148 1155173 2.65% 149 7880721 18.11% 150 26941458 61.92% 43511724 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.14 sequence-density-rank=3 fanout-score=91.19 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=18.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=26 prefix-density=0.20 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=233.10 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=26.4 sequence=GAAGAAGAAGAAA SRR4237605 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:12:03 Started mapping on | Feb 12 16:12:04 Finished on | Feb 12 16:15:05 Mapping speed, Million of reads per hour | 865.43 Number of input reads | 43511724 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 42251457 Uniquely mapped reads % | 97.10% Average mapped length | 291.59 Number of splices: Total | 38701526 Number of splices: Annotated (sjdb) | 38028252 Number of splices: GT/AG | 38119728 Number of splices: GC/AG | 456513 Number of splices: AT/AC | 35160 Number of splices: Non-canonical | 90125 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 810731 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 59729 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 469381 469381 469381 N_multimapping 810731 810731 810731 N_noFeature 1219769 41658229 1585401 N_ambiguous 420597 4784 188782 UnstrandedReadsAssigned:40611091 PositiveStrandReadsAssigned:588444 NegativeStrandReadsAssigned:40477274 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237605 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237605-trimmed-pair1.fastq SRR4237605-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,511,724 reads, 40,232,115 reads pseudoaligned [quant] estimated average fragment length: 229.723 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR4237605.ke.tsv 34699 SRR4237605.se.tsv 87100 total ==> SRR4237605.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.28 893.481 13.7758 Potri.005G024800.1.v4.1 1035 806.277 136 4.65332 Potri.004G059700.1.v4.1 961 732.307 13 0.489731 Potri.007G009000.2.v4.1 1416 1187.28 0 0 Potri.003G141000.2.v4.1 2943 2714.28 641.243 6.51742 Potri.016G087400.1.v4.1 270 87.3555 3953.57 1248.55 Potri.015G069301.1.v4.1 564 340.067 0 0 Potri.010G195200.1.v4.1 1773 1544.28 116.859 2.0876 Potri.012G127500.1.v4.1 977 748.292 13468 496.523 ==> SRR4237605.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5448 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 499 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 46 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237605 completed mapping pipeline successfully