Starting /dee2/code/volunteer_pipeline.sh SRR4237614 current disk space = 3051950424064 free memory = 1581845352 SRR4237614 SRAfilesize 1689b0a7346fc69f1db1fdd9e56e7936 SRR4237614.sra SRR4237614.sra file validated SRR4237614 is paired end SRR4237614 is conventional basespace SRR4237614 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237614_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.389 33.0 33.0 34.0 2.0 34.0 2 32.25925 34.0 32.0 34.0 28.0 34.0 3 32.39325 34.0 33.0 34.0 28.0 34.0 4 32.67975 34.0 33.0 34.0 32.0 34.0 5 32.80675 34.0 33.0 34.0 32.0 34.0 6 36.59725 38.0 37.0 38.0 34.0 38.0 7 37.0455 38.0 38.0 38.0 36.0 38.0 8 36.97 38.0 38.0 38.0 36.0 38.0 9 37.1295 38.0 38.0 38.0 36.0 38.0 10-14 36.837599999999995 38.0 38.0 38.0 35.2 38.0 15-19 36.9602 38.0 38.0 38.0 35.6 38.0 20-24 36.9638 38.0 38.0 38.0 35.6 38.0 25-29 37.0031 38.0 38.0 38.0 35.8 38.0 30-34 36.989000000000004 38.0 38.0 38.0 35.8 38.0 35-39 36.96995 38.0 38.0 38.0 35.6 38.0 40-44 36.892849999999996 38.0 38.0 38.0 35.4 38.0 45-49 36.55875 38.0 37.8 38.0 33.8 38.0 50-54 36.697950000000006 38.0 38.0 38.0 34.4 38.0 55-59 36.7873 38.0 38.0 38.0 35.2 38.0 60-64 36.69785 38.0 38.0 38.0 34.8 38.0 65-69 36.65695000000001 38.0 38.0 38.0 34.4 38.0 70-74 36.080200000000005 38.0 37.2 38.0 31.8 38.0 75-79 36.35835 38.0 38.0 38.0 33.6 38.0 80-84 36.47795 38.0 38.0 38.0 34.0 38.0 85-89 36.391949999999994 38.0 38.0 38.0 33.8 38.0 90-94 36.430600000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.24685 38.0 38.0 38.0 33.6 38.0 100-104 36.04944999999999 38.0 37.0 38.0 33.0 38.0 105-109 35.9994 38.0 37.0 38.0 32.6 38.0 110-114 35.86775 38.0 37.0 38.0 32.4 38.0 115-119 35.751599999999996 38.0 37.0 38.0 31.2 38.0 120-124 35.64075 38.0 36.8 38.0 31.2 38.0 125-129 35.48425 38.0 36.6 38.0 30.6 38.0 130-134 34.667449999999995 38.0 35.0 38.0 25.4 38.0 135-139 34.512800000000006 38.0 34.8 38.0 25.6 38.0 140-144 34.75935 38.0 35.4 38.0 27.4 38.0 145-149 33.964999999999996 38.0 35.0 38.0 23.6 38.0 150 27.43975 34.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 2.0 16 1.0 17 0.0 18 4.0 19 4.0 20 5.0 21 4.0 22 4.0 23 9.0 24 15.0 25 18.0 26 20.0 27 26.0 28 38.0 29 51.0 30 68.0 31 100.0 32 99.0 33 126.0 34 191.0 35 303.0 36 587.0 37 2317.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.3943661971831 11.774647887323944 8.76056338028169 33.07042253521127 2 23.35 14.499999999999998 33.75 28.4 3 18.6 22.95 27.200000000000003 31.25 4 23.549999999999997 29.325000000000003 23.150000000000002 23.974999999999998 5 21.875 34.449999999999996 23.25 20.424999999999997 6 17.724999999999998 36.475 24.425 21.375 7 13.3 25.650000000000002 42.3 18.75 8 16.675 25.55 31.75 26.025 9 16.625 25.775 33.300000000000004 24.3 10-14 19.32 30.509999999999998 26.85 23.32 15-19 19.41 29.835 26.950000000000003 23.805 20-24 19.470000000000002 29.28 27.37 23.880000000000003 25-29 19.485 29.59 27.32 23.605 30-34 19.650000000000002 28.785 27.560000000000002 24.005000000000003 35-39 19.375 29.465000000000003 27.655 23.505000000000003 40-44 19.905 29.485 27.555000000000003 23.055 45-49 20.064999999999998 29.12 26.985 23.830000000000002 50-54 20.055 29.505 26.955000000000002 23.485 55-59 19.765 29.195 27.955000000000002 23.085 60-64 19.67 29.595 27.055 23.68 65-69 19.925 29.304999999999996 27.49 23.28 70-74 19.97 29.225 27.025 23.78 75-79 19.509999999999998 29.25 27.665 23.575 80-84 19.67 28.994999999999997 27.365000000000002 23.97 85-89 19.900000000000002 28.88 27.37 23.849999999999998 90-94 20.34 28.99 27.034999999999997 23.635 95-99 19.79 28.835 27.22 24.154999999999998 100-104 20.655 28.694999999999997 27.3 23.35 105-109 20.015 29.21 27.35 23.425 110-114 20.560000000000002 28.82 27.11 23.51 115-119 20.075000000000003 29.304999999999996 27.279999999999998 23.34 120-124 20.24 28.685 27.375 23.7 125-129 19.8 28.915000000000003 27.13 24.154999999999998 130-134 20.495 28.810000000000002 26.97 23.724999999999998 135-139 20.66 29.005 26.895000000000003 23.44 140-144 19.97 28.77 27.1 24.16 145-149 21.075 29.065 26.150000000000002 23.71 150 20.375 29.2 25.6 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 2.5 24 4.5 25 5.5 26 4.5 27 8.0 28 11.5 29 18.0 30 24.0 31 26.0 32 35.5 33 46.5 34 55.0 35 75.0 36 95.5 37 108.5 38 139.5 39 169.0 40 210.0 41 242.5 42 243.0 43 253.5 44 265.0 45 263.5 46 268.5 47 257.0 48 225.5 49 211.5 50 173.5 51 131.0 52 106.5 53 82.5 54 68.5 55 55.5 56 32.0 57 19.0 58 18.5 59 11.5 60 7.5 61 5.0 62 3.0 63 2.0 64 2.5 65 2.5 66 1.0 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.9000000000000004 0.0 0.0 0.0 0.0 126-127 4.1375 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.175000000000001 0.0 0.0 0.0 0.0 134-135 5.7625 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138 6.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237614 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237614_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23225 33.0 33.0 34.0 31.0 34.0 2 32.3295 33.0 33.0 34.0 31.0 34.0 3 32.385 33.0 33.0 34.0 31.0 34.0 4 32.26 33.0 33.0 34.0 31.0 34.0 5 32.31475 33.0 33.0 34.0 31.0 34.0 6 36.3325 38.0 38.0 38.0 34.0 38.0 7 36.2545 38.0 38.0 38.0 33.0 38.0 8 36.26825 38.0 38.0 38.0 33.0 38.0 9 36.2385 38.0 38.0 38.0 33.0 38.0 10-14 36.24125 38.0 38.0 38.0 33.4 38.0 15-19 35.91145 38.0 37.6 38.0 31.0 38.0 20-24 35.9106 38.0 37.8 38.0 32.0 38.0 25-29 36.2022 38.0 38.0 38.0 33.4 38.0 30-34 36.17635 38.0 38.0 38.0 33.6 38.0 35-39 36.1323 38.0 38.0 38.0 33.4 38.0 40-44 36.17575000000001 38.0 38.0 38.0 33.8 38.0 45-49 36.054050000000004 38.0 38.0 38.0 33.2 38.0 50-54 36.104749999999996 38.0 38.0 38.0 33.6 38.0 55-59 36.0294 38.0 38.0 38.0 33.4 38.0 60-64 35.92165 38.0 38.0 38.0 32.4 38.0 65-69 35.9644 38.0 38.0 38.0 32.6 38.0 70-74 35.649 38.0 37.6 38.0 31.4 38.0 75-79 35.4649 38.0 36.8 38.0 30.0 38.0 80-84 35.654199999999996 38.0 37.0 38.0 31.0 38.0 85-89 35.51655 38.0 37.0 38.0 30.2 38.0 90-94 35.5321 38.0 37.0 38.0 30.2 38.0 95-99 35.4402 38.0 37.0 38.0 30.2 38.0 100-104 35.211349999999996 38.0 37.0 38.0 28.8 38.0 105-109 34.274649999999994 38.0 35.0 38.0 24.6 38.0 110-114 34.9328 38.0 36.4 38.0 27.2 38.0 115-119 34.85705 38.0 36.4 38.0 26.4 38.0 120-124 34.662099999999995 38.0 36.0 38.0 25.4 38.0 125-129 34.1846 38.0 35.2 38.0 22.8 38.0 130-134 33.689800000000005 38.0 34.4 38.0 20.2 38.0 135-139 33.5337 38.0 33.6 38.0 17.4 38.0 140-144 32.879149999999996 38.0 33.0 38.0 13.8 38.0 145-149 31.5957 38.0 32.4 38.0 6.2 38.0 150 24.0265 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 15.0 4 5.0 5 5.0 6 3.0 7 4.0 8 5.0 9 1.0 10 3.0 11 7.0 12 1.0 13 5.0 14 4.0 15 1.0 16 3.0 17 7.0 18 5.0 19 4.0 20 14.0 21 10.0 22 14.0 23 26.0 24 22.0 25 30.0 26 28.0 27 53.0 28 44.0 29 81.0 30 65.0 31 93.0 32 108.0 33 169.0 34 176.0 35 285.0 36 512.0 37 2178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.625 19.825 12.625 21.925 2 28.799999999999997 24.575 29.4 17.224999999999998 3 22.075 27.675 32.225 18.025 4 24.775 34.9 22.875 17.45 5 25.75 36.175000000000004 22.05 16.025 6 19.525000000000002 37.65 23.65 19.175 7 19.575 20.849999999999998 40.025 19.55 8 21.05 25.3 28.325 25.324999999999996 9 22.8 24.7 29.75 22.75 10-14 24.3 28.494999999999997 26.419999999999998 20.785 15-19 23.49 27.915 28.405 20.19 20-24 23.085 28.09 27.97 20.855 25-29 23.43 28.01 28.425 20.135 30-34 23.195 28.025 28.360000000000003 20.419999999999998 35-39 22.905 28.634999999999998 27.79 20.669999999999998 40-44 23.150000000000002 28.084999999999997 28.050000000000004 20.715 45-49 23.105 28.310000000000002 28.505000000000003 20.080000000000002 50-54 23.345 27.975 28.26 20.419999999999998 55-59 23.330000000000002 28.144999999999996 28.32 20.205000000000002 60-64 23.14 28.13 28.585 20.145 65-69 24.055 27.975 27.900000000000002 20.07 70-74 23.630000000000003 27.74 28.34 20.29 75-79 23.43 26.99 28.825 20.755000000000003 80-84 23.57 27.775 28.405 20.25 85-89 23.945 28.18 27.83 20.044999999999998 90-94 23.785 28.175 28.444999999999997 19.595000000000002 95-99 23.575 27.0 28.76 20.665 100-104 23.599999999999998 28.360000000000003 27.865000000000002 20.175 105-109 24.035 27.825 28.325 19.814999999999998 110-114 23.71 27.939999999999998 28.24 20.11 115-119 23.990000000000002 28.09 27.87 20.05 120-124 24.125 27.805000000000003 28.555000000000003 19.515 125-129 24.94 27.395000000000003 27.915 19.75 130-134 24.43 28.1 27.48 19.99 135-139 24.58 27.74 27.91 19.77 140-144 24.605 28.21 27.35 19.835 145-149 25.215 28.215 27.215 19.355 150 26.8 27.075 26.174999999999997 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.5 23 2.0 24 3.5 25 4.0 26 5.5 27 7.5 28 7.0 29 11.5 30 19.0 31 17.5 32 24.5 33 40.0 34 48.5 35 59.5 36 79.0 37 103.5 38 135.5 39 160.0 40 179.5 41 221.5 42 264.0 43 288.5 44 304.5 45 289.5 46 274.0 47 259.5 48 231.5 49 208.5 50 180.0 51 153.0 52 105.0 53 69.0 54 65.0 55 47.0 56 35.0 57 31.0 58 17.0 59 10.5 60 7.5 61 7.0 62 5.0 63 2.5 64 2.5 65 1.5 66 2.0 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.35 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.275 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.637499999999999 0.0 0.0 0.0 0.0 132-133 5.0625 0.0 0.0 0.0 0.0 134-135 5.6125 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAACC 10 0.006973645 144.0 2 >>END_MODULE Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095115 spots for SRR4237614.sra Written 3095115 spots for SRR4237614.sra Read 3095122 spots for SRR4237614.sra Written 3095122 spots for SRR4237614.sra SRR ids: ['SRR4237614.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_du5qpwke SRR4237614.sra spots: 61902307 blocks: [[1, 3095115], [3095116, 6190230], [6190231, 9285345], [9285346, 12380460], [12380461, 15475575], [15475576, 18570690], [18570691, 21665805], [21665806, 24760920], [24760921, 27856035], [27856036, 30951150], [30951151, 34046265], [34046266, 37141380], [37141381, 40236495], [40236496, 43331610], [43331611, 46426725], [46426726, 49521840], [49521841, 52616955], [52616956, 55712070], [55712071, 58807185], [58807186, 61902307]] SRR4237614 file size 20834057 SRR4237614 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237614 SRR4237614_1.fastq SRR4237614_2.fastq Input file: SRR4237614_1.fastq Paired file: SRR4237614_2.fastq trimmed: SRR4237614-trimmed-pair1.fastq, SRR4237614-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:59:12 2025 >> started Wed Feb 12 17:00:19 2025 >> done (67.545s) 61902307 read pairs processed; of these: 181165 ( 0.29%) short read pairs filtered out after trimming by size control 114684 ( 0.19%) empty read pairs filtered out after trimming by size control 61606458 (99.52%) read pairs available; of these: 24991023 (40.57%) trimmed read pairs available after processing 36615435 (59.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 5 0.00% 20 8 0.00% 21 6 0.00% 22 10 0.00% 23 21 0.00% 24 12 0.00% 25 13 0.00% 26 27 0.00% 27 34 0.00% 28 20 0.00% 29 26 0.00% 30 22 0.00% 31 31 0.00% 32 32 0.00% 33 29 0.00% 34 31 0.00% 35 33 0.00% 36 46 0.00% 37 43 0.00% 38 52 0.00% 39 68 0.00% 40 61 0.00% 41 92 0.00% 42 104 0.00% 43 95 0.00% 44 102 0.00% 45 135 0.00% 46 137 0.00% 47 169 0.00% 48 205 0.00% 49 198 0.00% 50 282 0.00% 51 253 0.00% 52 285 0.00% 53 351 0.00% 54 376 0.00% 55 423 0.00% 56 452 0.00% 57 547 0.00% 58 589 0.00% 59 663 0.00% 60 792 0.00% 61 907 0.00% 62 953 0.00% 63 1115 0.00% 64 1151 0.00% 65 1322 0.00% 66 1623 0.00% 67 1974 0.00% 68 2703 0.00% 69 5412 0.01% 70 5145 0.01% 71 3781 0.01% 72 3743 0.01% 73 3945 0.01% 74 4396 0.01% 75 4856 0.01% 76 5357 0.01% 77 5910 0.01% 78 6519 0.01% 79 7740 0.01% 80 8493 0.01% 81 10018 0.02% 82 11388 0.02% 83 14194 0.02% 84 27287 0.04% 85 27703 0.04% 86 28362 0.05% 87 29809 0.05% 88 31294 0.05% 89 32671 0.05% 90 34559 0.06% 91 36623 0.06% 92 39093 0.06% 93 41538 0.07% 94 44826 0.07% 95 47551 0.08% 96 50855 0.08% 97 53143 0.09% 98 55226 0.09% 99 59342 0.10% 100 62355 0.10% 101 66263 0.11% 102 70607 0.11% 103 75215 0.12% 104 79860 0.13% 105 83936 0.14% 106 87914 0.14% 107 91499 0.15% 108 94858 0.15% 109 99145 0.16% 110 103188 0.17% 111 108538 0.18% 112 113296 0.18% 113 118798 0.19% 114 124263 0.20% 115 129005 0.21% 116 133075 0.22% 117 139516 0.23% 118 143234 0.23% 119 146860 0.24% 120 151283 0.25% 121 157588 0.26% 122 163377 0.27% 123 169088 0.27% 124 175963 0.29% 125 182816 0.30% 126 189940 0.31% 127 195457 0.32% 128 201386 0.33% 129 209011 0.34% 130 216601 0.35% 131 223244 0.36% 132 232543 0.38% 133 241430 0.39% 134 252297 0.41% 135 265382 0.43% 136 277133 0.45% 137 291255 0.47% 138 307709 0.50% 139 324316 0.53% 140 345487 0.56% 141 372846 0.61% 142 408447 0.66% 143 455703 0.74% 144 528492 0.86% 145 637473 1.03% 146 811962 1.32% 147 1143888 1.86% 148 2064444 3.35% 149 10963617 17.80% 150 36615435 59.43% 61606458 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=2.9 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAAGGAAGAATAGAATAAAAGAAGCTGAGAACAGAAATTGTGGCACCATTTTAGTGGTTTTTGGATGAGGTGGGCTATATTGCTGCTAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=309.57 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=14.0 sequence=AGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=266.26 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=29.9 sequence=AAGAAGAAGAAA SRR4237614 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:01:03 Started mapping on | Feb 12 17:01:03 Finished on | Feb 12 17:05:34 Mapping speed, Million of reads per hour | 818.39 Number of input reads | 61606458 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 59475647 Uniquely mapped reads % | 96.54% Average mapped length | 291.16 Number of splices: Total | 52817327 Number of splices: Annotated (sjdb) | 51882085 Number of splices: GT/AG | 52016255 Number of splices: GC/AG | 622145 Number of splices: AT/AC | 47486 Number of splices: Non-canonical | 131441 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1084990 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 61257 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1228214 1228214 1228214 N_multimapping 1084990 1084990 1084990 N_noFeature 1692960 58688559 2113387 N_ambiguous 620454 3173 251710 UnstrandedReadsAssigned:57162233 PositiveStrandReadsAssigned:783915 NegativeStrandReadsAssigned:57110550 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237614 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237614-trimmed-pair1.fastq SRR4237614-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,606,458 reads, 56,835,015 reads pseudoaligned [quant] estimated average fragment length: 228.739 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52401 SRR4237614.ke.tsv 34699 SRR4237614.se.tsv 87100 total ==> SRR4237614.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.26 1294 13.4276 Potri.005G024800.1.v4.1 1035 807.261 135 3.1067 Potri.004G059700.1.v4.1 961 733.267 42 1.06406 Potri.007G009000.2.v4.1 1416 1188.26 0 0 Potri.003G141000.2.v4.1 2943 2715.26 778.199 5.32426 Potri.016G087400.1.v4.1 270 84.9625 8598.66 1880.11 Potri.015G069301.1.v4.1 564 339.736 0 0 Potri.010G195200.1.v4.1 1773 1545.26 127.766 1.53601 Potri.012G127500.1.v4.1 977 749.267 12528 310.617 ==> SRR4237614.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7556 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 674 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 41 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237614 completed mapping pipeline successfully