Starting /dee2/code/volunteer_pipeline.sh SRR4237608 current disk space = 3051647324160 free memory = 1491408808 SRR4237608 SRAfilesize fea0e2b1fd39032ffd00fcac870d92d1 SRR4237608.sra SRR4237608.sra file validated SRR4237608 is paired end SRR4237608 is conventional basespace SRR4237608 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237608_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36875 34.0 33.0 34.0 33.0 34.0 2 33.4765 34.0 34.0 34.0 33.0 34.0 3 33.491 34.0 34.0 34.0 33.0 34.0 4 33.44825 34.0 34.0 34.0 33.0 34.0 5 33.47525 34.0 34.0 34.0 33.0 34.0 6 36.7695 38.0 37.0 38.0 35.0 38.0 7 37.31075 38.0 38.0 38.0 37.0 38.0 8 37.447 38.0 38.0 38.0 37.0 38.0 9 37.55925 38.0 38.0 38.0 37.0 38.0 10-14 37.50965 38.0 38.0 38.0 37.8 38.0 15-19 37.54785 38.0 38.0 38.0 38.0 38.0 20-24 37.535999999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.4858 38.0 38.0 38.0 37.6 38.0 30-34 37.30745 38.0 38.0 38.0 37.0 38.0 35-39 37.497350000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.38135 38.0 38.0 38.0 37.0 38.0 45-49 37.37495 38.0 38.0 38.0 37.0 38.0 50-54 37.22154999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.197950000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.28425 38.0 38.0 38.0 37.0 38.0 65-69 37.2861 38.0 38.0 38.0 37.0 38.0 70-74 37.224900000000005 38.0 38.0 38.0 36.8 38.0 75-79 37.18585 38.0 38.0 38.0 36.6 38.0 80-84 37.0972 38.0 38.0 38.0 36.0 38.0 85-89 37.036550000000005 38.0 38.0 38.0 36.0 38.0 90-94 37.04615 38.0 38.0 38.0 36.0 38.0 95-99 37.0441 38.0 38.0 38.0 36.0 38.0 100-104 36.94155 38.0 38.0 38.0 35.8 38.0 105-109 36.7628 38.0 38.0 38.0 35.0 38.0 110-114 36.7093 38.0 38.0 38.0 35.2 38.0 115-119 36.07695 38.0 37.2 38.0 32.0 38.0 120-124 36.6 38.0 38.0 38.0 34.4 38.0 125-129 36.476150000000004 38.0 38.0 38.0 34.0 38.0 130-134 36.31615000000001 38.0 38.0 38.0 34.0 38.0 135-139 36.24175 38.0 38.0 38.0 34.0 38.0 140-144 36.0483 38.0 38.0 38.0 33.6 38.0 145-149 34.937200000000004 38.0 36.0 38.0 28.0 38.0 150 30.3085 35.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 4.0 23 8.0 24 6.0 25 9.0 26 9.0 27 15.0 28 14.0 29 34.0 30 34.0 31 43.0 32 49.0 33 64.0 34 90.0 35 158.0 36 481.0 37 2974.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.07416687546981 11.651215234277124 9.571535955900776 34.70308193435229 2 22.825 14.524999999999999 35.525 27.125 3 20.625 19.875 26.400000000000002 33.1 4 21.8304576144036 29.48237059264816 24.256064016004 24.431107776944234 5 23.225 32.324999999999996 25.525 18.925 6 18.15 35.325 24.675 21.85 7 13.925 28.175 40.699999999999996 17.2 8 16.2 26.5 31.15 26.150000000000002 9 17.549999999999997 24.925 33.825 23.7 10-14 20.165 30.5 26.810000000000002 22.525000000000002 15-19 20.1 28.775000000000002 27.400000000000002 23.724999999999998 20-24 19.79 29.165000000000003 27.944999999999997 23.1 25-29 19.975 28.645 27.46 23.919999999999998 30-34 19.634999999999998 29.53 27.005000000000003 23.830000000000002 35-39 19.79 29.13 27.555000000000003 23.525 40-44 19.705000000000002 29.325000000000003 26.775 24.195 45-49 20.32 28.884999999999998 27.05 23.745 50-54 19.755 28.705000000000002 27.875 23.665 55-59 20.29 28.88 27.575 23.255 60-64 19.935 28.515 27.43 24.12 65-69 19.275000000000002 29.049999999999997 27.61 24.065 70-74 20.169999999999998 28.970000000000002 27.255000000000003 23.605 75-79 19.775000000000002 28.999999999999996 27.455000000000002 23.77 80-84 19.97 28.28 27.52 24.23 85-89 19.975 28.994999999999997 27.295 23.735 90-94 19.91 28.525 27.525 24.04 95-99 20.41 28.084999999999997 27.68 23.825 100-104 20.380000000000003 28.050000000000004 27.939999999999998 23.630000000000003 105-109 20.345 28.215 27.35 24.09 110-114 20.48 28.725 27.305 23.49 115-119 20.424999999999997 28.265 27.169999999999998 24.14 120-124 20.325 28.345 26.955000000000002 24.375 125-129 20.46 28.275 27.095000000000002 24.169999999999998 130-134 21.19 28.82 26.83 23.16 135-139 20.89 28.305000000000003 27.125 23.68 140-144 20.43 28.294999999999998 27.279999999999998 23.995 145-149 20.715 28.46 27.0 23.825 150 21.157232704402514 28.251572327044027 26.566037735849058 24.0251572327044 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 1.5 24 2.5 25 2.5 26 6.5 27 10.5 28 8.5 29 12.0 30 24.0 31 26.0 32 31.0 33 46.0 34 54.5 35 71.0 36 82.5 37 112.0 38 140.0 39 152.5 40 181.0 41 214.0 42 245.0 43 264.0 44 279.0 45 275.5 46 269.5 47 257.0 48 230.0 49 205.0 50 173.0 51 144.5 52 118.0 53 92.0 54 68.5 55 47.0 56 36.0 57 30.5 58 24.0 59 17.5 60 11.0 61 7.0 62 6.0 63 5.0 64 3.5 65 3.0 66 3.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2125 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.2374999999999998 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.9875 0.0 0.0 0.0 0.0 124-125 2.4 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.1375 0.0 0.0 0.0 0.0 132-133 3.4625 0.0 0.0 0.0 0.0 134-135 3.7625 0.0 0.0 0.0 0.0 136-137 4.0875 0.0 0.0 0.0 0.0 138 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTTT 10 0.006973645 144.0 8 AAAAAAA 20 0.006139246 28.8 50-54 >>END_MODULE SRR4237608 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237608_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99 33.0 33.0 34.0 32.0 34.0 2 32.82825 34.0 33.0 34.0 32.0 34.0 3 32.9635 34.0 33.0 34.0 32.0 34.0 4 33.004 34.0 33.0 34.0 32.0 34.0 5 32.95225 34.0 33.0 34.0 32.0 34.0 6 37.052 38.0 38.0 38.0 37.0 38.0 7 37.15575 38.0 38.0 38.0 37.0 38.0 8 37.126 38.0 38.0 38.0 37.0 38.0 9 37.12725 38.0 38.0 38.0 37.0 38.0 10-14 37.083000000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.0616 38.0 38.0 38.0 37.0 38.0 20-24 37.090799999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.0231 38.0 38.0 38.0 36.8 38.0 30-34 36.416250000000005 38.0 37.6 38.0 33.8 38.0 35-39 37.01105 38.0 38.0 38.0 37.0 38.0 40-44 35.2944 38.0 35.4 38.0 26.6 38.0 45-49 36.04155 38.0 36.8 38.0 30.8 38.0 50-54 36.6149 38.0 38.0 38.0 35.2 38.0 55-59 36.924800000000005 38.0 38.0 38.0 36.8 38.0 60-64 36.91715000000001 38.0 38.0 38.0 36.8 38.0 65-69 36.9661 38.0 38.0 38.0 37.0 38.0 70-74 36.8915 38.0 38.0 38.0 36.4 38.0 75-79 36.842999999999996 38.0 38.0 38.0 36.6 38.0 80-84 36.846700000000006 38.0 38.0 38.0 36.2 38.0 85-89 36.7622 38.0 38.0 38.0 36.0 38.0 90-94 36.7024 38.0 38.0 38.0 36.0 38.0 95-99 36.706900000000005 38.0 38.0 38.0 36.0 38.0 100-104 36.68575 38.0 38.0 38.0 36.0 38.0 105-109 36.6276 38.0 38.0 38.0 35.8 38.0 110-114 36.5317 38.0 38.0 38.0 35.4 38.0 115-119 36.466899999999995 38.0 38.0 38.0 35.0 38.0 120-124 36.33225 38.0 38.0 38.0 34.8 38.0 125-129 36.16135 38.0 38.0 38.0 34.0 38.0 130-134 36.1526 38.0 38.0 38.0 34.0 38.0 135-139 35.98195 38.0 38.0 38.0 33.8 38.0 140-144 35.765699999999995 38.0 38.0 38.0 33.2 38.0 145-149 35.498400000000004 38.0 38.0 38.0 33.0 38.0 150 29.8465 35.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 8.0 4 6.0 5 2.0 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 4.0 12 1.0 13 0.0 14 1.0 15 3.0 16 8.0 17 3.0 18 2.0 19 5.0 20 2.0 21 4.0 22 5.0 23 7.0 24 8.0 25 9.0 26 15.0 27 14.0 28 28.0 29 19.0 30 34.0 31 39.0 32 42.0 33 64.0 34 91.0 35 148.0 36 401.0 37 3010.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.1 22.2 11.450000000000001 24.25 2 28.125 25.775 30.725 15.375 3 21.25 28.925 31.275 18.55 4 24.65 34.025 23.275000000000002 18.05 5 26.05 35.425000000000004 22.7 15.825 6 21.675 37.875 22.425 18.025 7 19.2 20.925 40.400000000000006 19.475 8 22.525000000000002 24.3 29.025000000000002 24.15 9 22.125 24.025 30.45 23.400000000000002 10-14 23.5 28.725 26.93 20.845 15-19 23.49 27.61 28.015 20.885 20-24 23.49 28.205000000000002 27.985 20.32 25-29 23.455000000000002 28.044999999999998 27.58 20.919999999999998 30-34 23.06 27.87 28.044999999999998 21.025 35-39 23.369999999999997 28.53 27.415 20.685000000000002 40-44 23.39 27.994999999999997 27.97 20.645 45-49 23.555 27.644999999999996 28.125 20.674999999999997 50-54 23.28 28.475 27.715 20.53 55-59 23.849999999999998 27.955000000000002 27.525 20.669999999999998 60-64 23.78 28.794999999999998 27.515 19.91 65-69 24.035 27.400000000000002 28.26 20.305 70-74 23.595 27.79 27.96 20.655 75-79 23.94 28.09 27.73 20.24 80-84 23.785 27.689999999999998 28.345 20.18 85-89 23.395 27.505000000000003 28.499999999999996 20.599999999999998 90-94 23.645 27.265 28.585 20.505000000000003 95-99 23.565 27.87 27.825 20.74 100-104 23.61 27.79 28.24 20.36 105-109 24.335 27.18 28.525 19.96 110-114 24.09 27.655 28.42 19.835 115-119 24.47 27.405 28.01 20.115 120-124 24.45 27.305 27.76 20.485 125-129 24.035 27.98 27.485 20.5 130-134 24.57 27.495000000000005 27.705000000000002 20.23 135-139 24.255 28.46 27.065 20.22 140-144 24.34 28.175 27.395000000000003 20.09 145-149 24.365000000000002 28.215 27.865000000000002 19.555 150 24.75 28.249999999999996 26.85 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 2.5 24 3.0 25 1.5 26 3.0 27 5.0 28 6.0 29 11.0 30 14.0 31 14.5 32 26.5 33 38.5 34 38.0 35 47.5 36 68.5 37 98.0 38 120.5 39 141.5 40 203.5 41 249.5 42 256.0 43 278.0 44 288.5 45 285.0 46 294.0 47 275.0 48 249.5 49 229.5 50 180.5 51 139.5 52 113.0 53 81.0 54 58.5 55 47.5 56 37.5 57 26.5 58 19.0 59 12.5 60 7.5 61 6.0 62 4.5 63 4.5 64 2.5 65 1.0 66 2.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2125 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.6500000000000004 0.0 0.0 0.0 0.0 128-129 2.9124999999999996 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.5375 0.0 0.0 0.0 0.0 134-135 3.8375000000000004 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138 4.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTGAT 10 0.006973645 144.0 5 >>END_MODULE Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888338 spots for SRR4237608.sra Written 2888338 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra Read 2888332 spots for SRR4237608.sra Written 2888332 spots for SRR4237608.sra SRR ids: ['SRR4237608.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_509yibd4 SRR4237608.sra spots: 57766646 blocks: [[1, 2888332], [2888333, 5776664], [5776665, 8664996], [8664997, 11553328], [11553329, 14441660], [14441661, 17329992], [17329993, 20218324], [20218325, 23106656], [23106657, 25994988], [25994989, 28883320], [28883321, 31771652], [31771653, 34659984], [34659985, 37548316], [37548317, 40436648], [40436649, 43324980], [43324981, 46213312], [46213313, 49101644], [49101645, 51989976], [51989977, 54878308], [54878309, 57766646]] SRR4237608 file size 19440695 SRR4237608 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237608 SRR4237608_1.fastq SRR4237608_2.fastq Input file: SRR4237608_1.fastq Paired file: SRR4237608_2.fastq trimmed: SRR4237608-trimmed-pair1.fastq, SRR4237608-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:49:53 2025 >> started Wed Feb 12 15:51:01 2025 >> done (68.843s) 57766646 read pairs processed; of these: 119604 ( 0.21%) short read pairs filtered out after trimming by size control 47779 ( 0.08%) empty read pairs filtered out after trimming by size control 57599263 (99.71%) read pairs available; of these: 18078077 (31.39%) trimmed read pairs available after processing 39521186 (68.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 13 0.00% 20 7 0.00% 21 4 0.00% 22 9 0.00% 23 15 0.00% 24 12 0.00% 25 11 0.00% 26 16 0.00% 27 20 0.00% 28 18 0.00% 29 12 0.00% 30 27 0.00% 31 21 0.00% 32 17 0.00% 33 25 0.00% 34 29 0.00% 35 33 0.00% 36 31 0.00% 37 38 0.00% 38 43 0.00% 39 51 0.00% 40 55 0.00% 41 58 0.00% 42 67 0.00% 43 72 0.00% 44 79 0.00% 45 87 0.00% 46 99 0.00% 47 105 0.00% 48 111 0.00% 49 143 0.00% 50 142 0.00% 51 147 0.00% 52 186 0.00% 53 179 0.00% 54 220 0.00% 55 228 0.00% 56 260 0.00% 57 289 0.00% 58 347 0.00% 59 342 0.00% 60 397 0.00% 61 490 0.00% 62 514 0.00% 63 658 0.00% 64 698 0.00% 65 706 0.00% 66 828 0.00% 67 1113 0.00% 68 1541 0.00% 69 3162 0.01% 70 3224 0.01% 71 1740 0.00% 72 1791 0.00% 73 1968 0.00% 74 2113 0.00% 75 2352 0.00% 76 2718 0.00% 77 3004 0.01% 78 3368 0.01% 79 3827 0.01% 80 4338 0.01% 81 4711 0.01% 82 5560 0.01% 83 7334 0.01% 84 18795 0.03% 85 16703 0.03% 86 14790 0.03% 87 15231 0.03% 88 17196 0.03% 89 18140 0.03% 90 16757 0.03% 91 18243 0.03% 92 22641 0.04% 93 22781 0.04% 94 24267 0.04% 95 24749 0.04% 96 26558 0.05% 97 27708 0.05% 98 29013 0.05% 99 31484 0.05% 100 32949 0.06% 101 35080 0.06% 102 38848 0.07% 103 40444 0.07% 104 42724 0.07% 105 45844 0.08% 106 48453 0.08% 107 51602 0.09% 108 56066 0.10% 109 57138 0.10% 110 59102 0.10% 111 64007 0.11% 112 65892 0.11% 113 69216 0.12% 114 73139 0.13% 115 76671 0.13% 116 80063 0.14% 117 84054 0.15% 118 87913 0.15% 119 90038 0.16% 120 94805 0.16% 121 96979 0.17% 122 100436 0.17% 123 104060 0.18% 124 109580 0.19% 125 114604 0.20% 126 118745 0.21% 127 123871 0.22% 128 127803 0.22% 129 133844 0.23% 130 138396 0.24% 131 142850 0.25% 132 148532 0.26% 133 155629 0.27% 134 161140 0.28% 135 169367 0.29% 136 178128 0.31% 137 187652 0.33% 138 197936 0.34% 139 208737 0.36% 140 222601 0.39% 141 240533 0.42% 142 262339 0.46% 143 290323 0.50% 144 332357 0.58% 145 405892 0.70% 146 521692 0.91% 147 807932 1.40% 148 1346773 2.34% 149 9228409 16.02% 150 39521186 68.61% 57599263 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=40 prefix-density=0.17 prefix-fanout=2.4 sequence=CGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGGCAGTCAAAGATGAGATCACCTGAGAAACAAGGCGGTTAAGATTGGTGTAAGTGGGACGCTCAATGTCAAGAGAGCGCCTGCAAATGTCATAGATGGCCTCATTGTCAAGGAGCACAGCAACATCAGTATGCTCAAGGAGAGAGTGAGTTGAAAGGACACTGTTGTAGGGCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=115.77 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=17.3 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=38 prefix-density=0.22 prefix-fanout=2.0 sequence=TGCATTTCGATT criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=209.04 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=24.8 sequence=GAAGAAGAAGAAA SRR4237608 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:51:52 Started mapping on | Feb 12 15:51:52 Finished on | Feb 12 15:57:28 Mapping speed, Million of reads per hour | 617.13 Number of input reads | 57599263 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 55210223 Uniquely mapped reads % | 95.85% Average mapped length | 294.04 Number of splices: Total | 50742655 Number of splices: Annotated (sjdb) | 49855336 Number of splices: GT/AG | 49992121 Number of splices: GC/AG | 591688 Number of splices: AT/AC | 45462 Number of splices: Non-canonical | 113384 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1151098 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 46823 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1314256 1314256 1314256 N_multimapping 1151098 1151098 1151098 N_noFeature 1529701 54562587 1873222 N_ambiguous 546087 3275 239548 UnstrandedReadsAssigned:53134435 PositiveStrandReadsAssigned:644361 NegativeStrandReadsAssigned:53097453 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237608 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237608-trimmed-pair1.fastq SRR4237608-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,599,263 reads, 52,847,025 reads pseudoaligned [quant] estimated average fragment length: 243.703 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR4237608.ke.tsv 34699 SRR4237608.se.tsv 87100 total ==> SRR4237608.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.3 1226 13.8787 Potri.005G024800.1.v4.1 1035 792.297 135 3.42432 Potri.004G059700.1.v4.1 961 718.345 7 0.195836 Potri.007G009000.2.v4.1 1416 1173.3 0 0 Potri.003G141000.2.v4.1 2943 2700.3 831.091 6.18536 Potri.016G087400.1.v4.1 270 78.1581 5942.82 1528.08 Potri.015G069301.1.v4.1 564 326.529 0 0 Potri.010G195200.1.v4.1 1773 1530.3 212 2.78412 Potri.012G127500.1.v4.1 977 734.324 16170 442.538 ==> SRR4237608.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6130 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 714 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR4237608 completed mapping pipeline successfully