Starting /dee2/code/volunteer_pipeline.sh SRR4237610 current disk space = 3051944796160 free memory = 1576488668 SRR4237610 SRAfilesize c5030013c1adadf7bc8f9f363eb9d1d7 SRR4237610.sra SRR4237610.sra file validated SRR4237610 is paired end SRR4237610 is conventional basespace SRR4237610 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237610_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.3365 33.0 33.0 34.0 18.0 34.0 2 31.8815 33.0 32.0 34.0 27.0 34.0 3 32.484 33.0 33.0 34.0 28.0 34.0 4 32.67375 34.0 33.0 34.0 32.0 34.0 5 32.8585 34.0 33.0 34.0 32.0 34.0 6 35.82225 38.0 37.0 38.0 31.0 38.0 7 36.81325 38.0 37.0 38.0 34.0 38.0 8 36.9635 38.0 38.0 38.0 35.0 38.0 9 37.07125 38.0 38.0 38.0 36.0 38.0 10-14 37.1625 38.0 38.0 38.0 36.0 38.0 15-19 37.07635 38.0 38.0 38.0 36.0 38.0 20-24 36.6819 38.0 37.8 38.0 33.8 38.0 25-29 36.8652 38.0 38.0 38.0 35.4 38.0 30-34 36.96875 38.0 38.0 38.0 36.0 38.0 35-39 36.783550000000005 38.0 38.0 38.0 35.0 38.0 40-44 36.823750000000004 38.0 38.0 38.0 35.4 38.0 45-49 36.7962 38.0 38.0 38.0 35.0 38.0 50-54 36.684000000000005 38.0 38.0 38.0 34.6 38.0 55-59 36.68055 38.0 38.0 38.0 34.6 38.0 60-64 36.7519 38.0 38.0 38.0 34.8 38.0 65-69 36.64235 38.0 38.0 38.0 34.4 38.0 70-74 36.68325 38.0 38.0 38.0 34.6 38.0 75-79 36.12445 38.0 37.4 38.0 32.0 38.0 80-84 33.4058 37.2 30.8 38.0 23.8 38.0 85-89 36.26935 38.0 37.4 38.0 33.2 38.0 90-94 36.06845 38.0 37.6 38.0 32.2 38.0 95-99 36.26955 38.0 37.6 38.0 33.8 38.0 100-104 36.069849999999995 38.0 37.2 38.0 33.0 38.0 105-109 35.87785 38.0 37.2 38.0 32.0 38.0 110-114 35.860850000000006 38.0 37.0 38.0 31.8 38.0 115-119 35.7099 38.0 37.0 38.0 31.2 38.0 120-124 35.500099999999996 38.0 36.6 38.0 29.8 38.0 125-129 35.312 38.0 36.2 38.0 29.0 38.0 130-134 35.06165 38.0 35.8 38.0 27.8 38.0 135-139 34.73225 38.0 35.4 38.0 27.2 38.0 140-144 32.81545 37.2 31.6 38.0 19.6 38.0 145-149 34.02635 38.0 35.0 38.0 24.4 38.0 150 29.44525 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 3.0 17 2.0 18 1.0 19 1.0 20 3.0 21 8.0 22 11.0 23 14.0 24 19.0 25 22.0 26 18.0 27 40.0 28 40.0 29 47.0 30 62.0 31 90.0 32 105.0 33 127.0 34 215.0 35 299.0 36 748.0 37 2117.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.728060671722645 11.94474539544962 9.859154929577464 41.468039003250276 2 22.325 14.674999999999999 36.5 26.5 3 20.0 20.1 25.25 34.65 4 22.875 28.65 23.474999999999998 25.0 5 23.474999999999998 32.875 23.799999999999997 19.85 6 15.950000000000001 36.449999999999996 25.15 22.45 7 14.674999999999999 26.900000000000002 41.5 16.925 8 16.375 25.525 32.225 25.874999999999996 9 16.950000000000003 24.5 33.95 24.6 10-14 19.43 30.43 27.075 23.064999999999998 15-19 19.27 29.965000000000003 27.694999999999997 23.07 20-24 19.345000000000002 30.115 27.445000000000004 23.095 25-29 19.43 29.225 27.584999999999997 23.76 30-34 19.335 29.09 27.985 23.59 35-39 20.325 29.205 27.125 23.345 40-44 19.52 29.544999999999998 27.415 23.52 45-49 20.015 28.689999999999998 27.650000000000002 23.645 50-54 19.99 29.42 27.37 23.22 55-59 19.814999999999998 29.435 27.169999999999998 23.580000000000002 60-64 19.98 29.395 27.04 23.585 65-69 19.7 29.544999999999998 27.245 23.51 70-74 19.25 29.395 27.700000000000003 23.655 75-79 19.925 29.270000000000003 27.1 23.705000000000002 80-84 19.68 29.544999999999998 27.245 23.53 85-89 19.66 29.125 27.76 23.455000000000002 90-94 19.91 29.909999999999997 26.805 23.375 95-99 19.625 29.26 27.325 23.79 100-104 20.080000000000002 28.99 27.529999999999998 23.400000000000002 105-109 19.875 29.24 27.445000000000004 23.44 110-114 19.869999999999997 29.235 27.284999999999997 23.61 115-119 19.794999999999998 28.615000000000002 27.644999999999996 23.945 120-124 20.495 29.285 26.540000000000003 23.68 125-129 19.89 29.345 27.22 23.544999999999998 130-134 20.01 28.87 27.334999999999997 23.785 135-139 19.875 29.195 26.815 24.115000000000002 140-144 20.285 28.794999999999998 26.72 24.2 145-149 21.025 29.404999999999998 25.919999999999998 23.65 150 20.125 28.575 26.75 24.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 2.5 23 3.5 24 3.0 25 6.5 26 6.5 27 6.0 28 10.5 29 15.0 30 25.5 31 41.0 32 45.5 33 55.0 34 73.0 35 77.0 36 84.0 37 111.0 38 141.0 39 170.0 40 205.5 41 242.0 42 243.5 43 248.0 44 270.0 45 269.0 46 252.0 47 245.5 48 235.0 49 195.0 50 149.5 51 126.5 52 115.5 53 92.0 54 72.0 55 47.5 56 30.5 57 24.0 58 16.0 59 9.5 60 5.0 61 5.5 62 5.0 63 4.0 64 3.5 65 1.5 66 0.5 67 0.0 68 0.5 69 1.5 70 1.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.3375000000000004 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.85 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.737500000000001 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.4 0.0 0.0 0.0 0.0 134-135 5.875 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCAAC 10 0.0069808904 143.95 5 >>END_MODULE SRR4237610 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237610_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.07725 33.0 32.0 34.0 30.0 34.0 2 30.62175 33.0 31.0 34.0 18.0 34.0 3 31.81 33.0 32.0 34.0 27.0 34.0 4 32.09175 33.0 33.0 34.0 30.0 34.0 5 32.32175 33.0 33.0 34.0 31.0 34.0 6 36.14675 38.0 38.0 38.0 33.0 38.0 7 36.48275 38.0 38.0 38.0 34.0 38.0 8 36.5605 38.0 38.0 38.0 34.0 38.0 9 36.501 38.0 38.0 38.0 34.0 38.0 10-14 36.458349999999996 38.0 38.0 38.0 33.8 38.0 15-19 36.60465 38.0 38.0 38.0 34.4 38.0 20-24 35.67125 38.0 36.8 38.0 29.2 38.0 25-29 35.467499999999994 38.0 35.8 38.0 29.2 38.0 30-34 35.96135 38.0 37.2 38.0 32.0 38.0 35-39 36.39905 38.0 38.0 38.0 33.8 38.0 40-44 36.46415 38.0 38.0 38.0 34.0 38.0 45-49 36.33645 38.0 38.0 38.0 33.8 38.0 50-54 36.523450000000004 38.0 38.0 38.0 34.0 38.0 55-59 36.43295 38.0 38.0 38.0 34.2 38.0 60-64 36.4077 38.0 38.0 38.0 33.8 38.0 65-69 35.682950000000005 38.0 37.2 38.0 28.6 38.0 70-74 36.0906 38.0 37.8 38.0 32.6 38.0 75-79 34.2385 37.8 33.6 38.0 22.6 38.0 80-84 35.1761 38.0 36.0 38.0 28.2 38.0 85-89 35.783849999999994 38.0 37.0 38.0 30.8 38.0 90-94 35.8727 38.0 37.0 38.0 31.8 38.0 95-99 35.82855 38.0 37.0 38.0 31.0 38.0 100-104 35.691449999999996 38.0 37.0 38.0 30.0 38.0 105-109 35.36725 38.0 36.8 38.0 28.6 38.0 110-114 35.57815 38.0 37.0 38.0 30.2 38.0 115-119 35.5535 38.0 37.0 38.0 30.2 38.0 120-124 35.26370000000001 38.0 36.4 38.0 29.2 38.0 125-129 35.0433 38.0 36.0 38.0 27.8 38.0 130-134 34.728 38.0 35.8 38.0 26.4 38.0 135-139 34.5123 38.0 35.6 38.0 25.2 38.0 140-144 33.85699999999999 38.0 34.2 38.0 21.8 38.0 145-149 32.93695 38.0 33.8 38.0 11.4 38.0 150 26.4465 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 5.0 13 0.0 14 4.0 15 4.0 16 4.0 17 3.0 18 7.0 19 4.0 20 12.0 21 14.0 22 22.0 23 18.0 24 26.0 25 37.0 26 34.0 27 43.0 28 53.0 29 65.0 30 81.0 31 93.0 32 99.0 33 138.0 34 183.0 35 311.0 36 620.0 37 2110.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.625 18.025 14.575 28.775000000000002 2 27.275 24.2 33.525 15.0 3 21.6 27.775 30.125 20.5 4 24.9 33.975 23.599999999999998 17.525 5 26.400000000000002 35.575 22.650000000000002 15.375 6 20.849999999999998 38.800000000000004 23.05 17.299999999999997 7 20.474999999999998 20.1 40.8 18.625 8 21.15 24.725 29.75 24.375 9 21.775 25.224999999999998 30.7 22.3 10-14 23.810000000000002 28.645 26.685 20.86 15-19 23.565 27.27 28.075 21.09 20-24 23.189999999999998 28.32 27.615000000000002 20.875 25-29 23.025000000000002 28.64 27.83 20.505000000000003 30-34 23.31 27.950000000000003 28.525 20.215 35-39 23.25 27.779999999999998 28.29 20.68 40-44 23.56 27.845 28.389999999999997 20.205000000000002 45-49 23.335 27.595 28.865000000000002 20.205000000000002 50-54 23.565 27.805000000000003 28.18 20.45 55-59 23.525 28.365000000000002 27.925 20.185 60-64 22.985 27.944999999999997 28.970000000000002 20.1 65-69 23.77 27.905 28.155 20.169999999999998 70-74 24.115000000000002 27.47 28.499999999999996 19.915 75-79 23.794999999999998 27.855 28.64 19.71 80-84 23.53 27.625 28.754999999999995 20.09 85-89 23.56 27.860000000000003 28.595 19.985 90-94 23.71 27.79 28.65 19.85 95-99 23.849999999999998 27.905 28.549999999999997 19.695 100-104 23.61 27.785 28.58 20.025000000000002 105-109 24.075 28.000000000000004 28.48 19.445 110-114 23.805 27.405 29.455 19.335 115-119 23.54 27.644999999999996 28.73 20.085 120-124 24.54 27.46 28.549999999999997 19.45 125-129 24.39 28.144999999999996 27.675 19.79 130-134 24.43 27.279999999999998 28.465 19.825 135-139 24.23 28.189999999999998 27.88 19.7 140-144 24.93 27.905 28.105000000000004 19.06 145-149 25.555 27.889999999999997 27.555000000000003 19.0 150 25.324999999999996 26.35 29.475 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 6.0 28 8.0 29 11.5 30 17.5 31 22.0 32 29.5 33 39.5 34 52.5 35 71.5 36 80.5 37 99.5 38 125.0 39 162.0 40 212.0 41 237.0 42 254.0 43 286.0 44 307.0 45 296.5 46 282.0 47 262.0 48 226.0 49 196.0 50 175.0 51 133.0 52 99.5 53 91.0 54 70.0 55 43.5 56 30.5 57 22.0 58 12.5 59 6.0 60 7.0 61 7.0 62 3.0 63 2.5 64 1.5 65 1.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0125 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.0625 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.0875 0.0 0.0 0.025 0.0 86-87 0.125 0.0 0.0 0.025 0.0 88-89 0.125 0.0 0.0 0.025 0.0 90-91 0.2 0.0 0.0 0.025 0.0 92-93 0.275 0.0 0.0 0.025 0.0 94-95 0.38749999999999996 0.0 0.0 0.025 0.0 96-97 0.525 0.0 0.0 0.025 0.0 98-99 0.6375 0.0 0.0 0.025 0.0 100-101 0.8125 0.0 0.0 0.025 0.0 102-103 0.9624999999999999 0.0 0.0 0.025 0.0 104-105 1.1375 0.0 0.0 0.025 0.0 106-107 1.3 0.0 0.0 0.025 0.0 108-109 1.575 0.0 0.0 0.025 0.0 110-111 1.75 0.0 0.0 0.025 0.0 112-113 2.05 0.0 0.0 0.025 0.0 114-115 2.4124999999999996 0.0 0.0 0.025 0.0 116-117 2.825 0.0 0.0 0.025 0.0 118-119 3.1125 0.0 0.0 0.025 0.0 120-121 3.4000000000000004 0.0 0.0 0.025 0.0 122-123 3.6625 0.0 0.0 0.025 0.0 124-125 3.95 0.0 0.0 0.025 0.0 126-127 4.425 0.0 0.0 0.025 0.0 128-129 4.9375 0.0 0.0 0.025 0.0 130-131 5.3 0.0 0.0 0.025 0.0 132-133 5.637499999999999 0.0 0.0 0.025 0.0 134-135 6.1 0.0 0.0 0.025 0.0 136-137 6.574999999999999 0.0 0.0 0.025 0.0 138 6.9 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183048 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183048 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra Read 3183041 spots for SRR4237610.sra Written 3183041 spots for SRR4237610.sra SRR ids: ['SRR4237610.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9nt1dr75 SRR4237610.sra spots: 63660827 blocks: [[1, 3183041], [3183042, 6366082], [6366083, 9549123], [9549124, 12732164], [12732165, 15915205], [15915206, 19098246], [19098247, 22281287], [22281288, 25464328], [25464329, 28647369], [28647370, 31830410], [31830411, 35013451], [35013452, 38196492], [38196493, 41379533], [41379534, 44562574], [44562575, 47745615], [47745616, 50928656], [50928657, 54111697], [54111698, 57294738], [57294739, 60477779], [60477780, 63660827]] SRR4237610 file size 21426527 SRR4237610 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237610 SRR4237610_1.fastq SRR4237610_2.fastq Input file: SRR4237610_1.fastq Paired file: SRR4237610_2.fastq trimmed: SRR4237610-trimmed-pair1.fastq, SRR4237610-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:53:49 2025 >> started Wed Feb 12 16:55:04 2025 >> done (74.808s) 63660827 read pairs processed; of these: 49689 ( 0.08%) short read pairs filtered out after trimming by size control 44324 ( 0.07%) empty read pairs filtered out after trimming by size control 63566814 (99.85%) read pairs available; of these: 23627021 (37.17%) trimmed read pairs available after processing 39939793 (62.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 8 0.00% 21 6 0.00% 22 16 0.00% 23 7 0.00% 24 13 0.00% 25 10 0.00% 26 18 0.00% 27 28 0.00% 28 18 0.00% 29 21 0.00% 30 34 0.00% 31 23 0.00% 32 23 0.00% 33 31 0.00% 34 44 0.00% 35 38 0.00% 36 35 0.00% 37 53 0.00% 38 58 0.00% 39 54 0.00% 40 57 0.00% 41 73 0.00% 42 86 0.00% 43 99 0.00% 44 99 0.00% 45 126 0.00% 46 132 0.00% 47 161 0.00% 48 180 0.00% 49 185 0.00% 50 175 0.00% 51 236 0.00% 52 226 0.00% 53 265 0.00% 54 295 0.00% 55 315 0.00% 56 380 0.00% 57 416 0.00% 58 500 0.00% 59 535 0.00% 60 632 0.00% 61 707 0.00% 62 832 0.00% 63 923 0.00% 64 1026 0.00% 65 1205 0.00% 66 1362 0.00% 67 1600 0.00% 68 1841 0.00% 69 2721 0.00% 70 3091 0.00% 71 2937 0.00% 72 3042 0.00% 73 3391 0.01% 74 3704 0.01% 75 4176 0.01% 76 4713 0.01% 77 5207 0.01% 78 5740 0.01% 79 6503 0.01% 80 7318 0.01% 81 8408 0.01% 82 9548 0.02% 83 11151 0.02% 84 15399 0.02% 85 17009 0.03% 86 18397 0.03% 87 19973 0.03% 88 21550 0.03% 89 23106 0.04% 90 24858 0.04% 91 26878 0.04% 92 29687 0.05% 93 31631 0.05% 94 34754 0.05% 95 37921 0.06% 96 40381 0.06% 97 43535 0.07% 98 46314 0.07% 99 49263 0.08% 100 52446 0.08% 101 55513 0.09% 102 58605 0.09% 103 63039 0.10% 104 67382 0.11% 105 71779 0.11% 106 76128 0.12% 107 80321 0.13% 108 83710 0.13% 109 87047 0.14% 110 90636 0.14% 111 94762 0.15% 112 99120 0.16% 113 103937 0.16% 114 109192 0.17% 115 114311 0.18% 116 118749 0.19% 117 124974 0.20% 118 130335 0.21% 119 133950 0.21% 120 137663 0.22% 121 143015 0.22% 122 146074 0.23% 123 153976 0.24% 124 158888 0.25% 125 166858 0.26% 126 171666 0.27% 127 178620 0.28% 128 184487 0.29% 129 191646 0.30% 130 198989 0.31% 131 204547 0.32% 132 214256 0.34% 133 223162 0.35% 134 231118 0.36% 135 242625 0.38% 136 255798 0.40% 137 270283 0.43% 138 288134 0.45% 139 306222 0.48% 140 325475 0.51% 141 352694 0.55% 142 385027 0.61% 143 427994 0.67% 144 491026 0.77% 145 590880 0.93% 146 752502 1.18% 147 1077216 1.69% 148 1960791 3.08% 149 10801921 16.99% 150 39939793 62.83% 63566814 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=183.49 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=12.1 sequence=TCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATTAGGA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=37 prefix-density=0.19 prefix-fanout=2.3 sequence=TCTAGCTAGTGGTTTAATAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=249.44 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=29.0 sequence=AAGAAGAAGAAA SRR4237610 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:55:48 Started mapping on | Feb 12 16:55:48 Finished on | Feb 12 17:00:55 Mapping speed, Million of reads per hour | 745.41 Number of input reads | 63566814 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 61701747 Uniquely mapped reads % | 97.07% Average mapped length | 292.42 Number of splices: Total | 53103480 Number of splices: Annotated (sjdb) | 52093314 Number of splices: GT/AG | 52289080 Number of splices: GC/AG | 623023 Number of splices: AT/AC | 53665 Number of splices: Non-canonical | 137712 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1196277 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 69201 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718771 718771 718771 N_multimapping 1196277 1196277 1196277 N_noFeature 1888785 60902183 2285154 N_ambiguous 666328 4191 260013 UnstrandedReadsAssigned:59146634 PositiveStrandReadsAssigned:795373 NegativeStrandReadsAssigned:59156580 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237610 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237610-trimmed-pair1.fastq SRR4237610-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 63,566,814 reads, 58,953,829 reads pseudoaligned [quant] estimated average fragment length: 231.118 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52401 SRR4237610.ke.tsv 34699 SRR4237610.se.tsv 87100 total ==> SRR4237610.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.88 1424 13.6056 Potri.005G024800.1.v4.1 1035 804.882 172 3.65042 Potri.004G059700.1.v4.1 961 730.901 56 1.30881 Potri.007G009000.2.v4.1 1416 1185.88 0 0 Potri.003G141000.2.v4.1 2943 2712.88 933.441 5.87763 Potri.016G087400.1.v4.1 270 82.4676 9941 2059.17 Potri.015G069301.1.v4.1 564 336.76 0 0 Potri.010G195200.1.v4.1 1773 1542.88 235 2.60185 Potri.012G127500.1.v4.1 977 746.889 17030 389.498 ==> SRR4237610.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8435 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 876 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR4237610 completed mapping pipeline successfully