Starting /dee2/code/volunteer_pipeline.sh SRR4237609 current disk space = 3051723386880 free memory = 1506474204 SRR4237609 SRAfilesize cda8fb91b53cbeb261b0918c190f8b40 SRR4237609.sra SRR4237609.sra file validated SRR4237609 is paired end SRR4237609 is conventional basespace SRR4237609 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237609_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.784 33.0 32.0 34.0 2.0 34.0 2 32.15125 33.0 32.0 34.0 27.0 34.0 3 32.37475 34.0 32.0 34.0 28.0 34.0 4 32.698 34.0 33.0 34.0 32.0 34.0 5 32.7855 34.0 33.0 34.0 32.0 34.0 6 36.62475 38.0 37.0 38.0 34.0 38.0 7 36.95475 38.0 38.0 38.0 35.0 38.0 8 36.9785 38.0 38.0 38.0 35.0 38.0 9 37.1675 38.0 38.0 38.0 36.0 38.0 10-14 37.201950000000004 38.0 38.0 38.0 36.2 38.0 15-19 37.15715 38.0 38.0 38.0 36.0 38.0 20-24 37.192949999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.6891 38.0 37.8 38.0 34.2 38.0 30-34 36.700450000000004 38.0 38.0 38.0 34.6 38.0 35-39 36.947250000000004 38.0 38.0 38.0 35.8 38.0 40-44 37.00195 38.0 38.0 38.0 36.0 38.0 45-49 36.97265 38.0 38.0 38.0 36.0 38.0 50-54 36.7315 38.0 37.8 38.0 34.6 38.0 55-59 36.36875 38.0 37.6 38.0 33.2 38.0 60-64 36.6934 38.0 38.0 38.0 34.6 38.0 65-69 36.74665 38.0 38.0 38.0 34.8 38.0 70-74 34.6652 37.0 32.0 38.0 29.2 38.0 75-79 36.351150000000004 38.0 37.4 38.0 33.4 38.0 80-84 34.5942 37.4 32.0 38.0 27.6 38.0 85-89 36.176100000000005 38.0 37.2 38.0 32.6 38.0 90-94 36.1971 38.0 37.2 38.0 32.8 38.0 95-99 36.39919999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.26120000000001 38.0 37.6 38.0 33.4 38.0 105-109 36.0458 38.0 37.0 38.0 32.8 38.0 110-114 35.5924 38.0 36.6 38.0 30.4 38.0 115-119 35.6561 38.0 36.8 38.0 30.8 38.0 120-124 35.1632 38.0 36.0 38.0 27.6 38.0 125-129 34.378550000000004 38.0 34.4 38.0 24.4 38.0 130-134 34.5711 38.0 35.0 38.0 25.2 38.0 135-139 34.517399999999995 38.0 35.0 38.0 24.8 38.0 140-144 33.83615 37.6 33.8 38.0 23.6 38.0 145-149 33.2594 37.8 34.2 38.0 19.2 38.0 150 26.195 34.0 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 3.0 19 5.0 20 2.0 21 6.0 22 14.0 23 7.0 24 17.0 25 12.0 26 28.0 27 33.0 28 47.0 29 54.0 30 72.0 31 80.0 32 124.0 33 164.0 34 244.0 35 342.0 36 813.0 37 1929.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.734693877551024 10.06036217303823 8.508192009198046 44.69675194021271 2 21.525 15.1 38.35 25.025 3 20.849999999999998 18.85 25.674999999999997 34.625 4 23.849999999999998 27.575 22.3 26.275 5 21.875 35.475 23.724999999999998 18.925 6 19.1 34.675 26.05 20.175 7 13.15 26.8 42.3 17.75 8 16.05 25.124999999999996 33.85 24.975 9 17.275 24.45 34.050000000000004 24.224999999999998 10-14 19.145 30.0 27.375 23.48 15-19 19.689999999999998 29.044999999999998 27.22 24.044999999999998 20-24 19.53 28.754999999999995 27.68 24.035 25-29 19.21 29.29 27.689999999999998 23.810000000000002 30-34 19.71 29.17 27.045 24.075 35-39 19.835 28.78 27.439999999999998 23.945 40-44 19.415 28.845 27.915 23.825 45-49 19.785 28.465 27.965 23.785 50-54 20.01 28.76 27.325 23.905 55-59 19.62 29.38 27.37 23.630000000000003 60-64 19.585 28.825 27.715 23.875 65-69 19.535 28.71 28.105000000000004 23.65 70-74 19.735 29.14 27.47 23.655 75-79 20.05 28.475 28.310000000000002 23.165 80-84 20.26 29.695 27.229999999999997 22.814999999999998 85-89 19.79 28.98 27.544999999999998 23.685000000000002 90-94 20.150000000000002 28.565 27.46 23.825 95-99 19.775000000000002 28.515 28.255000000000003 23.455000000000002 100-104 20.185 29.18 27.255000000000003 23.380000000000003 105-109 19.925 28.9 27.66 23.515 110-114 20.200000000000003 28.665000000000003 27.560000000000002 23.575 115-119 20.555 28.7 27.224999999999998 23.52 120-124 20.505000000000003 28.225 27.075 24.195 125-129 20.435 28.439999999999998 27.47 23.655 130-134 20.330000000000002 28.935 27.18 23.555 135-139 20.4 28.595 27.245 23.76 140-144 20.315 28.175 27.82 23.69 145-149 20.625 29.165000000000003 26.945000000000004 23.265 150 20.325 29.825000000000003 27.175 22.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 2.0 21 2.0 22 1.5 23 2.0 24 1.5 25 3.5 26 5.5 27 7.5 28 12.0 29 15.0 30 20.0 31 27.0 32 34.0 33 45.5 34 57.5 35 69.0 36 87.0 37 113.5 38 148.5 39 182.5 40 204.5 41 224.5 42 248.5 43 260.5 44 269.5 45 272.5 46 264.0 47 260.5 48 244.0 49 198.0 50 153.5 51 123.5 52 101.0 53 95.5 54 76.0 55 46.0 56 35.5 57 24.5 58 15.0 59 14.0 60 9.5 61 5.5 62 4.5 63 4.0 64 2.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.2249999999999996 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 5.0125 0.0 0.0 0.0 0.0 132-133 5.425 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.2 0.0 0.0 0.0 0.0 138 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237609 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237609_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.305 33.0 33.0 34.0 31.0 34.0 2 32.0985 33.0 33.0 34.0 31.0 34.0 3 32.288 33.0 33.0 34.0 31.0 34.0 4 32.358 33.0 33.0 34.0 31.0 34.0 5 32.353 33.0 33.0 34.0 31.0 34.0 6 36.365 38.0 38.0 38.0 34.0 38.0 7 36.1515 38.0 38.0 38.0 33.0 38.0 8 36.09375 38.0 38.0 38.0 33.0 38.0 9 36.35325 38.0 38.0 38.0 34.0 38.0 10-14 36.41775 38.0 38.0 38.0 33.6 38.0 15-19 36.444500000000005 38.0 38.0 38.0 34.0 38.0 20-24 36.5107 38.0 38.0 38.0 33.8 38.0 25-29 36.3969 38.0 38.0 38.0 33.4 38.0 30-34 36.4085 38.0 38.0 38.0 34.0 38.0 35-39 36.417500000000004 38.0 38.0 38.0 34.0 38.0 40-44 36.25965 38.0 38.0 38.0 33.2 38.0 45-49 34.805899999999994 38.0 35.0 38.0 24.6 38.0 50-54 36.0591 38.0 37.6 38.0 31.8 38.0 55-59 36.3408 38.0 38.0 38.0 33.8 38.0 60-64 36.3557 38.0 38.0 38.0 34.0 38.0 65-69 36.160199999999996 38.0 38.0 38.0 33.2 38.0 70-74 35.232299999999995 38.0 36.4 38.0 26.6 38.0 75-79 33.5587 37.6 31.6 38.0 23.0 38.0 80-84 35.756449999999994 38.0 36.8 38.0 31.2 38.0 85-89 35.4052 38.0 36.8 38.0 28.6 38.0 90-94 35.44625 38.0 37.0 38.0 29.4 38.0 95-99 35.56325 38.0 37.0 38.0 30.4 38.0 100-104 35.6815 38.0 37.0 38.0 30.8 38.0 105-109 35.3658 38.0 36.8 38.0 28.8 38.0 110-114 34.45655000000001 38.0 34.8 38.0 24.8 38.0 115-119 34.8871 38.0 36.0 38.0 26.4 38.0 120-124 34.907000000000004 38.0 36.0 38.0 27.4 38.0 125-129 34.74715 38.0 36.0 38.0 26.4 38.0 130-134 34.27695 38.0 35.2 38.0 22.8 38.0 135-139 34.18415 38.0 35.2 38.0 24.2 38.0 140-144 32.817499999999995 37.6 32.2 38.0 18.6 38.0 145-149 31.839049999999997 38.0 32.4 38.0 8.6 38.0 150 24.45225 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 0.0 5 2.0 6 1.0 7 2.0 8 4.0 9 2.0 10 0.0 11 4.0 12 3.0 13 4.0 14 3.0 15 2.0 16 5.0 17 7.0 18 2.0 19 12.0 20 12.0 21 11.0 22 19.0 23 27.0 24 20.0 25 30.0 26 36.0 27 43.0 28 57.0 29 61.0 30 100.0 31 110.0 32 116.0 33 128.0 34 232.0 35 332.0 36 712.0 37 1895.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.4 18.175 13.3 32.125 2 26.25 23.875 34.075 15.8 3 20.474999999999998 28.225 31.5 19.8 4 23.825 34.475 23.35 18.35 5 26.325 37.1 21.45 15.125 6 19.975 40.075 23.7 16.25 7 20.349999999999998 19.775000000000002 40.45 19.425 8 21.925 23.875 30.025000000000002 24.175 9 22.375 25.224999999999998 30.0 22.400000000000002 10-14 22.96 29.345 26.715 20.979999999999997 15-19 23.205000000000002 27.355 28.299999999999997 21.14 20-24 23.34 28.13 27.955000000000002 20.575 25-29 23.335 27.76 27.985 20.919999999999998 30-34 23.11 28.575 27.750000000000004 20.565 35-39 23.189999999999998 27.88 28.53 20.4 40-44 23.56 28.435 27.63 20.375 45-49 22.835 27.634999999999998 28.49 21.04 50-54 22.935 28.139999999999997 28.615000000000002 20.31 55-59 23.26 27.68 28.825 20.235 60-64 23.064999999999998 27.845 28.34 20.75 65-69 23.43 27.744999999999997 28.275 20.549999999999997 70-74 23.445 28.12 27.889999999999997 20.544999999999998 75-79 23.415 27.82 28.64 20.125 80-84 23.64 28.360000000000003 27.43 20.57 85-89 23.78 28.194999999999997 28.335 19.689999999999998 90-94 23.05 27.715 28.595 20.64 95-99 23.185 27.915 28.54 20.36 100-104 23.865 27.875 28.610000000000003 19.650000000000002 105-109 23.724999999999998 27.865000000000002 28.34 20.07 110-114 24.07 27.950000000000003 27.965 20.015 115-119 24.285 27.185 28.110000000000003 20.419999999999998 120-124 24.26 28.075 28.110000000000003 19.555 125-129 24.015 27.865000000000002 27.97 20.150000000000002 130-134 25.19 27.41 27.865000000000002 19.535 135-139 24.295 28.03 27.97 19.705000000000002 140-144 24.75 27.875 27.505000000000003 19.869999999999997 145-149 24.779999999999998 28.494999999999997 27.334999999999997 19.39 150 24.025 28.525 27.650000000000002 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 2.5 24 3.5 25 3.0 26 5.5 27 5.5 28 6.0 29 13.5 30 16.0 31 24.5 32 34.0 33 36.5 34 47.0 35 62.5 36 86.0 37 110.0 38 145.0 39 180.0 40 197.0 41 219.0 42 245.0 43 278.5 44 289.5 45 271.5 46 271.0 47 256.5 48 237.0 49 210.0 50 170.0 51 148.5 52 120.5 53 87.0 54 62.0 55 40.0 56 22.0 57 22.0 58 23.0 59 14.5 60 8.5 61 5.0 62 4.0 63 4.5 64 3.0 65 1.5 66 2.5 67 2.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.9249999999999999 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.9749999999999999 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.45 0.0 0.0 0.0 0.0 130-131 5.075 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.800000000000001 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138 6.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402540 spots for SRR4237609.sra Written 3402540 spots for SRR4237609.sra Read 3402550 spots for SRR4237609.sra Written 3402550 spots for SRR4237609.sra SRR ids: ['SRR4237609.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nt7k8okp SRR4237609.sra spots: 68050810 blocks: [[1, 3402540], [3402541, 6805080], [6805081, 10207620], [10207621, 13610160], [13610161, 17012700], [17012701, 20415240], [20415241, 23817780], [23817781, 27220320], [27220321, 30622860], [30622861, 34025400], [34025401, 37427940], [37427941, 40830480], [40830481, 44233020], [44233021, 47635560], [47635561, 51038100], [51038101, 54440640], [54440641, 57843180], [57843181, 61245720], [61245721, 64648260], [64648261, 68050810]] SRR4237609 file size 22905574 SRR4237609 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237609 SRR4237609_1.fastq SRR4237609_2.fastq Input file: SRR4237609_1.fastq Paired file: SRR4237609_2.fastq trimmed: SRR4237609-trimmed-pair1.fastq, SRR4237609-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:05:11 2025 >> started Wed Feb 12 16:06:43 2025 >> done (91.999s) 68050810 read pairs processed; of these: 60358 ( 0.09%) short read pairs filtered out after trimming by size control 43120 ( 0.06%) empty read pairs filtered out after trimming by size control 67947332 (99.85%) read pairs available; of these: 26811702 (39.46%) trimmed read pairs available after processing 41135630 (60.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 7 0.00% 21 7 0.00% 22 5 0.00% 23 8 0.00% 24 9 0.00% 25 13 0.00% 26 6 0.00% 27 19 0.00% 28 20 0.00% 29 16 0.00% 30 15 0.00% 31 22 0.00% 32 19 0.00% 33 20 0.00% 34 22 0.00% 35 27 0.00% 36 47 0.00% 37 48 0.00% 38 62 0.00% 39 52 0.00% 40 64 0.00% 41 65 0.00% 42 78 0.00% 43 69 0.00% 44 73 0.00% 45 88 0.00% 46 102 0.00% 47 138 0.00% 48 145 0.00% 49 144 0.00% 50 159 0.00% 51 198 0.00% 52 219 0.00% 53 239 0.00% 54 247 0.00% 55 259 0.00% 56 296 0.00% 57 347 0.00% 58 416 0.00% 59 453 0.00% 60 500 0.00% 61 573 0.00% 62 638 0.00% 63 748 0.00% 64 877 0.00% 65 952 0.00% 66 1020 0.00% 67 1208 0.00% 68 1381 0.00% 69 1970 0.00% 70 2157 0.00% 71 2085 0.00% 72 2260 0.00% 73 2623 0.00% 74 2884 0.00% 75 3290 0.00% 76 3701 0.01% 77 4165 0.01% 78 4551 0.01% 79 5271 0.01% 80 6060 0.01% 81 6877 0.01% 82 7801 0.01% 83 9352 0.01% 84 13564 0.02% 85 14967 0.02% 86 16062 0.02% 87 17621 0.03% 88 18693 0.03% 89 20157 0.03% 90 21900 0.03% 91 24001 0.04% 92 26038 0.04% 93 28053 0.04% 94 30783 0.05% 95 32862 0.05% 96 36004 0.05% 97 39012 0.06% 98 41553 0.06% 99 44731 0.07% 100 48504 0.07% 101 50923 0.07% 102 55471 0.08% 103 58994 0.09% 104 63020 0.09% 105 68176 0.10% 106 72595 0.11% 107 77356 0.11% 108 81616 0.12% 109 86263 0.13% 110 90415 0.13% 111 95192 0.14% 112 100324 0.15% 113 105176 0.15% 114 112692 0.17% 115 119706 0.18% 116 123346 0.18% 117 130717 0.19% 118 138464 0.20% 119 142411 0.21% 120 146866 0.22% 121 154582 0.23% 122 159683 0.24% 123 166742 0.25% 124 175027 0.26% 125 185019 0.27% 126 191640 0.28% 127 200854 0.30% 128 209225 0.31% 129 217360 0.32% 130 227824 0.34% 131 235963 0.35% 132 245393 0.36% 133 256389 0.38% 134 268061 0.39% 135 281490 0.41% 136 299188 0.44% 137 316655 0.47% 138 338418 0.50% 139 358205 0.53% 140 386080 0.57% 141 415204 0.61% 142 453802 0.67% 143 506971 0.75% 144 581173 0.86% 145 697816 1.03% 146 887947 1.31% 147 1266039 1.86% 148 2303332 3.39% 149 12354191 18.18% 150 41135630 60.54% 67947332 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=10.10 fanout-score-rank=13 prefix-density=0.30 prefix-fanout=5.7 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=189.19 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=12.3 sequence=AAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.2 sequence=TGCTTTATTTTCCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=89.01 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=18.2 sequence=TGCTGCTGAAATT SRR4237609 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:07:28 Started mapping on | Feb 12 16:07:29 Finished on | Feb 12 16:13:32 Mapping speed, Million of reads per hour | 673.86 Number of input reads | 67947332 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 65678424 Uniquely mapped reads % | 96.66% Average mapped length | 292.58 Number of splices: Total | 60729890 Number of splices: Annotated (sjdb) | 59638121 Number of splices: GT/AG | 59820951 Number of splices: GC/AG | 714045 Number of splices: AT/AC | 57329 Number of splices: Non-canonical | 137565 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1219726 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 91764 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.38% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1106541 1106541 1106541 N_multimapping 1219726 1219726 1219726 N_noFeature 1896741 64830090 2401250 N_ambiguous 643070 5062 295269 UnstrandedReadsAssigned:63138613 PositiveStrandReadsAssigned:843272 NegativeStrandReadsAssigned:62981905 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237609 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237609-trimmed-pair1.fastq SRR4237609-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 67,947,332 reads, 62,674,335 reads pseudoaligned [quant] estimated average fragment length: 228.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR4237609.ke.tsv 34699 SRR4237609.se.tsv 87100 total ==> SRR4237609.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.84 1427 13.4494 Potri.005G024800.1.v4.1 1035 807.842 206 4.30405 Potri.004G059700.1.v4.1 961 733.842 20 0.460007 Potri.007G009000.2.v4.1 1416 1188.84 0 0 Potri.003G141000.2.v4.1 2943 2715.84 1101.34 6.84469 Potri.016G087400.1.v4.1 270 83.9123 9356 1881.92 Potri.015G069301.1.v4.1 564 339.958 0 0 Potri.010G195200.1.v4.1 1773 1545.84 192 2.09639 Potri.012G127500.1.v4.1 977 749.842 12451 280.266 ==> SRR4237609.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8820 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 981 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 32 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 17 SRR4237609 completed mapping pipeline successfully