Starting /dee2/code/volunteer_pipeline.sh SRR4237612 current disk space = 3052017942528 free memory = 1577355696 SRR4237612 SRAfilesize 8b201525355a39c2df7da3ce240c6d39 SRR4237612.sra SRR4237612.sra file validated SRR4237612 is paired end SRR4237612 is conventional basespace SRR4237612 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237612_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.3035 33.0 33.0 34.0 18.0 34.0 2 32.59275 34.0 33.0 34.0 28.0 34.0 3 32.80275 34.0 33.0 34.0 31.0 34.0 4 33.07225 34.0 33.0 34.0 32.0 34.0 5 32.3495 33.0 33.0 34.0 31.0 34.0 6 36.532 38.0 37.0 38.0 34.0 38.0 7 37.11125 38.0 38.0 38.0 36.0 38.0 8 37.17525 38.0 38.0 38.0 36.0 38.0 9 37.33675 38.0 38.0 38.0 37.0 38.0 10-14 37.332049999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.31975 38.0 38.0 38.0 37.0 38.0 20-24 37.275 38.0 38.0 38.0 36.6 38.0 25-29 36.56815 38.0 37.4 38.0 33.6 38.0 30-34 37.222699999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.99775 38.0 38.0 38.0 35.8 38.0 40-44 37.1261 38.0 38.0 38.0 36.2 38.0 45-49 37.0532 38.0 38.0 38.0 36.0 38.0 50-54 36.4504 38.0 37.6 38.0 33.6 38.0 55-59 34.35235 37.6 33.8 38.0 24.8 38.0 60-64 34.384550000000004 36.4 31.2 38.0 28.4 38.0 65-69 36.930099999999996 38.0 38.0 38.0 35.8 38.0 70-74 35.18705 37.6 34.6 38.0 29.8 38.0 75-79 36.27095 38.0 37.4 38.0 32.6 38.0 80-84 35.8523 38.0 36.6 38.0 30.0 38.0 85-89 36.2691 38.0 37.4 38.0 33.4 38.0 90-94 36.0073 38.0 37.0 38.0 31.4 38.0 95-99 36.64640000000001 38.0 38.0 38.0 34.8 38.0 100-104 36.473400000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.436350000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.4351 38.0 38.0 38.0 34.0 38.0 115-119 36.227500000000006 38.0 37.6 38.0 33.6 38.0 120-124 36.08775000000001 38.0 37.6 38.0 33.4 38.0 125-129 34.7531 38.0 35.2 38.0 25.8 38.0 130-134 35.638850000000005 38.0 36.8 38.0 32.2 38.0 135-139 32.18085 36.4 29.2 38.0 21.0 38.0 140-144 31.2111 36.0 27.0 38.0 17.2 38.0 145-149 33.83945000000001 37.6 34.6 38.0 25.2 38.0 150 29.8055 35.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 2.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 2.0 17 0.0 18 5.0 19 1.0 20 2.0 21 7.0 22 8.0 23 11.0 24 13.0 25 15.0 26 25.0 27 28.0 28 37.0 29 37.0 30 53.0 31 63.0 32 98.0 33 147.0 34 233.0 35 505.0 36 1138.0 37 1563.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.26644736842105 10.389254385964913 12.472587719298247 40.87171052631579 2 23.599999999999998 15.35 34.125 26.924999999999997 3 20.3 19.425 24.825 35.449999999999996 4 23.474999999999998 28.499999999999996 20.525 27.500000000000004 5 22.95 35.625 22.2 19.225 6 18.224999999999998 36.0 25.174999999999997 20.599999999999998 7 14.499999999999998 26.525 40.525 18.45 8 18.099999999999998 25.724999999999998 31.6 24.575 9 17.974999999999998 24.425 32.95 24.65 10-14 19.885 30.275000000000002 26.97 22.869999999999997 15-19 19.580000000000002 28.915000000000003 27.975 23.53 20-24 19.595000000000002 29.189999999999998 27.310000000000002 23.905 25-29 19.63 29.73 26.900000000000002 23.74 30-34 19.805 29.625 27.400000000000002 23.169999999999998 35-39 20.105 29.89 26.815 23.189999999999998 40-44 19.505 29.035 27.560000000000002 23.9 45-49 19.99 29.265 26.884999999999998 23.86 50-54 19.84 29.104999999999997 27.779999999999998 23.275000000000002 55-59 19.794999999999998 29.48 26.995 23.73 60-64 19.66 29.549999999999997 27.205000000000002 23.585 65-69 20.035 29.445 27.134999999999998 23.385 70-74 20.59 29.445 27.175 22.79 75-79 19.744999999999997 29.015 27.544999999999998 23.695 80-84 19.919999999999998 29.225 26.85 24.005000000000003 85-89 19.79 28.68 27.97 23.56 90-94 20.16 28.4 27.865000000000002 23.575 95-99 20.395 28.749999999999996 27.3 23.555 100-104 20.575 29.099999999999998 26.884999999999998 23.44 105-109 20.435 29.395 26.915 23.255 110-114 20.630000000000003 29.330000000000002 26.740000000000002 23.3 115-119 20.45 28.89 27.195000000000004 23.465 120-124 20.315 28.810000000000002 26.99 23.885 125-129 20.505000000000003 29.354999999999997 26.215 23.925 130-134 20.8 29.23 26.32 23.65 135-139 20.755000000000003 28.435 26.900000000000002 23.91 140-144 21.044999999999998 27.97 27.145000000000003 23.84 145-149 20.9 28.720000000000002 26.68 23.7 150 20.875 28.050000000000004 26.450000000000003 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.5 22 2.5 23 1.5 24 1.0 25 3.5 26 7.0 27 8.0 28 9.5 29 15.5 30 23.0 31 31.5 32 39.0 33 49.0 34 62.5 35 77.5 36 86.0 37 112.5 38 148.5 39 178.0 40 204.5 41 227.0 42 246.5 43 254.5 44 266.0 45 254.5 46 228.0 47 231.0 48 231.5 49 205.0 50 169.0 51 135.5 52 111.0 53 87.5 54 65.5 55 55.5 56 43.5 57 30.5 58 26.5 59 20.0 60 13.0 61 6.5 62 5.5 63 8.5 64 6.5 65 2.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.799999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.5250000000000004 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.425 0.0 0.0 0.0 0.0 124-125 4.9 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.9875 0.0 0.0 0.0 0.0 130-131 6.324999999999999 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.0 0.0 0.0 0.0 0.0 136-137 7.525 0.0 0.0 0.0 0.0 138 7.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTCC 10 0.005742624 153.53334 1 >>END_MODULE SRR4237612 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237612_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33375 33.0 33.0 34.0 31.0 34.0 2 32.50075 33.0 33.0 34.0 31.0 34.0 3 32.444 33.0 33.0 34.0 31.0 34.0 4 32.46025 33.0 33.0 34.0 32.0 34.0 5 32.50625 33.0 33.0 34.0 32.0 34.0 6 36.5995 38.0 38.0 38.0 34.0 38.0 7 36.59925 38.0 38.0 38.0 35.0 38.0 8 36.64225 38.0 38.0 38.0 35.0 38.0 9 36.73175 38.0 38.0 38.0 35.0 38.0 10-14 36.360200000000006 38.0 37.8 38.0 33.8 38.0 15-19 36.389700000000005 38.0 38.0 38.0 33.8 38.0 20-24 34.2596 37.8 33.8 38.0 22.8 38.0 25-29 36.1543 38.0 37.6 38.0 32.6 38.0 30-34 36.5501 38.0 38.0 38.0 34.6 38.0 35-39 36.48765 38.0 38.0 38.0 34.4 38.0 40-44 36.44565 38.0 38.0 38.0 34.2 38.0 45-49 35.99569999999999 38.0 37.4 38.0 31.6 38.0 50-54 35.03445 37.8 35.0 38.0 28.4 38.0 55-59 36.27419999999999 38.0 38.0 38.0 33.8 38.0 60-64 36.23935 38.0 38.0 38.0 33.4 38.0 65-69 36.2996 38.0 38.0 38.0 34.0 38.0 70-74 35.14895 38.0 35.6 38.0 28.4 38.0 75-79 34.500699999999995 38.0 35.2 38.0 23.4 38.0 80-84 36.07315 38.0 37.8 38.0 33.0 38.0 85-89 36.09655 38.0 38.0 38.0 33.4 38.0 90-94 35.8212 38.0 37.2 38.0 31.4 38.0 95-99 35.82405 38.0 37.4 38.0 32.0 38.0 100-104 35.647850000000005 38.0 37.0 38.0 31.4 38.0 105-109 35.4168 38.0 36.8 38.0 29.8 38.0 110-114 33.817750000000004 37.4 32.8 38.0 24.6 38.0 115-119 33.17765 37.2 31.2 38.0 21.8 38.0 120-124 34.80485 38.0 35.8 38.0 26.8 38.0 125-129 34.74055 38.0 35.8 38.0 27.2 38.0 130-134 34.37134999999999 38.0 35.0 38.0 24.2 38.0 135-139 34.27845 38.0 35.0 38.0 23.6 38.0 140-144 33.427299999999995 38.0 34.0 38.0 20.0 38.0 145-149 32.173950000000005 38.0 33.0 38.0 8.6 38.0 150 25.64975 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 6.0 4 1.0 5 0.0 6 0.0 7 1.0 8 2.0 9 2.0 10 4.0 11 1.0 12 2.0 13 4.0 14 3.0 15 4.0 16 5.0 17 1.0 18 12.0 19 5.0 20 11.0 21 9.0 22 14.0 23 15.0 24 22.0 25 23.0 26 32.0 27 41.0 28 53.0 29 59.0 30 90.0 31 89.0 32 131.0 33 161.0 34 220.0 35 347.0 36 810.0 37 1806.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.949999999999996 17.525 17.575 28.95 2 29.375 23.275000000000002 31.225 16.125 3 21.3 27.750000000000004 31.825 19.125 4 24.875 33.45 23.5 18.175 5 26.6 35.0 22.325 16.075 6 20.9 39.050000000000004 23.0 17.05 7 19.900000000000002 20.325 40.625 19.15 8 21.325 25.900000000000002 27.800000000000004 24.975 9 21.95 23.799999999999997 30.099999999999998 24.15 10-14 23.810000000000002 28.389999999999997 26.240000000000002 21.560000000000002 15-19 23.32 27.57 28.005000000000003 21.105 20-24 23.555 27.589999999999996 28.000000000000004 20.855 25-29 23.435 27.715 28.155 20.695 30-34 23.3 28.470000000000002 27.805000000000003 20.424999999999997 35-39 23.044999999999998 27.68 28.29 20.985 40-44 23.875 27.805000000000003 28.005000000000003 20.315 45-49 23.455000000000002 27.825 28.33 20.39 50-54 23.105 27.825 28.34 20.73 55-59 23.75 26.605 28.33 21.315 60-64 23.425 27.825 28.01 20.74 65-69 23.445 27.33 28.83 20.395 70-74 23.535 27.565 27.935 20.965 75-79 23.28 27.395000000000003 28.99 20.335 80-84 23.78 28.21 28.055000000000003 19.955000000000002 85-89 22.770000000000003 27.779999999999998 28.83 20.62 90-94 23.830000000000002 27.985 28.235 19.950000000000003 95-99 23.625 27.839999999999996 28.725 19.81 100-104 23.52 27.810000000000002 28.815 19.855 105-109 24.365000000000002 27.08 28.305000000000003 20.25 110-114 23.89 27.54 28.525 20.044999999999998 115-119 24.765 27.084999999999997 28.355000000000004 19.794999999999998 120-124 24.51 27.32 28.544999999999998 19.625 125-129 24.9 27.224999999999998 27.765 20.11 130-134 24.69 28.315 27.46 19.535 135-139 24.525 27.725 27.794999999999998 19.955000000000002 140-144 25.385 27.744999999999997 27.315 19.555 145-149 25.355 28.349999999999998 27.125 19.17 150 26.025 27.425 27.075 19.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.5 25 4.0 26 7.5 27 8.0 28 8.0 29 13.5 30 16.0 31 18.0 32 23.0 33 31.5 34 46.5 35 67.5 36 82.0 37 110.5 38 144.0 39 161.0 40 183.5 41 214.5 42 256.0 43 267.5 44 277.0 45 289.0 46 279.0 47 254.0 48 232.0 49 202.0 50 160.5 51 142.5 52 121.0 53 100.5 54 74.5 55 48.5 56 42.0 57 32.5 58 22.0 59 15.0 60 7.0 61 6.0 62 5.5 63 3.0 64 2.5 65 3.0 66 3.0 67 2.5 68 2.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.7 0.0 0.0 0.0 0.0 126-127 5.324999999999999 0.0 0.0 0.0 0.0 128-129 5.824999999999999 0.0 0.0 0.0 0.0 130-131 6.324999999999999 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 7.1125 0.0 0.0 0.0 0.0 136-137 7.6625 0.0 0.0 0.0 0.0 138 7.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTCA 10 0.006973645 144.0 5 AGTTCTC 10 0.006973645 144.0 4 >>END_MODULE Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893398 spots for SRR4237612.sra Written 2893398 spots for SRR4237612.sra Read 2893403 spots for SRR4237612.sra Written 2893403 spots for SRR4237612.sra SRR ids: ['SRR4237612.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_460815ff SRR4237612.sra spots: 57867965 blocks: [[1, 2893398], [2893399, 5786796], [5786797, 8680194], [8680195, 11573592], [11573593, 14466990], [14466991, 17360388], [17360389, 20253786], [20253787, 23147184], [23147185, 26040582], [26040583, 28933980], [28933981, 31827378], [31827379, 34720776], [34720777, 37614174], [37614175, 40507572], [40507573, 43400970], [43400971, 46294368], [46294369, 49187766], [49187767, 52081164], [52081165, 54974562], [54974563, 57867965]] SRR4237612 file size 19474830 SRR4237612 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237612 SRR4237612_1.fastq SRR4237612_2.fastq Input file: SRR4237612_1.fastq Paired file: SRR4237612_2.fastq trimmed: SRR4237612-trimmed-pair1.fastq, SRR4237612-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:38:43 2025 >> started Wed Feb 12 16:39:44 2025 >> done (61.607s) 57867965 read pairs processed; of these: 71896 ( 0.12%) short read pairs filtered out after trimming by size control 92227 ( 0.16%) empty read pairs filtered out after trimming by size control 57703842 (99.72%) read pairs available; of these: 22407495 (38.83%) trimmed read pairs available after processing 35296347 (61.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 10 0.00% 20 13 0.00% 21 18 0.00% 22 14 0.00% 23 13 0.00% 24 18 0.00% 25 19 0.00% 26 20 0.00% 27 21 0.00% 28 27 0.00% 29 21 0.00% 30 29 0.00% 31 26 0.00% 32 33 0.00% 33 27 0.00% 34 40 0.00% 35 36 0.00% 36 49 0.00% 37 51 0.00% 38 62 0.00% 39 70 0.00% 40 68 0.00% 41 96 0.00% 42 105 0.00% 43 119 0.00% 44 133 0.00% 45 134 0.00% 46 145 0.00% 47 192 0.00% 48 218 0.00% 49 226 0.00% 50 266 0.00% 51 293 0.00% 52 291 0.00% 53 369 0.00% 54 441 0.00% 55 476 0.00% 56 474 0.00% 57 550 0.00% 58 644 0.00% 59 727 0.00% 60 809 0.00% 61 969 0.00% 62 1100 0.00% 63 1231 0.00% 64 1476 0.00% 65 1959 0.00% 66 2020 0.00% 67 2109 0.00% 68 2610 0.00% 69 4510 0.01% 70 4311 0.01% 71 3556 0.01% 72 3799 0.01% 73 4241 0.01% 74 4857 0.01% 75 5418 0.01% 76 5984 0.01% 77 6665 0.01% 78 7481 0.01% 79 8314 0.01% 80 9342 0.02% 81 10546 0.02% 82 12277 0.02% 83 14251 0.02% 84 20255 0.04% 85 22023 0.04% 86 23335 0.04% 87 25292 0.04% 88 26903 0.05% 89 28638 0.05% 90 30266 0.05% 91 33035 0.06% 92 36022 0.06% 93 38759 0.07% 94 42132 0.07% 95 45288 0.08% 96 48795 0.08% 97 51901 0.09% 98 54520 0.09% 99 57989 0.10% 100 61234 0.11% 101 64541 0.11% 102 68699 0.12% 103 73242 0.13% 104 78154 0.14% 105 82743 0.14% 106 87362 0.15% 107 91393 0.16% 108 94259 0.16% 109 98747 0.17% 110 101369 0.18% 111 105361 0.18% 112 110973 0.19% 113 114877 0.20% 114 120836 0.21% 115 126621 0.22% 116 131241 0.23% 117 135966 0.24% 118 140365 0.24% 119 143856 0.25% 120 146979 0.25% 121 152538 0.26% 122 155418 0.27% 123 160887 0.28% 124 168444 0.29% 125 175675 0.30% 126 180869 0.31% 127 186991 0.32% 128 191843 0.33% 129 197632 0.34% 130 204587 0.35% 131 210107 0.36% 132 218325 0.38% 133 226992 0.39% 134 234390 0.41% 135 243244 0.42% 136 256010 0.44% 137 268085 0.46% 138 282553 0.49% 139 298404 0.52% 140 315729 0.55% 141 338427 0.59% 142 365415 0.63% 143 403837 0.70% 144 458753 0.80% 145 547356 0.95% 146 688704 1.19% 147 980393 1.70% 148 1731248 3.00% 149 9674245 16.77% 150 35296347 61.17% 57703842 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=39 prefix-density=0.25 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=82.73 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=16.3 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.4 sequence=TCTAGCTAGTGGTTTAATAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=2612.55 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=29.3 sequence=AAGAAGAAGTAAAGGAAGAACAGAAGCCTGTTGAAACAGAGGAGAAGGTTGAAACAGAAACCCCAGTAGAAAAGACTGAGTAATGAGGT SRR4237612 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:40:27 Started mapping on | Feb 12 16:40:27 Finished on | Feb 12 16:46:21 Mapping speed, Million of reads per hour | 586.82 Number of input reads | 57703842 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 55018805 Uniquely mapped reads % | 95.35% Average mapped length | 291.13 Number of splices: Total | 45809388 Number of splices: Annotated (sjdb) | 44976984 Number of splices: GT/AG | 45111714 Number of splices: GC/AG | 535440 Number of splices: AT/AC | 42207 Number of splices: Non-canonical | 120027 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1042999 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 84253 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1708509 1708509 1708509 N_multimapping 1042999 1042999 1042999 N_noFeature 1641574 54279585 2013283 N_ambiguous 591400 3547 221066 UnstrandedReadsAssigned:52785831 PositiveStrandReadsAssigned:735673 NegativeStrandReadsAssigned:52784456 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237612 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237612-trimmed-pair1.fastq SRR4237612-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,703,842 reads, 52,549,211 reads pseudoaligned [quant] estimated average fragment length: 225.302 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,298 rounds 52401 SRR4237612.ke.tsv 34699 SRR4237612.se.tsv 87100 total ==> SRR4237612.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.7 1159 12.954 Potri.005G024800.1.v4.1 1035 810.698 84 2.07725 Potri.004G059700.1.v4.1 961 736.718 44 1.19735 Potri.007G009000.2.v4.1 1416 1191.7 0 0 Potri.003G141000.2.v4.1 2943 2718.7 715.124 5.27338 Potri.016G087400.1.v4.1 270 86.0457 8115.08 1890.74 Potri.015G069301.1.v4.1 564 342.496 0 0 Potri.010G195200.1.v4.1 1773 1548.7 256 3.31392 Potri.012G127500.1.v4.1 977 752.718 11057 294.492 ==> SRR4237612.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9535 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 808 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237612 completed mapping pipeline successfully