Starting /dee2/code/volunteer_pipeline.sh SRR4237606 current disk space = 3051936694272 free memory = 1581145540 SRR4237606 SRAfilesize 82000546fcbf35eb6d092d33c1177778 SRR4237606.sra SRR4237606.sra file validated SRR4237606 is paired end SRR4237606 is conventional basespace SRR4237606 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237606_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.413 34.0 33.0 34.0 33.0 34.0 2 33.374 34.0 33.0 34.0 33.0 34.0 3 33.46375 34.0 34.0 34.0 33.0 34.0 4 33.441 34.0 34.0 34.0 33.0 34.0 5 33.117 34.0 34.0 34.0 33.0 34.0 6 37.013 38.0 37.0 38.0 36.0 38.0 7 37.3495 38.0 38.0 38.0 37.0 38.0 8 37.51025 38.0 38.0 38.0 37.0 38.0 9 37.6 38.0 38.0 38.0 38.0 38.0 10-14 37.57215000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.53655 38.0 38.0 38.0 38.0 38.0 20-24 37.50235 38.0 38.0 38.0 38.0 38.0 25-29 37.4486 38.0 38.0 38.0 37.6 38.0 30-34 37.34805 38.0 38.0 38.0 37.6 38.0 35-39 37.36944999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.323750000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.363800000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.23785 38.0 38.0 38.0 36.8 38.0 55-59 37.127050000000004 38.0 38.0 38.0 36.4 38.0 60-64 37.081849999999996 38.0 38.0 38.0 36.2 38.0 65-69 36.405550000000005 38.0 37.4 38.0 33.0 38.0 70-74 36.88425 38.0 38.0 38.0 35.8 38.0 75-79 36.8458 38.0 38.0 38.0 35.8 38.0 80-84 36.79605 38.0 38.0 38.0 35.4 38.0 85-89 36.71175 38.0 38.0 38.0 35.0 38.0 90-94 36.89110000000001 38.0 38.0 38.0 35.8 38.0 95-99 36.71875 38.0 38.0 38.0 35.2 38.0 100-104 35.4207 38.0 36.6 38.0 28.2 38.0 105-109 36.28535 38.0 37.4 38.0 33.0 38.0 110-114 36.589 38.0 38.0 38.0 34.6 38.0 115-119 36.49325 38.0 38.0 38.0 34.2 38.0 120-124 36.46465 38.0 38.0 38.0 34.6 38.0 125-129 35.7544 38.0 36.8 38.0 31.4 38.0 130-134 35.942099999999996 38.0 37.4 38.0 33.2 38.0 135-139 35.84045 38.0 37.4 38.0 33.0 38.0 140-144 35.6229 38.0 36.2 38.0 32.6 38.0 145-149 34.65345 38.0 35.8 38.0 28.0 38.0 150 29.71675 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 1.0 20 7.0 21 3.0 22 2.0 23 2.0 24 7.0 25 12.0 26 18.0 27 19.0 28 22.0 29 41.0 30 35.0 31 47.0 32 55.0 33 86.0 34 123.0 35 211.0 36 507.0 37 2791.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.675 12.325 8.425 38.574999999999996 2 21.916437327995997 15.836877658243683 35.60170127595696 26.64498373780335 3 19.425 19.1 26.025 35.449999999999996 4 22.625 29.875 22.1 25.4 5 22.480424349583227 33.24071735286688 23.74336953776206 20.535488759787825 6 17.05 36.15 24.325 22.475 7 12.950000000000001 26.150000000000002 43.25 17.65 8 17.275 25.374999999999996 32.275 25.074999999999996 9 17.0 24.45 34.325 24.224999999999998 10-14 19.43 30.819999999999997 27.045 22.705000000000002 15-19 20.07 29.525000000000002 26.905 23.5 20-24 19.53 29.904999999999998 27.384999999999998 23.18 25-29 18.875 30.285 27.389999999999997 23.45 30-34 19.835 29.580000000000002 27.839999999999996 22.745 35-39 19.66 29.115000000000002 27.905 23.32 40-44 20.25 29.255 27.025 23.47 45-49 20.01 28.82 27.12 24.05 50-54 19.305 29.215000000000003 28.01 23.47 55-59 20.0 29.39 27.034999999999997 23.575 60-64 19.865 29.354999999999997 27.250000000000004 23.53 65-69 20.330000000000002 29.595 27.034999999999997 23.04 70-74 20.630000000000003 28.744999999999997 27.084999999999997 23.54 75-79 20.19 28.470000000000002 27.72 23.62 80-84 19.755 29.57 26.924999999999997 23.75 85-89 20.16 28.970000000000002 27.215 23.655 90-94 20.185 29.095 27.224999999999998 23.494999999999997 95-99 20.19 28.88 26.86 24.07 100-104 20.89 28.52 27.58 23.01 105-109 21.14 28.294999999999998 26.755000000000003 23.810000000000002 110-114 20.39 28.299999999999997 27.310000000000002 24.0 115-119 20.200000000000003 29.244999999999997 27.375 23.18 120-124 20.549999999999997 29.03 27.060000000000002 23.36 125-129 20.412041204120413 28.132813281328133 27.3977397739774 24.05740574057406 130-134 20.93 27.765 27.27 24.035 135-139 20.618092713907085 28.464269640446066 26.468970345551835 24.448667300095014 140-144 20.717071707170717 28.40784078407841 26.812681268126816 24.062406240624064 145-149 21.535 28.134999999999998 26.674999999999997 23.655 150 21.007771371270994 27.97693657558285 27.224868388067186 23.790423665078965 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.5 18 1.5 19 0.0 20 0.0 21 1.5 22 2.5 23 2.0 24 2.5 25 5.5 26 8.0 27 8.5 28 10.5 29 17.5 30 23.5 31 24.0 32 35.5 33 53.5 34 71.5 35 91.0 36 104.0 37 116.5 38 136.5 39 160.0 40 181.0 41 206.5 42 229.0 43 240.0 44 268.5 45 279.0 46 254.5 47 251.5 48 225.0 49 193.5 50 172.5 51 140.5 52 118.5 53 93.5 54 75.0 55 57.0 56 34.0 57 24.0 58 20.0 59 12.0 60 9.5 61 8.5 62 6.5 63 4.5 64 2.5 65 2.0 66 2.5 67 1.0 68 2.0 69 3.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 1.0250000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.015 140-144 0.01 145-149 0.0 150 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.4000000000000004 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 4.025 0.0 0.0 0.0 0.0 126-127 4.550000000000001 0.0 0.0 0.0 0.0 128-129 5.0875 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.0875 0.0 0.0 0.0 0.0 134-135 6.55 0.0 0.0 0.0 0.0 136-137 7.0 0.0 0.0 0.0 0.0 138 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGTA 10 0.0069827023 143.9375 8 >>END_MODULE SRR4237606 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237606_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81075 33.0 33.0 34.0 32.0 34.0 2 32.947 34.0 33.0 34.0 32.0 34.0 3 32.9885 34.0 33.0 34.0 32.0 34.0 4 33.069 34.0 33.0 34.0 32.0 34.0 5 32.851 34.0 33.0 34.0 32.0 34.0 6 36.99475 38.0 38.0 38.0 37.0 38.0 7 37.0405 38.0 38.0 38.0 37.0 38.0 8 37.0 38.0 38.0 38.0 37.0 38.0 9 36.84 38.0 38.0 38.0 36.0 38.0 10-14 36.80045 38.0 38.0 38.0 36.0 38.0 15-19 36.9351 38.0 38.0 38.0 36.4 38.0 20-24 36.56609999999999 38.0 37.8 38.0 34.2 38.0 25-29 35.3619 38.0 35.4 38.0 26.6 38.0 30-34 36.79105 38.0 38.0 38.0 35.6 38.0 35-39 36.345600000000005 38.0 37.6 38.0 33.6 38.0 40-44 36.73595 38.0 37.8 38.0 35.4 38.0 45-49 36.7801 38.0 38.0 38.0 35.8 38.0 50-54 36.868199999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.9038 38.0 38.0 38.0 36.4 38.0 60-64 36.40755 38.0 37.8 38.0 34.0 38.0 65-69 35.994550000000004 38.0 37.4 38.0 31.6 38.0 70-74 36.34435 38.0 37.8 38.0 33.6 38.0 75-79 35.7817 38.0 36.6 38.0 30.0 38.0 80-84 36.7485 38.0 38.0 38.0 35.6 38.0 85-89 36.2123 38.0 37.6 38.0 32.8 38.0 90-94 36.62475 38.0 38.0 38.0 35.2 38.0 95-99 36.627700000000004 38.0 38.0 38.0 35.4 38.0 100-104 36.410900000000005 38.0 38.0 38.0 34.6 38.0 105-109 35.1702 38.0 35.8 38.0 28.4 38.0 110-114 36.32280000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.18255 38.0 38.0 38.0 34.0 38.0 120-124 36.1094 38.0 38.0 38.0 34.0 38.0 125-129 35.99835 38.0 38.0 38.0 34.0 38.0 130-134 35.911350000000006 38.0 38.0 38.0 33.8 38.0 135-139 35.548 38.0 37.8 38.0 32.2 38.0 140-144 35.269600000000004 38.0 37.0 38.0 31.4 38.0 145-149 34.825750000000006 38.0 36.0 38.0 31.0 38.0 150 28.72275 34.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 1.0 5 0.0 6 1.0 7 2.0 8 2.0 9 1.0 10 1.0 11 2.0 12 2.0 13 3.0 14 2.0 15 3.0 16 4.0 17 4.0 18 4.0 19 5.0 20 8.0 21 7.0 22 13.0 23 14.0 24 12.0 25 15.0 26 13.0 27 27.0 28 25.0 29 46.0 30 30.0 31 62.0 32 66.0 33 87.0 34 124.0 35 202.0 36 590.0 37 2611.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.400000000000006 22.125 11.75 25.724999999999998 2 28.325 26.35 31.275 14.05 3 20.65 28.475 31.65 19.225 4 25.424999999999997 33.025 24.025 17.525 5 24.7 37.625 22.375 15.299999999999999 6 20.56613226452906 38.30160320641283 22.49498997995992 18.637274549098194 7 20.275344180225282 20.150187734668336 39.67459324155194 19.899874843554443 8 22.35294117647059 24.330413016270338 29.411764705882355 23.90488110137672 9 21.42320220496116 24.680531195189175 30.969681784014032 22.92658481583563 10-14 24.718087505638252 28.471908986117377 25.670325264371275 21.139678243873103 15-19 23.532652243589745 27.609174679487182 28.079927884615387 20.778245192307693 20-24 23.635999599559515 28.065872459705677 27.870657723495846 20.427470217238962 25-29 24.113759262968156 27.313238533947526 28.359703585019027 20.21329861806529 30-34 23.476128515664097 28.04023621259133 28.11029926934241 20.373336002402162 35-39 23.313467220914507 28.391846546802224 27.500375619772626 20.794310612510642 40-44 23.859367957129262 27.966144137827413 27.92106976511243 20.253418139930886 45-49 22.983264856198016 28.114039482914123 27.70818719310552 21.194508467782345 50-54 23.130887953497695 28.17698937662858 28.04670274604129 20.64541992383243 55-59 23.622599889707725 28.00421115957287 28.189702712187298 20.18348623853211 60-64 23.497267759562842 27.608161628315038 28.655938236326268 20.23863237579586 65-69 23.50435915422387 28.274376189998996 28.139092093396133 20.082172562381 70-74 23.683287396642445 27.38160861939364 28.263593084439993 20.67151089952393 75-79 23.606935257566647 27.480457005411907 28.48767288033674 20.424934856684708 80-84 23.468109624730698 27.526429179818628 28.24790821183426 20.757552983616414 85-89 23.840064134682834 27.362461168453756 28.830544142699672 19.966930554163746 90-94 23.423558897243108 27.363408521303256 28.56641604010025 20.64661654135338 95-99 24.117529081428 27.05074207781789 28.44464500601685 20.387083834737265 100-104 24.262311507439506 27.493612544461698 28.841240418816692 19.4028355292821 105-109 23.72151264713248 28.484848484848484 27.312797395442022 20.480841472577012 110-114 23.79711307137129 26.8995589414595 28.894346431435448 20.40898155573376 115-119 23.957288951273313 27.71706436735512 28.23841989171847 20.087226789653098 120-124 24.31999198517257 26.969894304463253 27.996794069027704 20.713319641336472 125-129 23.709531923423874 27.924225719154055 28.350205472586946 20.01603688483512 130-134 24.802084377192106 27.527808397635035 27.788355546647956 19.881751678524903 135-139 24.969915764139593 27.366626554352187 27.637384677095866 20.026073004412353 140-144 24.88076710678247 28.42010141071339 27.551583914855165 19.147547567648978 145-149 25.471225185482254 27.967716061760576 27.07038299578905 19.490675756968116 150 25.296343001261036 27.667087011349306 27.46532156368222 19.57124842370744 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 1.5 5 1.5 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 0.0 23 1.0 24 2.0 25 2.0 26 2.5 27 4.5 28 9.0 29 10.5 30 12.5 31 19.5 32 26.0 33 31.0 34 43.5 35 70.0 36 88.5 37 98.5 38 121.0 39 160.5 40 194.0 41 226.5 42 267.0 43 278.5 44 291.0 45 296.0 46 276.0 47 265.5 48 227.0 49 183.0 50 165.5 51 135.0 52 117.0 53 102.0 54 71.0 55 48.0 56 36.5 57 29.5 58 21.5 59 16.5 60 9.5 61 7.0 62 6.5 63 3.5 64 1.5 65 2.5 66 2.5 67 1.5 68 2.0 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.125 8 0.125 9 0.22499999999999998 10-14 0.23500000000000001 15-19 0.16 20-24 0.11 25-29 0.13999999999999999 30-34 0.09 35-39 0.165 40-44 0.165 45-49 0.21 50-54 0.22 55-59 0.265 60-64 0.265 65-69 0.21 70-74 0.22499999999999998 75-79 0.22 80-84 0.20500000000000002 85-89 0.21 90-94 0.25 95-99 0.27999999999999997 100-104 0.19499999999999998 105-109 0.17500000000000002 110-114 0.24 115-119 0.26 120-124 0.185 125-129 0.22999999999999998 130-134 0.21 135-139 0.27999999999999997 140-144 0.40499999999999997 145-149 0.26 150 0.8750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.4000000000000004 0.0 0.0 0.0 0.0 118-119 2.85 0.0 0.0 0.0 0.0 120-121 3.2750000000000004 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.425000000000001 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.550000000000001 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.325 0.0 0.0 0.0 0.0 136-137 6.75 0.0 0.0 0.0 0.0 138 7.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCAC 10 0.006973645 144.0 9 CCCCCCC 20 0.006139246 28.8 90-94 >>END_MODULE Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393500 spots for SRR4237606.sra Written 2393500 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra Read 2393497 spots for SRR4237606.sra Written 2393497 spots for SRR4237606.sra SRR ids: ['SRR4237606.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fwrclvj8 SRR4237606.sra spots: 47869943 blocks: [[1, 2393497], [2393498, 4786994], [4786995, 7180491], [7180492, 9573988], [9573989, 11967485], [11967486, 14360982], [14360983, 16754479], [16754480, 19147976], [19147977, 21541473], [21541474, 23934970], [23934971, 26328467], [26328468, 28721964], [28721965, 31115461], [31115462, 33508958], [33508959, 35902455], [35902456, 38295952], [38295953, 40689449], [40689450, 43082946], [43082947, 45476443], [45476444, 47869943]] SRR4237606 file size 16106356 SRR4237606 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237606 SRR4237606_1.fastq SRR4237606_2.fastq Input file: SRR4237606_1.fastq Paired file: SRR4237606_2.fastq trimmed: SRR4237606-trimmed-pair1.fastq, SRR4237606-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:12:04 2025 >> started Wed Feb 12 16:13:00 2025 >> done (56.553s) 47869943 read pairs processed; of these: 35855 ( 0.07%) short read pairs filtered out after trimming by size control 30779 ( 0.06%) empty read pairs filtered out after trimming by size control 47803309 (99.86%) read pairs available; of these: 17255681 (36.10%) trimmed read pairs available after processing 30547628 (63.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 14 0.00% 20 11 0.00% 21 6 0.00% 22 8 0.00% 23 17 0.00% 24 13 0.00% 25 9 0.00% 26 20 0.00% 27 5 0.00% 28 14 0.00% 29 12 0.00% 30 13 0.00% 31 22 0.00% 32 16 0.00% 33 16 0.00% 34 17 0.00% 35 30 0.00% 36 30 0.00% 37 37 0.00% 38 34 0.00% 39 39 0.00% 40 46 0.00% 41 72 0.00% 42 65 0.00% 43 69 0.00% 44 68 0.00% 45 108 0.00% 46 105 0.00% 47 99 0.00% 48 121 0.00% 49 166 0.00% 50 176 0.00% 51 170 0.00% 52 213 0.00% 53 228 0.00% 54 262 0.00% 55 245 0.00% 56 314 0.00% 57 359 0.00% 58 382 0.00% 59 415 0.00% 60 531 0.00% 61 577 0.00% 62 631 0.00% 63 795 0.00% 64 818 0.00% 65 1026 0.00% 66 1161 0.00% 67 1277 0.00% 68 1848 0.00% 69 3384 0.01% 70 3128 0.01% 71 2207 0.00% 72 2483 0.01% 73 2721 0.01% 74 3031 0.01% 75 3474 0.01% 76 3849 0.01% 77 4493 0.01% 78 4840 0.01% 79 5507 0.01% 80 6108 0.01% 81 6897 0.01% 82 8088 0.02% 83 9090 0.02% 84 11749 0.02% 85 12951 0.03% 86 14312 0.03% 87 16015 0.03% 88 17031 0.04% 89 18270 0.04% 90 21393 0.04% 91 22429 0.05% 92 24091 0.05% 93 26511 0.06% 94 29145 0.06% 95 33882 0.07% 96 35228 0.07% 97 38436 0.08% 98 38189 0.08% 99 40879 0.09% 100 44028 0.09% 101 46624 0.10% 102 50530 0.11% 103 53833 0.11% 104 57343 0.12% 105 61025 0.13% 106 65477 0.14% 107 67840 0.14% 108 70738 0.15% 109 74144 0.16% 110 76152 0.16% 111 81395 0.17% 112 84914 0.18% 113 88919 0.19% 114 93696 0.20% 115 98410 0.21% 116 102219 0.21% 117 108362 0.23% 118 111304 0.23% 119 112952 0.24% 120 116147 0.24% 121 121017 0.25% 122 124057 0.26% 123 128580 0.27% 124 133878 0.28% 125 138688 0.29% 126 143082 0.30% 127 149196 0.31% 128 153461 0.32% 129 158347 0.33% 130 162710 0.34% 131 167753 0.35% 132 171977 0.36% 133 178470 0.37% 134 183039 0.38% 135 190699 0.40% 136 199728 0.42% 137 206934 0.43% 138 217496 0.45% 139 227379 0.48% 140 239842 0.50% 141 256213 0.54% 142 278199 0.58% 143 299279 0.63% 144 340567 0.71% 145 396909 0.83% 146 477607 1.00% 147 667096 1.40% 148 1402079 2.93% 149 7592795 15.88% 150 30547628 63.90% 47803309 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=32 prefix-density=0.16 prefix-fanout=2.6 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=93.00 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=17.5 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGTTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGTAGTTATATTCACAGAGTTTCCTGTGGTGGTTACATTAAGCTCTAACCTGCCACCTGATCCTGCTTGTGTGGTCAGAGGGTTGCTCACAGTCTGGAACTGGGAACTTGATAGAAATTGTGGTATAATGTGAAACTGTACTAGCTCAGCCTTTTCTTGATCGCTTAGGGAGTTGAGG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=31 prefix-density=0.21 prefix-fanout=2.8 sequence=GAATCTTGCATGTCTAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=245.31 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=26.7 sequence=GAAGAAGAAGAAA SRR4237606 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:13:43 Started mapping on | Feb 12 16:13:43 Finished on | Feb 12 16:17:14 Mapping speed, Million of reads per hour | 815.60 Number of input reads | 47803309 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 46115260 Uniquely mapped reads % | 96.47% Average mapped length | 291.85 Number of splices: Total | 39110503 Number of splices: Annotated (sjdb) | 38419054 Number of splices: GT/AG | 38512698 Number of splices: GC/AG | 457639 Number of splices: AT/AC | 37700 Number of splices: Non-canonical | 102466 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 973617 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 92038 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.27% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 748102 748102 748102 N_multimapping 973617 973617 973617 N_noFeature 1293340 45517588 1564832 N_ambiguous 518565 3983 189145 UnstrandedReadsAssigned:44303355 PositiveStrandReadsAssigned:593689 NegativeStrandReadsAssigned:44361283 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237606 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237606-trimmed-pair1.fastq SRR4237606-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,803,309 reads, 44,149,455 reads pseudoaligned [quant] estimated average fragment length: 224.59 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR4237606.ke.tsv 34699 SRR4237606.se.tsv 87100 total ==> SRR4237606.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.41 907 11.5679 Potri.005G024800.1.v4.1 1035 811.41 179 5.04872 Potri.004G059700.1.v4.1 961 737.423 11 0.341386 Potri.007G009000.2.v4.1 1416 1192.41 0 0 Potri.003G141000.2.v4.1 2943 2719.41 584.169 4.91624 Potri.016G087400.1.v4.1 270 86.2158 5875.55 1559.66 Potri.015G069301.1.v4.1 564 343.483 0 0 Potri.010G195200.1.v4.1 1773 1549.41 276 4.07673 Potri.012G127500.1.v4.1 977 753.417 10811 328.397 ==> SRR4237606.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8521 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 674 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 45 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237606 completed mapping pipeline successfully