Starting /dee2/code/volunteer_pipeline.sh SRR4237611 current disk space = 3051694968832 free memory = 1057461408 SRR4237611 SRAfilesize 7f5b9c9f92526ac03c6b59db1dda4c5f SRR4237611.sra SRR4237611.sra file validated SRR4237611 is paired end SRR4237611 is conventional basespace SRR4237611 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237611_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.0375 33.0 27.0 34.0 2.0 34.0 2 31.59675 33.0 28.0 34.0 27.0 34.0 3 32.00675 33.0 32.0 34.0 27.0 34.0 4 32.56025 33.0 33.0 34.0 32.0 34.0 5 32.78875 33.0 33.0 34.0 32.0 34.0 6 36.56275 38.0 37.0 38.0 34.0 38.0 7 36.91275 38.0 38.0 38.0 35.0 38.0 8 37.109 38.0 38.0 38.0 36.0 38.0 9 37.0375 38.0 38.0 38.0 36.0 38.0 10-14 37.1356 38.0 38.0 38.0 36.0 38.0 15-19 37.0581 38.0 38.0 38.0 35.8 38.0 20-24 37.0664 38.0 38.0 38.0 36.0 38.0 25-29 37.099399999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.927299999999995 38.0 38.0 38.0 35.4 38.0 35-39 36.75535 38.0 38.0 38.0 35.0 38.0 40-44 36.758300000000006 38.0 38.0 38.0 35.0 38.0 45-49 36.858850000000004 38.0 38.0 38.0 35.2 38.0 50-54 36.652 38.0 38.0 38.0 34.4 38.0 55-59 34.94539999999999 37.8 34.8 38.0 27.8 38.0 60-64 35.36525 37.8 35.4 38.0 29.0 38.0 65-69 36.5247 38.0 37.8 38.0 33.6 38.0 70-74 35.8995 38.0 36.8 38.0 29.2 38.0 75-79 36.484300000000005 38.0 38.0 38.0 34.0 38.0 80-84 33.832699999999996 37.4 32.4 38.0 23.6 38.0 85-89 35.55205000000001 37.8 36.0 38.0 29.8 38.0 90-94 36.11685 38.0 37.2 38.0 33.2 38.0 95-99 36.296749999999996 38.0 37.8 38.0 34.0 38.0 100-104 36.24155 38.0 37.6 38.0 33.8 38.0 105-109 36.08795 38.0 37.0 38.0 33.0 38.0 110-114 35.8663 38.0 37.0 38.0 32.2 38.0 115-119 35.7803 38.0 37.0 38.0 31.4 38.0 120-124 35.83145 38.0 37.0 38.0 31.8 38.0 125-129 35.439949999999996 38.0 36.2 38.0 30.2 38.0 130-134 34.51405 38.0 34.6 38.0 25.6 38.0 135-139 34.09755 38.0 34.6 38.0 22.8 38.0 140-144 34.612449999999995 38.0 35.2 38.0 26.8 38.0 145-149 32.8414 38.0 32.8 38.0 18.8 38.0 150 27.07075 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 1.0 12 0.0 13 1.0 14 3.0 15 0.0 16 0.0 17 2.0 18 5.0 19 3.0 20 3.0 21 5.0 22 13.0 23 10.0 24 12.0 25 18.0 26 28.0 27 37.0 28 45.0 29 49.0 30 79.0 31 76.0 32 113.0 33 145.0 34 259.0 35 369.0 36 863.0 37 1857.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.28970163618864 13.442412576195059 8.886750080205326 36.38113570741097 2 22.75 15.25 34.449999999999996 27.55 3 19.825 19.25 26.950000000000003 33.975 4 23.3 27.875 22.7 26.125 5 22.775000000000002 32.2 23.825 21.2 6 18.425 37.1 22.400000000000002 22.075 7 14.224999999999998 28.125 39.95 17.7 8 16.3 25.025 33.225 25.45 9 16.85 25.374999999999996 32.775 25.0 10-14 18.965 31.4 26.905 22.73 15-19 19.425 29.79 27.755000000000003 23.03 20-24 19.185 29.455 28.225 23.135 25-29 19.93 30.305 27.034999999999997 22.73 30-34 19.75 30.09 27.095000000000002 23.064999999999998 35-39 19.655 29.56 27.134999999999998 23.65 40-44 19.42 30.04 27.27 23.27 45-49 19.310965548277416 29.731486574328713 27.386369318465924 23.571178558927947 50-54 19.235 29.520000000000003 27.66 23.585 55-59 19.66 30.17 27.029999999999998 23.14 60-64 19.37 29.659999999999997 27.26 23.71 65-69 19.36 29.425 27.655 23.56 70-74 19.384999999999998 29.43 27.355 23.830000000000002 75-79 19.855 29.459999999999997 27.12 23.565 80-84 19.606960696069606 29.117911791179118 27.53775377537754 23.737373737373737 85-89 19.685 29.18 27.389999999999997 23.745 90-94 19.285 29.154999999999998 27.615000000000002 23.945 95-99 19.835 28.815 27.605 23.745 100-104 19.615 29.095 27.834999999999997 23.455000000000002 105-109 20.405 28.925 27.305 23.365 110-114 20.03 29.025000000000002 27.52 23.425 115-119 19.67 29.044999999999998 27.41 23.875 120-124 20.11 29.505 26.845000000000002 23.54 125-129 20.316015800790037 28.891444572228615 27.02135106755338 23.771188559427973 130-134 19.970998549927497 28.72143607180359 26.93134656732837 24.376218810940546 135-139 20.46102305115256 28.63143157157858 27.316365818290915 23.59117955897795 140-144 20.41602080104005 28.32141607080354 27.886394319715986 23.376168808440422 145-149 20.71 29.24 26.21 23.84 150 19.625 28.549999999999997 27.725 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 0.5 21 2.0 22 1.5 23 2.0 24 3.0 25 5.0 26 8.0 27 10.0 28 18.0 29 26.0 30 29.5 31 38.0 32 48.5 33 61.5 34 78.0 35 95.5 36 113.5 37 120.0 38 144.5 39 165.5 40 198.5 41 235.0 42 230.0 43 251.0 44 279.0 45 254.0 46 243.5 47 248.0 48 216.5 49 174.0 50 141.5 51 123.0 52 99.5 53 80.5 54 67.0 55 48.5 56 37.5 57 31.0 58 19.0 59 11.5 60 8.0 61 6.0 62 6.5 63 6.0 64 3.0 65 1.5 66 1.5 67 0.5 68 1.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 22.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.005 140-144 0.005 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7250000000000001 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.7874999999999996 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.45 0.0 0.0 0.0 0.0 128-129 3.7625 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138 6.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCAGT 20 0.0061889584 28.752502 30-34 >>END_MODULE SRR4237611 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237611_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3735 33.0 33.0 34.0 31.0 34.0 2 32.5615 33.0 33.0 34.0 31.0 34.0 3 32.58 33.0 33.0 34.0 31.0 34.0 4 32.323 33.0 33.0 34.0 31.0 34.0 5 32.47975 33.0 33.0 34.0 31.0 34.0 6 36.5085 38.0 38.0 38.0 34.0 38.0 7 36.592 38.0 38.0 38.0 34.0 38.0 8 36.6205 38.0 38.0 38.0 34.0 38.0 9 36.40175 38.0 38.0 38.0 34.0 38.0 10-14 36.506449999999994 38.0 38.0 38.0 34.2 38.0 15-19 36.498850000000004 38.0 38.0 38.0 34.2 38.0 20-24 36.5031 38.0 38.0 38.0 34.2 38.0 25-29 36.116 38.0 37.6 38.0 32.4 38.0 30-34 36.44425 38.0 38.0 38.0 34.6 38.0 35-39 35.80669999999999 38.0 37.0 38.0 30.4 38.0 40-44 36.155449999999995 38.0 37.6 38.0 32.8 38.0 45-49 36.38869999999999 38.0 38.0 38.0 34.0 38.0 50-54 36.36895 38.0 38.0 38.0 34.0 38.0 55-59 36.3041 38.0 38.0 38.0 34.0 38.0 60-64 36.3224 38.0 38.0 38.0 34.0 38.0 65-69 36.25169999999999 38.0 38.0 38.0 33.8 38.0 70-74 36.08225 38.0 38.0 38.0 33.2 38.0 75-79 35.665949999999995 38.0 37.2 38.0 30.2 38.0 80-84 35.749849999999995 38.0 37.2 38.0 31.6 38.0 85-89 35.5809 38.0 37.0 38.0 30.0 38.0 90-94 35.60585 38.0 37.0 38.0 30.8 38.0 95-99 35.675 38.0 37.0 38.0 31.2 38.0 100-104 35.33525 38.0 36.8 38.0 29.6 38.0 105-109 32.548350000000006 37.0 29.0 38.0 20.8 38.0 110-114 35.00065 38.0 36.0 38.0 27.6 38.0 115-119 34.93155 38.0 36.0 38.0 27.4 38.0 120-124 34.57275 38.0 35.6 38.0 25.0 38.0 125-129 34.36885 38.0 35.4 38.0 25.2 38.0 130-134 34.025349999999996 38.0 34.4 38.0 21.8 38.0 135-139 33.53405 38.0 33.2 38.0 20.2 38.0 140-144 32.6192 38.0 33.0 38.0 13.8 38.0 145-149 31.719450000000002 38.0 33.0 38.0 6.2 38.0 150 23.20025 31.0 2.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 1.0 5 1.0 6 3.0 7 3.0 8 2.0 9 0.0 10 4.0 11 1.0 12 1.0 13 4.0 14 7.0 15 1.0 16 3.0 17 8.0 18 8.0 19 8.0 20 14.0 21 19.0 22 16.0 23 22.0 24 20.0 25 33.0 26 31.0 27 43.0 28 64.0 29 57.0 30 67.0 31 93.0 32 107.0 33 151.0 34 202.0 35 307.0 36 640.0 37 2042.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.6 21.75 12.675 25.974999999999998 2 28.875 24.275 31.825 15.024999999999999 3 20.9 28.225 32.824999999999996 18.05 4 25.05 33.6 23.625 17.724999999999998 5 26.625 36.55 20.825 16.0 6 20.0 40.175 24.4 15.425 7 21.675 20.8 39.125 18.4 8 21.2 26.3 29.925 22.575 9 22.900000000000002 24.375 30.25 22.475 10-14 24.175 28.99 26.674999999999997 20.16 15-19 23.39 27.939999999999998 28.389999999999997 20.28 20-24 23.39 28.15 27.905 20.555 25-29 23.830000000000002 28.189999999999998 27.455000000000002 20.525 30-34 22.835 28.494999999999997 27.62 21.05 35-39 23.29 27.96 28.349999999999998 20.4 40-44 23.674999999999997 27.675 28.060000000000002 20.59 45-49 23.189999999999998 27.365000000000002 28.37 21.075 50-54 23.355 27.860000000000003 28.185 20.599999999999998 55-59 23.724999999999998 27.68 28.485 20.11 60-64 23.265 28.084999999999997 28.685 19.965 65-69 23.405 27.589999999999996 29.065 19.939999999999998 70-74 23.9 27.87 28.51 19.72 75-79 23.745 28.134999999999998 28.01 20.11 80-84 23.735 27.544999999999998 28.205000000000002 20.515 85-89 23.425 27.975 28.835 19.765 90-94 23.84 27.284999999999997 29.37 19.505 95-99 23.59 27.155 29.315 19.939999999999998 100-104 23.905 27.18 29.235 19.68 105-109 23.29 27.700000000000003 28.935 20.075000000000003 110-114 23.885 28.095 28.29 19.73 115-119 24.490000000000002 27.589999999999996 28.299999999999997 19.62 120-124 23.865 27.3 28.48 20.355 125-129 24.0 27.79 28.425 19.785 130-134 24.265 27.655 28.46 19.62 135-139 24.51 27.785 28.27 19.435 140-144 25.06 27.715 27.67 19.555 145-149 24.93 27.83 27.97 19.27 150 24.775 26.575 30.049999999999997 18.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 2.5 25 3.0 26 5.0 27 6.0 28 12.0 29 17.0 30 17.0 31 27.0 32 34.5 33 39.0 34 51.0 35 66.0 36 82.5 37 114.5 38 136.5 39 153.5 40 207.5 41 244.5 42 255.5 43 272.5 44 270.5 45 265.5 46 266.0 47 251.0 48 236.0 49 206.0 50 162.5 51 140.5 52 119.5 53 91.5 54 66.0 55 45.5 56 36.5 57 28.5 58 18.5 59 12.5 60 8.5 61 6.0 62 4.5 63 1.5 64 1.5 65 2.0 66 1.0 67 0.0 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.6 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.4125 0.0 0.0 0.0 0.0 138 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACATGC 10 0.006973645 144.0 7 GTACGAT 10 0.006973645 144.0 1 >>END_MODULE Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445359 spots for SRR4237611.sra Written 3445359 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra Read 3445358 spots for SRR4237611.sra Written 3445358 spots for SRR4237611.sra SRR ids: ['SRR4237611.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j0qy6e8r SRR4237611.sra spots: 68907161 blocks: [[1, 3445358], [3445359, 6890716], [6890717, 10336074], [10336075, 13781432], [13781433, 17226790], [17226791, 20672148], [20672149, 24117506], [24117507, 27562864], [27562865, 31008222], [31008223, 34453580], [34453581, 37898938], [37898939, 41344296], [41344297, 44789654], [44789655, 48235012], [48235013, 51680370], [51680371, 55125728], [55125729, 58571086], [58571087, 62016444], [62016445, 65461802], [65461803, 68907161]] SRR4237611 file size 23194091 SRR4237611 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237611 SRR4237611_1.fastq SRR4237611_2.fastq Input file: SRR4237611_1.fastq Paired file: SRR4237611_2.fastq trimmed: SRR4237611-trimmed-pair1.fastq, SRR4237611-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:18:41 2025 >> started Wed Feb 12 16:20:05 2025 >> done (83.820s) 68907161 read pairs processed; of these: 89726 ( 0.13%) short read pairs filtered out after trimming by size control 89262 ( 0.13%) empty read pairs filtered out after trimming by size control 68728173 (99.74%) read pairs available; of these: 27730023 (40.35%) trimmed read pairs available after processing 40998150 (59.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 8 0.00% 21 13 0.00% 22 8 0.00% 23 18 0.00% 24 9 0.00% 25 11 0.00% 26 16 0.00% 27 33 0.00% 28 19 0.00% 29 21 0.00% 30 40 0.00% 31 37 0.00% 32 25 0.00% 33 31 0.00% 34 36 0.00% 35 43 0.00% 36 47 0.00% 37 40 0.00% 38 58 0.00% 39 65 0.00% 40 75 0.00% 41 75 0.00% 42 72 0.00% 43 103 0.00% 44 117 0.00% 45 131 0.00% 46 146 0.00% 47 143 0.00% 48 162 0.00% 49 193 0.00% 50 210 0.00% 51 232 0.00% 52 235 0.00% 53 291 0.00% 54 320 0.00% 55 334 0.00% 56 401 0.00% 57 437 0.00% 58 477 0.00% 59 521 0.00% 60 616 0.00% 61 637 0.00% 62 717 0.00% 63 889 0.00% 64 929 0.00% 65 1049 0.00% 66 1162 0.00% 67 1433 0.00% 68 1933 0.00% 69 3669 0.01% 70 3099 0.00% 71 2360 0.00% 72 2428 0.00% 73 2725 0.00% 74 2882 0.00% 75 3329 0.00% 76 3637 0.01% 77 4111 0.01% 78 4501 0.01% 79 5035 0.01% 80 5803 0.01% 81 6722 0.01% 82 7646 0.01% 83 9362 0.01% 84 16128 0.02% 85 16855 0.02% 86 17882 0.03% 87 18853 0.03% 88 19972 0.03% 89 21097 0.03% 90 22794 0.03% 91 24417 0.04% 92 26525 0.04% 93 28910 0.04% 94 31432 0.05% 95 33974 0.05% 96 36990 0.05% 97 39848 0.06% 98 41730 0.06% 99 44483 0.06% 100 47242 0.07% 101 50305 0.07% 102 54731 0.08% 103 58290 0.08% 104 63237 0.09% 105 68188 0.10% 106 72924 0.11% 107 76941 0.11% 108 80965 0.12% 109 85172 0.12% 110 89237 0.13% 111 94405 0.14% 112 99709 0.15% 113 104283 0.15% 114 110961 0.16% 115 117828 0.17% 116 122333 0.18% 117 129587 0.19% 118 135572 0.20% 119 140181 0.20% 120 145306 0.21% 121 152802 0.22% 122 156212 0.23% 123 164052 0.24% 124 171339 0.25% 125 180458 0.26% 126 188486 0.27% 127 196450 0.29% 128 206098 0.30% 129 215314 0.31% 130 223270 0.32% 131 232575 0.34% 132 241944 0.35% 133 252444 0.37% 134 264255 0.38% 135 278041 0.40% 136 296672 0.43% 137 315512 0.46% 138 336350 0.49% 139 358971 0.52% 140 385261 0.56% 141 419992 0.61% 142 459425 0.67% 143 516008 0.75% 144 589404 0.86% 145 715396 1.04% 146 910297 1.32% 147 1303952 1.90% 148 2385915 3.47% 149 13141903 19.12% 150 40998150 59.65% 68728173 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=313.95 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=20.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=20.08 fanout-score-rank=8 prefix-density=0.42 prefix-fanout=8.1 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=255.81 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=28.9 sequence=AAGAAGAAGAAA SRR4237611 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:20:50 Started mapping on | Feb 12 16:20:50 Finished on | Feb 12 16:26:45 Mapping speed, Million of reads per hour | 696.96 Number of input reads | 68728173 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 66556536 Uniquely mapped reads % | 96.84% Average mapped length | 292.57 Number of splices: Total | 56800582 Number of splices: Annotated (sjdb) | 55798222 Number of splices: GT/AG | 55958249 Number of splices: GC/AG | 656259 Number of splices: AT/AC | 53413 Number of splices: Non-canonical | 132661 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1302670 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 130177 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.04% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 958775 958775 958775 N_multimapping 1302670 1302670 1302670 N_noFeature 1893367 65536113 2444481 N_ambiguous 748993 4882 276054 UnstrandedReadsAssigned:63914176 PositiveStrandReadsAssigned:1015541 NegativeStrandReadsAssigned:63836001 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237611 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237611-trimmed-pair1.fastq SRR4237611-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 68,728,173 reads, 63,685,383 reads pseudoaligned [quant] estimated average fragment length: 226.838 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR4237611.ke.tsv 34699 SRR4237611.se.tsv 87100 total ==> SRR4237611.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.16 1146 9.62536 Potri.005G024800.1.v4.1 1035 809.162 238 4.42743 Potri.004G059700.1.v4.1 961 735.162 14 0.286652 Potri.007G009000.2.v4.1 1416 1190.16 0 0 Potri.003G141000.2.v4.1 2943 2717.16 1201.18 6.65432 Potri.016G087400.1.v4.1 270 81.8192 8751 1609.95 Potri.015G069301.1.v4.1 564 340.607 0 0 Potri.010G195200.1.v4.1 1773 1547.16 98 0.953455 Potri.012G127500.1.v4.1 977 751.162 19270 386.152 ==> SRR4237611.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7490 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1378 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR4237611 completed mapping pipeline successfully