Starting /dee2/code/volunteer_pipeline.sh SRR4237613 current disk space = 3051991048192 free memory = 1574563344 SRR4237613 SRAfilesize bea4808c5a99b44a23653936f0c361ba SRR4237613.sra SRR4237613.sra file validated SRR4237613 is paired end SRR4237613 is conventional basespace SRR4237613 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237613_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.1855 33.0 32.0 34.0 2.0 34.0 2 32.02575 33.0 32.0 34.0 27.0 34.0 3 32.26875 34.0 32.0 34.0 27.0 34.0 4 32.62675 34.0 33.0 34.0 32.0 34.0 5 32.69675 34.0 33.0 34.0 32.0 34.0 6 36.5965 38.0 37.0 38.0 34.0 38.0 7 36.95 38.0 38.0 38.0 35.0 38.0 8 37.01175 38.0 38.0 38.0 36.0 38.0 9 37.051 38.0 38.0 38.0 36.0 38.0 10-14 37.1126 38.0 38.0 38.0 36.0 38.0 15-19 37.1506 38.0 38.0 38.0 36.0 38.0 20-24 37.13315 38.0 38.0 38.0 36.0 38.0 25-29 36.626250000000006 38.0 37.8 38.0 34.2 38.0 30-34 36.725049999999996 38.0 38.0 38.0 35.0 38.0 35-39 36.9016 38.0 38.0 38.0 35.4 38.0 40-44 36.95934999999999 38.0 38.0 38.0 35.6 38.0 45-49 36.944500000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.672250000000005 38.0 37.8 38.0 34.6 38.0 55-59 36.38175 38.0 37.8 38.0 33.4 38.0 60-64 36.60885 38.0 38.0 38.0 34.2 38.0 65-69 36.6776 38.0 38.0 38.0 34.4 38.0 70-74 34.3737 37.0 31.8 38.0 28.4 38.0 75-79 36.244600000000005 38.0 37.4 38.0 32.8 38.0 80-84 34.4191 37.0 31.4 38.0 27.6 38.0 85-89 36.08985 38.0 37.2 38.0 32.6 38.0 90-94 36.155449999999995 38.0 37.2 38.0 33.4 38.0 95-99 36.22265 38.0 38.0 38.0 33.8 38.0 100-104 36.11705 38.0 37.2 38.0 33.4 38.0 105-109 35.95275 38.0 37.0 38.0 32.6 38.0 110-114 35.510450000000006 38.0 36.6 38.0 30.6 38.0 115-119 35.4222 38.0 36.6 38.0 29.6 38.0 120-124 34.9876 38.0 36.0 38.0 27.2 38.0 125-129 34.21735 38.0 34.4 38.0 24.2 38.0 130-134 34.537549999999996 38.0 35.2 38.0 25.4 38.0 135-139 34.48415 38.0 34.8 38.0 26.0 38.0 140-144 33.691050000000004 37.6 33.6 38.0 23.0 38.0 145-149 33.0519 37.6 33.8 38.0 17.2 38.0 150 25.84075 34.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 0.0 14 0.0 15 2.0 16 3.0 17 1.0 18 1.0 19 0.0 20 4.0 21 7.0 22 10.0 23 8.0 24 15.0 25 19.0 26 13.0 27 30.0 28 44.0 29 70.0 30 69.0 31 95.0 32 126.0 33 183.0 34 233.0 35 381.0 36 800.0 37 1876.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.48576460228941 10.302318755503375 9.216319342530085 44.99559729967714 2 21.7 14.575 37.824999999999996 25.900000000000002 3 20.474999999999998 19.175 25.224999999999998 35.125 4 24.0 28.000000000000004 22.6 25.4 5 23.474999999999998 33.275 23.674999999999997 19.575 6 17.675 36.05 25.025 21.25 7 12.475 27.025 40.75 19.75 8 17.025000000000002 25.25 31.775 25.95 9 15.8 23.849999999999998 35.199999999999996 25.15 10-14 19.74 30.314999999999998 27.315 22.63 15-19 19.165 28.77 28.134999999999998 23.93 20-24 19.744999999999997 28.74 27.589999999999996 23.925 25-29 19.865 29.375 27.265 23.494999999999997 30-34 19.625 28.970000000000002 27.515 23.89 35-39 19.994999999999997 28.93 27.08 23.995 40-44 19.74 29.225 27.47 23.565 45-49 19.345000000000002 29.175 27.744999999999997 23.735 50-54 19.919999999999998 29.294999999999998 27.01 23.775 55-59 19.585 28.845 27.71 23.86 60-64 19.425 29.165000000000003 27.555000000000003 23.855 65-69 20.255000000000003 28.525 27.655 23.565 70-74 19.835 29.470000000000002 27.445000000000004 23.25 75-79 19.68 28.815 27.485 24.02 80-84 20.09 29.01 27.345000000000002 23.555 85-89 20.305 28.485 27.22 23.990000000000002 90-94 19.665 28.985 27.495000000000005 23.855 95-99 19.905 28.52 27.634999999999998 23.94 100-104 20.155 28.68 27.18 23.985 105-109 19.935 29.080000000000002 27.575 23.41 110-114 20.380000000000003 28.605000000000004 27.305 23.71 115-119 20.630000000000003 28.694999999999997 27.005000000000003 23.669999999999998 120-124 20.43 28.57 27.515 23.485 125-129 20.195 28.575 27.495000000000005 23.735 130-134 20.29 27.97 27.705000000000002 24.035 135-139 20.424999999999997 28.605000000000004 27.250000000000004 23.72 140-144 20.595 28.38 27.439999999999998 23.585 145-149 20.71 28.235 27.229999999999997 23.825 150 19.925 26.950000000000003 28.199999999999996 24.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 1.0 23 0.5 24 1.5 25 2.5 26 4.0 27 7.5 28 12.5 29 14.5 30 17.0 31 26.5 32 35.5 33 37.0 34 52.0 35 74.5 36 92.0 37 115.5 38 145.0 39 172.0 40 205.5 41 234.0 42 248.0 43 260.5 44 270.0 45 269.5 46 276.0 47 262.5 48 225.5 49 200.0 50 165.5 51 138.5 52 111.0 53 83.0 54 64.0 55 47.0 56 32.5 57 25.0 58 22.5 59 15.5 60 9.5 61 5.5 62 3.0 63 2.5 64 2.5 65 1.5 66 1.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.2625000000000002 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.8625 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.4749999999999996 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 3.1624999999999996 0.0 0.0 0.0 0.0 130-131 3.5625 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.6625 0.0 0.0 0.0 0.0 138 5.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACATG 10 0.006993593 143.86249 4 GATCGGA 25 5.2125263E-4 28.772501 135-139 GAAGAGC 20 0.006167969 28.772501 140-144 TCGGAAG 20 0.006167969 28.772501 135-139 ATCGGAA 20 0.006167969 28.772501 135-139 GGAAGAG 20 0.006167969 28.772501 140-144 AGATCGG 25 5.2125263E-4 28.772501 135-139 >>END_MODULE SRR4237613 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237613_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1385 33.0 33.0 34.0 30.0 34.0 2 31.9955 33.0 33.0 34.0 28.0 34.0 3 32.175 33.0 33.0 34.0 30.0 34.0 4 32.2315 33.0 33.0 34.0 31.0 34.0 5 32.364 33.0 33.0 34.0 31.0 34.0 6 36.38125 38.0 38.0 38.0 34.0 38.0 7 36.08675 38.0 38.0 38.0 33.0 38.0 8 36.02575 38.0 38.0 38.0 31.0 38.0 9 36.29525 38.0 38.0 38.0 33.0 38.0 10-14 36.25105 38.0 38.0 38.0 33.4 38.0 15-19 36.32725 38.0 38.0 38.0 33.6 38.0 20-24 36.34345 38.0 38.0 38.0 33.6 38.0 25-29 36.2062 38.0 37.8 38.0 32.8 38.0 30-34 36.322500000000005 38.0 38.0 38.0 34.0 38.0 35-39 36.244099999999996 38.0 38.0 38.0 33.6 38.0 40-44 36.0511 38.0 37.6 38.0 32.2 38.0 45-49 34.5851 37.8 34.8 38.0 24.4 38.0 50-54 35.898500000000006 38.0 37.4 38.0 31.4 38.0 55-59 36.2176 38.0 37.8 38.0 33.0 38.0 60-64 36.174350000000004 38.0 38.0 38.0 33.0 38.0 65-69 36.01345 38.0 37.6 38.0 32.6 38.0 70-74 35.006949999999996 38.0 36.2 38.0 25.6 38.0 75-79 33.26075 37.2 31.0 38.0 22.8 38.0 80-84 35.64505 38.0 36.8 38.0 30.0 38.0 85-89 35.2507 38.0 36.4 38.0 28.0 38.0 90-94 35.3208 38.0 36.4 38.0 28.4 38.0 95-99 35.45354999999999 38.0 37.0 38.0 29.6 38.0 100-104 35.42700000000001 38.0 37.0 38.0 29.4 38.0 105-109 35.2067 38.0 36.4 38.0 28.2 38.0 110-114 34.26565000000001 37.8 34.0 38.0 24.2 38.0 115-119 34.516299999999994 38.0 35.0 38.0 24.6 38.0 120-124 34.7175 38.0 35.6 38.0 26.2 38.0 125-129 34.54445 38.0 35.2 38.0 24.6 38.0 130-134 34.10445 38.0 34.8 38.0 21.6 38.0 135-139 34.059000000000005 38.0 35.0 38.0 23.2 38.0 140-144 32.7516 37.6 32.0 38.0 17.0 38.0 145-149 31.4717 38.0 31.8 38.0 8.6 38.0 150 24.02175 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 1.0 5 0.0 6 2.0 7 0.0 8 1.0 9 1.0 10 3.0 11 2.0 12 3.0 13 2.0 14 4.0 15 4.0 16 2.0 17 6.0 18 6.0 19 5.0 20 7.0 21 14.0 22 15.0 23 22.0 24 33.0 25 39.0 26 46.0 27 60.0 28 66.0 29 71.0 30 97.0 31 123.0 32 124.0 33 158.0 34 212.0 35 359.0 36 711.0 37 1790.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.5 18.5 13.15 31.85 2 27.250000000000004 23.549999999999997 34.025 15.174999999999999 3 21.099999999999998 27.775 30.55 20.575 4 22.6 36.275 23.0 18.125 5 25.7 35.325 23.549999999999997 15.425 6 20.625 37.15 26.275 15.950000000000001 7 20.125 19.525000000000002 41.199999999999996 19.15 8 21.925 25.174999999999997 29.95 22.95 9 22.900000000000002 24.875 30.475 21.75 10-14 23.24 28.84 26.82 21.099999999999998 15-19 23.165 27.935 28.225 20.674999999999997 20-24 23.669999999999998 27.725 28.48 20.125 25-29 23.805 28.09 28.015 20.09 30-34 23.155 27.755000000000003 28.9 20.19 35-39 23.07 27.71 29.244999999999997 19.975 40-44 23.41 28.025 28.4 20.165 45-49 23.095 28.605000000000004 28.025 20.275000000000002 50-54 23.65 27.089999999999996 29.175 20.085 55-59 23.555 27.55 29.189999999999998 19.705000000000002 60-64 23.715 27.785 28.625 19.875 65-69 23.455000000000002 27.565 28.705000000000002 20.275000000000002 70-74 23.599999999999998 27.515 28.52 20.365 75-79 23.830000000000002 27.88 28.299999999999997 19.99 80-84 23.625 28.215 28.17 19.99 85-89 23.815 28.415000000000003 27.63 20.14 90-94 23.635 27.79 28.410000000000004 20.165 95-99 23.655 27.534999999999997 28.494999999999997 20.315 100-104 23.745 28.189999999999998 27.939999999999998 20.125 105-109 24.08 27.605 28.52 19.794999999999998 110-114 23.94 27.495000000000005 28.74 19.825 115-119 24.635 27.644999999999996 27.61 20.11 120-124 23.985 27.925 28.275 19.814999999999998 125-129 24.185000000000002 28.32 27.810000000000002 19.685 130-134 24.959999999999997 27.805000000000003 27.465 19.77 135-139 24.215 27.744999999999997 27.845 20.195 140-144 24.705 27.860000000000003 27.175 20.26 145-149 25.14 28.105000000000004 27.245 19.509999999999998 150 24.9 27.925 27.575 19.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 1.0 24 0.5 25 2.5 26 4.5 27 5.0 28 8.0 29 11.5 30 16.5 31 19.5 32 24.0 33 39.0 34 54.0 35 74.0 36 93.0 37 119.5 38 146.5 39 166.5 40 198.0 41 243.5 42 258.5 43 274.5 44 292.0 45 273.0 46 269.0 47 268.0 48 239.0 49 199.0 50 154.0 51 119.5 52 104.5 53 85.0 54 65.0 55 48.5 56 36.5 57 26.0 58 15.5 59 10.0 60 7.5 61 5.0 62 4.5 63 3.0 64 3.5 65 2.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.2875 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.225 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 3.9625000000000004 0.0 0.0 0.0 0.0 134-135 4.325 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCG 25 5.183459E-4 28.8 140-144 GATCGGA 25 5.183459E-4 28.8 135-139 GAAGAGC 25 5.183459E-4 28.8 140-144 TCGGAAG 25 5.183459E-4 28.8 135-139 AGAGCGT 25 5.183459E-4 28.8 140-144 ATCGGAA 25 5.183459E-4 28.8 135-139 AGATCGG 25 5.183459E-4 28.8 135-139 GGAAGAG 30 0.0015031899 23.999998 140-144 >>END_MODULE Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra Read 3481575 spots for SRR4237613.sra Written 3481575 spots for SRR4237613.sra Read 3481556 spots for SRR4237613.sra Written 3481556 spots for SRR4237613.sra SRR ids: ['SRR4237613.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zpl9tykz SRR4237613.sra spots: 69631139 blocks: [[1, 3481556], [3481557, 6963112], [6963113, 10444668], [10444669, 13926224], [13926225, 17407780], [17407781, 20889336], [20889337, 24370892], [24370893, 27852448], [27852449, 31334004], [31334005, 34815560], [34815561, 38297116], [38297117, 41778672], [41778673, 45260228], [45260229, 48741784], [48741785, 52223340], [52223341, 55704896], [55704897, 59186452], [59186453, 62668008], [62668009, 66149564], [66149565, 69631139]] SRR4237613 file size 23438009 SRR4237613 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237613 SRR4237613_1.fastq SRR4237613_2.fastq Input file: SRR4237613_1.fastq Paired file: SRR4237613_2.fastq trimmed: SRR4237613-trimmed-pair1.fastq, SRR4237613-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:43:59 2025 >> started Wed Feb 12 16:45:13 2025 >> done (73.944s) 69631139 read pairs processed; of these: 60367 ( 0.09%) short read pairs filtered out after trimming by size control 46803 ( 0.07%) empty read pairs filtered out after trimming by size control 69523969 (99.85%) read pairs available; of these: 26332567 (37.88%) trimmed read pairs available after processing 43191402 (62.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 6 0.00% 22 8 0.00% 23 9 0.00% 24 8 0.00% 25 6 0.00% 26 16 0.00% 27 23 0.00% 28 21 0.00% 29 9 0.00% 30 16 0.00% 31 15 0.00% 32 26 0.00% 33 14 0.00% 34 20 0.00% 35 22 0.00% 36 32 0.00% 37 44 0.00% 38 39 0.00% 39 40 0.00% 40 52 0.00% 41 56 0.00% 42 60 0.00% 43 51 0.00% 44 64 0.00% 45 71 0.00% 46 95 0.00% 47 104 0.00% 48 117 0.00% 49 134 0.00% 50 136 0.00% 51 146 0.00% 52 164 0.00% 53 189 0.00% 54 202 0.00% 55 232 0.00% 56 260 0.00% 57 265 0.00% 58 304 0.00% 59 345 0.00% 60 391 0.00% 61 428 0.00% 62 535 0.00% 63 558 0.00% 64 632 0.00% 65 730 0.00% 66 804 0.00% 67 932 0.00% 68 1023 0.00% 69 1454 0.00% 70 1500 0.00% 71 1478 0.00% 72 1630 0.00% 73 1948 0.00% 74 2121 0.00% 75 2464 0.00% 76 2587 0.00% 77 3101 0.00% 78 3362 0.00% 79 3869 0.01% 80 4327 0.01% 81 5061 0.01% 82 5704 0.01% 83 6980 0.01% 84 11164 0.02% 85 11805 0.02% 86 12525 0.02% 87 13771 0.02% 88 14516 0.02% 89 15575 0.02% 90 16582 0.02% 91 18123 0.03% 92 19656 0.03% 93 21262 0.03% 94 23476 0.03% 95 25162 0.04% 96 27266 0.04% 97 29557 0.04% 98 31584 0.05% 99 33592 0.05% 100 36402 0.05% 101 38860 0.06% 102 41592 0.06% 103 44664 0.06% 104 47776 0.07% 105 51291 0.07% 106 55547 0.08% 107 58597 0.08% 108 61415 0.09% 109 65712 0.09% 110 69046 0.10% 111 73009 0.11% 112 77495 0.11% 113 81250 0.12% 114 87460 0.13% 115 93294 0.13% 116 96941 0.14% 117 102773 0.15% 118 108732 0.16% 119 112278 0.16% 120 116477 0.17% 121 122787 0.18% 122 127783 0.18% 123 134336 0.19% 124 141784 0.20% 125 150708 0.22% 126 156181 0.22% 127 164702 0.24% 128 172165 0.25% 129 181025 0.26% 130 190788 0.27% 131 200393 0.29% 132 208516 0.30% 133 220404 0.32% 134 231369 0.33% 135 245273 0.35% 136 263195 0.38% 137 281139 0.40% 138 304592 0.44% 139 324633 0.47% 140 354277 0.51% 141 383974 0.55% 142 427359 0.61% 143 484105 0.70% 144 564595 0.81% 145 691629 0.99% 146 897358 1.29% 147 1307437 1.88% 148 2425111 3.49% 149 13071669 18.80% 150 43191402 62.12% 69523969 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=42 prefix-density=0.17 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=300.64 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=32.4 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=29 prefix-density=0.28 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=329.79 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=29.7 sequence=AAGAAGAAGAAG SRR4237613 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:45:57 Started mapping on | Feb 12 16:45:57 Finished on | Feb 12 16:51:03 Mapping speed, Million of reads per hour | 817.93 Number of input reads | 69523969 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 67545880 Uniquely mapped reads % | 97.15% Average mapped length | 293.77 Number of splices: Total | 64165340 Number of splices: Annotated (sjdb) | 63053984 Number of splices: GT/AG | 63164811 Number of splices: GC/AG | 791149 Number of splices: AT/AC | 62171 Number of splices: Non-canonical | 147209 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1252138 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 69766 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 783455 783455 783455 N_multimapping 1252138 1252138 1252138 N_noFeature 2022172 66788505 2459388 N_ambiguous 605397 4367 281643 UnstrandedReadsAssigned:64918311 PositiveStrandReadsAssigned:753008 NegativeStrandReadsAssigned:64804849 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237613 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237613-trimmed-pair1.fastq SRR4237613-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 69,523,969 reads, 64,390,857 reads pseudoaligned [quant] estimated average fragment length: 239.316 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR4237613.ke.tsv 34699 SRR4237613.se.tsv 87100 total ==> SRR4237613.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.68 1465 12.533 Potri.005G024800.1.v4.1 1035 796.684 205 3.91767 Potri.004G059700.1.v4.1 961 722.738 78 1.64314 Potri.007G009000.2.v4.1 1416 1177.68 0 0 Potri.003G141000.2.v4.1 2943 2704.68 1287.28 7.2463 Potri.016G087400.1.v4.1 270 78.4994 8203.25 1591.03 Potri.015G069301.1.v4.1 564 329.725 0 0 Potri.010G195200.1.v4.1 1773 1534.68 192.624 1.91096 Potri.012G127500.1.v4.1 977 738.706 39938 823.141 ==> SRR4237613.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4291 Potri.001G233950.v4.1 6 Potri.001G122700.v4.1 1258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR4237613 completed mapping pipeline successfully