Starting /dee2/code/volunteer_pipeline.sh SRR4237607 current disk space = 3051965202432 free memory = 1581114752 SRR4237607 SRAfilesize 8cb84e8c7c8f2e9acf83026ab0bbbd66 SRR4237607.sra SRR4237607.sra file validated SRR4237607 is paired end SRR4237607 is conventional basespace SRR4237607 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237607_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.11175 34.0 33.0 34.0 18.0 34.0 2 32.6625 34.0 33.0 34.0 28.0 34.0 3 32.847 34.0 33.0 34.0 31.0 34.0 4 33.08625 34.0 33.0 34.0 32.0 34.0 5 33.144 34.0 33.0 34.0 32.0 34.0 6 36.9135 38.0 37.0 38.0 35.0 38.0 7 37.22475 38.0 38.0 38.0 36.0 38.0 8 37.31425 38.0 38.0 38.0 37.0 38.0 9 37.448 38.0 38.0 38.0 37.0 38.0 10-14 37.36945 38.0 38.0 38.0 37.0 38.0 15-19 37.366200000000006 38.0 38.0 38.0 37.0 38.0 20-24 36.644600000000004 38.0 37.0 38.0 32.4 38.0 25-29 35.517199999999995 38.0 35.8 38.0 27.8 38.0 30-34 37.001 38.0 38.0 38.0 35.8 38.0 35-39 37.1671 38.0 38.0 38.0 36.6 38.0 40-44 37.19205 38.0 38.0 38.0 36.6 38.0 45-49 37.237700000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.2462 38.0 38.0 38.0 37.0 38.0 55-59 37.21464999999999 38.0 38.0 38.0 36.8 38.0 60-64 37.1404 38.0 38.0 38.0 36.0 38.0 65-69 37.08595 38.0 38.0 38.0 36.0 38.0 70-74 35.57905 38.0 35.4 38.0 30.0 38.0 75-79 36.34905 38.0 37.4 38.0 32.8 38.0 80-84 36.949799999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.966049999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.89875 38.0 38.0 38.0 35.6 38.0 95-99 36.92585 38.0 38.0 38.0 35.6 38.0 100-104 36.8103 38.0 38.0 38.0 35.0 38.0 105-109 36.71469999999999 38.0 38.0 38.0 35.0 38.0 110-114 36.60945 38.0 38.0 38.0 34.4 38.0 115-119 36.60185 38.0 38.0 38.0 34.0 38.0 120-124 36.52005 38.0 38.0 38.0 34.0 38.0 125-129 35.491550000000004 38.0 36.6 38.0 28.8 38.0 130-134 34.8371 38.0 34.6 38.0 27.6 38.0 135-139 35.5676 38.0 36.4 38.0 31.4 38.0 140-144 35.25455 38.0 35.6 38.0 29.6 38.0 145-149 35.27635 38.0 36.0 38.0 31.2 38.0 150 30.29225 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 2.0 18 1.0 19 2.0 20 3.0 21 2.0 22 4.0 23 4.0 24 11.0 25 10.0 26 15.0 27 15.0 28 31.0 29 30.0 30 35.0 31 54.0 32 78.0 33 108.0 34 173.0 35 260.0 36 718.0 37 2440.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.455147667678716 10.654154016008832 9.080872205354678 42.80982611095777 2 22.6 15.25 36.125 26.025 3 21.25 18.675 26.25 33.825 4 24.05 27.375 21.9 26.674999999999997 5 22.75 34.775 23.599999999999998 18.875 6 18.05 37.2 24.55 20.200000000000003 7 14.399999999999999 26.3 40.025 19.275000000000002 8 16.25 25.775 32.800000000000004 25.174999999999997 9 16.950000000000003 24.125 34.425 24.5 10-14 19.42 29.955 27.189999999999998 23.435 15-19 19.53 28.720000000000002 28.09 23.66 20-24 19.470000000000002 29.125 27.834999999999997 23.57 25-29 19.62 29.285 27.615000000000002 23.48 30-34 19.965 29.044999999999998 26.935 24.055 35-39 20.27 28.634999999999998 27.544999999999998 23.549999999999997 40-44 19.755 28.815 28.050000000000004 23.380000000000003 45-49 20.49 28.23 27.665 23.615 50-54 20.0 28.335 27.48 24.185000000000002 55-59 19.875 28.970000000000002 27.04 24.115000000000002 60-64 19.82 29.195 27.295 23.69 65-69 20.16 29.14 27.075 23.625 70-74 20.150000000000002 28.77 27.46 23.62 75-79 20.385 28.125 27.51 23.98 80-84 20.16 28.465 27.3 24.075 85-89 20.52 28.384999999999998 27.650000000000002 23.445 90-94 20.395 28.46 27.565 23.580000000000002 95-99 19.96 28.694999999999997 27.605 23.74 100-104 20.515 28.860000000000003 27.18 23.445 105-109 20.294999999999998 28.499999999999996 27.425 23.78 110-114 20.46 28.21 27.575 23.755000000000003 115-119 20.72 28.99 26.650000000000002 23.64 120-124 20.22 28.525 27.85 23.405 125-129 20.21 28.315 27.32 24.154999999999998 130-134 20.605 28.67 26.805 23.919999999999998 135-139 20.87 28.720000000000002 26.495 23.915 140-144 20.825 28.449999999999996 26.534999999999997 24.19 145-149 20.565 28.660000000000004 26.540000000000003 24.235 150 19.675 28.7 27.175 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 2.5 26 5.0 27 5.0 28 6.5 29 13.5 30 20.5 31 28.0 32 36.0 33 40.5 34 48.0 35 64.5 36 87.5 37 105.0 38 128.5 39 152.5 40 186.5 41 233.0 42 264.5 43 285.5 44 283.0 45 282.0 46 270.5 47 250.5 48 224.5 49 192.5 50 165.5 51 136.0 52 108.5 53 81.0 54 72.0 55 63.5 56 44.0 57 26.0 58 22.0 59 17.5 60 7.5 61 4.5 62 5.5 63 5.5 64 3.0 65 2.0 66 2.0 67 2.5 68 3.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.95 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.824999999999999 0.0 0.0 0.0 0.0 136-137 5.3625 0.0 0.0 0.0 0.0 138 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAATC 10 0.006991776 143.875 3 >>END_MODULE SRR4237607 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237607_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.515 33.0 33.0 34.0 32.0 34.0 2 32.79725 33.0 33.0 34.0 32.0 34.0 3 32.7765 33.0 33.0 34.0 32.0 34.0 4 32.718 33.0 33.0 34.0 32.0 34.0 5 32.72175 33.0 33.0 34.0 32.0 34.0 6 34.2795 38.0 35.0 38.0 16.0 38.0 7 36.1365 38.0 37.0 38.0 31.0 38.0 8 36.43025 38.0 38.0 38.0 34.0 38.0 9 36.111 38.0 38.0 38.0 33.0 38.0 10-14 36.724250000000005 38.0 38.0 38.0 35.4 38.0 15-19 35.579499999999996 38.0 35.6 38.0 29.8 38.0 20-24 36.575649999999996 38.0 38.0 38.0 34.6 38.0 25-29 36.696250000000006 38.0 38.0 38.0 35.2 38.0 30-34 36.68775 38.0 38.0 38.0 35.2 38.0 35-39 36.01005 38.0 37.2 38.0 29.8 38.0 40-44 36.72735 38.0 38.0 38.0 35.0 38.0 45-49 36.60875 38.0 38.0 38.0 35.0 38.0 50-54 36.689099999999996 38.0 38.0 38.0 35.2 38.0 55-59 36.6512 38.0 38.0 38.0 35.0 38.0 60-64 36.6678 38.0 38.0 38.0 35.2 38.0 65-69 36.617200000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.612049999999996 38.0 38.0 38.0 34.8 38.0 75-79 35.866200000000006 38.0 37.4 38.0 29.4 38.0 80-84 36.40495 38.0 38.0 38.0 34.2 38.0 85-89 36.398849999999996 38.0 38.0 38.0 34.0 38.0 90-94 35.35165 37.8 35.6 38.0 30.2 38.0 95-99 35.73885 38.0 36.8 38.0 31.4 38.0 100-104 36.1119 38.0 38.0 38.0 33.4 38.0 105-109 36.058049999999994 38.0 38.0 38.0 33.4 38.0 110-114 36.06155 38.0 38.0 38.0 33.4 38.0 115-119 35.95335 38.0 38.0 38.0 33.0 38.0 120-124 35.69010000000001 38.0 37.4 38.0 31.4 38.0 125-129 35.56715 38.0 37.0 38.0 31.2 38.0 130-134 35.20725 38.0 36.4 38.0 29.4 38.0 135-139 35.047599999999996 38.0 36.2 38.0 28.6 38.0 140-144 34.6245 38.0 36.0 38.0 27.0 38.0 145-149 33.854099999999995 38.0 35.8 38.0 21.8 38.0 150 27.43925 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 1.0 5 5.0 6 1.0 7 1.0 8 2.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 4.0 16 3.0 17 3.0 18 6.0 19 7.0 20 10.0 21 9.0 22 9.0 23 19.0 24 15.0 25 16.0 26 34.0 27 32.0 28 39.0 29 49.0 30 59.0 31 64.0 32 65.0 33 112.0 34 145.0 35 247.0 36 561.0 37 2469.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.074999999999996 17.974999999999998 13.575000000000001 30.375000000000004 2 27.275 25.05 33.875 13.8 3 21.825 28.000000000000004 30.55 19.625 4 24.474999999999998 33.800000000000004 23.275000000000002 18.45 5 26.174999999999997 35.475 23.200000000000003 15.15 6 19.7 39.85 23.625 16.825000000000003 7 19.875 19.175 42.025 18.925 8 22.5 23.549999999999997 29.599999999999998 24.349999999999998 9 23.1 24.099999999999998 31.85 20.95 10-14 23.61 28.625 26.86 20.905 15-19 23.61 27.375 28.035 20.979999999999997 20-24 22.855 27.855 28.215 21.075 25-29 23.35 28.084999999999997 27.915 20.65 30-34 23.385 27.994999999999997 28.205000000000002 20.415 35-39 23.1 27.725 28.43 20.745 40-44 23.605 27.705000000000002 28.03 20.66 45-49 23.16 28.225 28.110000000000003 20.505000000000003 50-54 23.575 27.544999999999998 28.42 20.46 55-59 23.515 27.85 27.865000000000002 20.77 60-64 23.0 28.294999999999998 28.249999999999996 20.455000000000002 65-69 23.78 27.950000000000003 27.925 20.345 70-74 23.810000000000002 28.299999999999997 27.725 20.165 75-79 23.9 27.625 27.994999999999997 20.48 80-84 23.76 27.439999999999998 27.96 20.84 85-89 24.32 27.735 27.525 20.419999999999998 90-94 23.24 27.485 28.945 20.330000000000002 95-99 23.599999999999998 27.82 28.139999999999997 20.44 100-104 23.51 27.810000000000002 28.134999999999998 20.544999999999998 105-109 24.235 26.96 28.610000000000003 20.195 110-114 23.785 27.250000000000004 28.749999999999996 20.215 115-119 23.974999999999998 27.735 28.375 19.915 120-124 24.195 27.13 27.975 20.7 125-129 24.15 28.155 27.315 20.380000000000003 130-134 24.865000000000002 27.544999999999998 27.755000000000003 19.835 135-139 24.29 27.689999999999998 27.685 20.335 140-144 24.315 27.584999999999997 28.08 20.02 145-149 25.03 28.015 27.529999999999998 19.425 150 24.425 28.199999999999996 27.500000000000004 19.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 4.0 26 6.0 27 7.0 28 8.5 29 10.0 30 13.0 31 18.5 32 29.0 33 34.5 34 38.0 35 60.0 36 84.5 37 98.0 38 126.5 39 154.0 40 186.5 41 233.5 42 260.5 43 270.5 44 297.5 45 316.0 46 297.0 47 270.5 48 235.5 49 194.0 50 155.5 51 130.5 52 112.5 53 85.5 54 65.0 55 53.0 56 38.0 57 26.0 58 20.0 59 16.0 60 12.0 61 6.5 62 4.5 63 3.5 64 2.5 65 2.5 66 2.0 67 1.0 68 0.0 69 0.0 70 1.0 71 2.5 72 1.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.9749999999999996 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.8125 0.0 0.0 0.0 0.0 136-137 5.3625 0.0 0.0 0.0 0.0 138 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAATC 10 0.006973645 144.0 2 >>END_MODULE Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869120 spots for SRR4237607.sra Written 2869120 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra Read 2869117 spots for SRR4237607.sra Written 2869117 spots for SRR4237607.sra SRR ids: ['SRR4237607.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yfbsrjcj SRR4237607.sra spots: 57382343 blocks: [[1, 2869117], [2869118, 5738234], [5738235, 8607351], [8607352, 11476468], [11476469, 14345585], [14345586, 17214702], [17214703, 20083819], [20083820, 22952936], [22952937, 25822053], [25822054, 28691170], [28691171, 31560287], [31560288, 34429404], [34429405, 37298521], [37298522, 40167638], [40167639, 43036755], [43036756, 45905872], [45905873, 48774989], [48774990, 51644106], [51644107, 54513223], [54513224, 57382343]] SRR4237607 file size 19311217 SRR4237607 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237607 SRR4237607_1.fastq SRR4237607_2.fastq Input file: SRR4237607_1.fastq Paired file: SRR4237607_2.fastq trimmed: SRR4237607-trimmed-pair1.fastq, SRR4237607-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:27:11 2025 >> started Wed Feb 12 16:28:15 2025 >> done (63.976s) 57382343 read pairs processed; of these: 42342 ( 0.07%) short read pairs filtered out after trimming by size control 31614 ( 0.06%) empty read pairs filtered out after trimming by size control 57308387 (99.87%) read pairs available; of these: 19477181 (33.99%) trimmed read pairs available after processing 37831206 (66.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 7 0.00% 20 10 0.00% 21 17 0.00% 22 12 0.00% 23 13 0.00% 24 8 0.00% 25 12 0.00% 26 13 0.00% 27 24 0.00% 28 18 0.00% 29 17 0.00% 30 30 0.00% 31 26 0.00% 32 17 0.00% 33 35 0.00% 34 18 0.00% 35 26 0.00% 36 29 0.00% 37 42 0.00% 38 42 0.00% 39 38 0.00% 40 53 0.00% 41 57 0.00% 42 70 0.00% 43 79 0.00% 44 80 0.00% 45 103 0.00% 46 93 0.00% 47 112 0.00% 48 124 0.00% 49 143 0.00% 50 175 0.00% 51 172 0.00% 52 184 0.00% 53 226 0.00% 54 232 0.00% 55 264 0.00% 56 294 0.00% 57 365 0.00% 58 326 0.00% 59 387 0.00% 60 465 0.00% 61 532 0.00% 62 561 0.00% 63 694 0.00% 64 757 0.00% 65 831 0.00% 66 1015 0.00% 67 1170 0.00% 68 1985 0.00% 69 3699 0.01% 70 3086 0.01% 71 1979 0.00% 72 2082 0.00% 73 2270 0.00% 74 2684 0.00% 75 2901 0.01% 76 3288 0.01% 77 3577 0.01% 78 4136 0.01% 79 4646 0.01% 80 5219 0.01% 81 5771 0.01% 82 6883 0.01% 83 7866 0.01% 84 11771 0.02% 85 12629 0.02% 86 13759 0.02% 87 15092 0.03% 88 16173 0.03% 89 17532 0.03% 90 18472 0.03% 91 20102 0.04% 92 21903 0.04% 93 23972 0.04% 94 25987 0.05% 95 27827 0.05% 96 30135 0.05% 97 32513 0.06% 98 34904 0.06% 99 36830 0.06% 100 38849 0.07% 101 42027 0.07% 102 44876 0.08% 103 47903 0.08% 104 50684 0.09% 105 54397 0.09% 106 58124 0.10% 107 61268 0.11% 108 63949 0.11% 109 67543 0.12% 110 70268 0.12% 111 73999 0.13% 112 77554 0.14% 113 81600 0.14% 114 85923 0.15% 115 90571 0.16% 116 94994 0.17% 117 99282 0.17% 118 103202 0.18% 119 106166 0.19% 120 109627 0.19% 121 114028 0.20% 122 117895 0.21% 123 121962 0.21% 124 128543 0.22% 125 133041 0.23% 126 139279 0.24% 127 145445 0.25% 128 150865 0.26% 129 156428 0.27% 130 162649 0.28% 131 167943 0.29% 132 175258 0.31% 133 183096 0.32% 134 189811 0.33% 135 198538 0.35% 136 209640 0.37% 137 220652 0.39% 138 235166 0.41% 139 250187 0.44% 140 266601 0.47% 141 286718 0.50% 142 311333 0.54% 143 345815 0.60% 144 392786 0.69% 145 468612 0.82% 146 592288 1.03% 147 833319 1.45% 148 1551094 2.71% 149 9273678 16.18% 150 37831206 66.01% 57308387 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=140.57 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=19.2 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.2 sequence=AGTTCCAATGGCCACTGT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=251.91 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=28.8 sequence=AAGAAGAAGAAA SRR4237607 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:28:58 Started mapping on | Feb 12 16:28:58 Finished on | Feb 12 16:34:16 Mapping speed, Million of reads per hour | 648.77 Number of input reads | 57308387 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 55314842 Uniquely mapped reads % | 96.52% Average mapped length | 293.31 Number of splices: Total | 50333026 Number of splices: Annotated (sjdb) | 49475256 Number of splices: GT/AG | 49586529 Number of splices: GC/AG | 585566 Number of splices: AT/AC | 44803 Number of splices: Non-canonical | 116128 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1009195 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 97311 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.51% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1032742 1032742 1032742 N_multimapping 1009195 1009195 1009195 N_noFeature 1524117 54655776 1908460 N_ambiguous 524080 4296 245940 UnstrandedReadsAssigned:53266645 PositiveStrandReadsAssigned:654770 NegativeStrandReadsAssigned:53160442 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237607 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237607-trimmed-pair1.fastq SRR4237607-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,308,387 reads, 52,905,705 reads pseudoaligned [quant] estimated average fragment length: 237.084 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,333 rounds 52401 SRR4237607.ke.tsv 34699 SRR4237607.se.tsv 87100 total ==> SRR4237607.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.92 1109 12.5077 Potri.005G024800.1.v4.1 1035 798.916 140 3.52176 Potri.004G059700.1.v4.1 961 724.933 19 0.52673 Potri.007G009000.2.v4.1 1416 1179.92 0 0 Potri.003G141000.2.v4.1 2943 2706.92 945.074 7.01655 Potri.016G087400.1.v4.1 270 81.001 7175.67 1780.35 Potri.015G069301.1.v4.1 564 332.329 0 0 Potri.010G195200.1.v4.1 1773 1536.92 136.819 1.78908 Potri.012G127500.1.v4.1 977 740.927 13170 357.225 ==> SRR4237607.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6573 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 697 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 37 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR4237607 completed mapping pipeline successfully