Starting /dee2/code/volunteer_pipeline.sh SRR4237615 current disk space = 3051983409152 free memory = 1486918868 SRR4237615 SRAfilesize 20d2a945159e1aaf98d5e8f24c0d2fea SRR4237615.sra SRR4237615.sra file validated SRR4237615 is paired end SRR4237615 is conventional basespace SRR4237615 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237615_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.224 34.0 33.0 34.0 18.0 34.0 2 32.77975 34.0 33.0 34.0 28.0 34.0 3 32.947 34.0 33.0 34.0 32.0 34.0 4 33.176 34.0 33.0 34.0 32.0 34.0 5 33.28575 34.0 33.0 34.0 33.0 34.0 6 37.117 38.0 38.0 38.0 36.0 38.0 7 37.354 38.0 38.0 38.0 37.0 38.0 8 37.4165 38.0 38.0 38.0 37.0 38.0 9 37.44325 38.0 38.0 38.0 37.0 38.0 10-14 37.4757 38.0 38.0 38.0 37.2 38.0 15-19 37.5047 38.0 38.0 38.0 37.2 38.0 20-24 37.213350000000005 38.0 38.0 38.0 36.6 38.0 25-29 37.4105 38.0 38.0 38.0 37.0 38.0 30-34 37.25145 38.0 38.0 38.0 36.6 38.0 35-39 37.30165 38.0 38.0 38.0 37.0 38.0 40-44 37.34675 38.0 38.0 38.0 37.0 38.0 45-49 37.087450000000004 38.0 38.0 38.0 36.2 38.0 50-54 37.206100000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.2293 38.0 38.0 38.0 37.0 38.0 60-64 37.1459 38.0 38.0 38.0 37.0 38.0 65-69 37.153999999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.185249999999996 38.0 38.0 38.0 36.8 38.0 75-79 37.11905 38.0 38.0 38.0 36.6 38.0 80-84 37.0395 38.0 38.0 38.0 36.2 38.0 85-89 36.99159999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.87305 38.0 38.0 38.0 35.8 38.0 95-99 36.896100000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.810950000000005 38.0 38.0 38.0 35.6 38.0 105-109 36.7583 38.0 38.0 38.0 35.2 38.0 110-114 36.694100000000006 38.0 38.0 38.0 35.0 38.0 115-119 36.49785 38.0 38.0 38.0 34.2 38.0 120-124 36.50175 38.0 38.0 38.0 34.4 38.0 125-129 36.28595 38.0 38.0 38.0 34.0 38.0 130-134 36.19075 38.0 38.0 38.0 34.0 38.0 135-139 35.9786 38.0 38.0 38.0 33.2 38.0 140-144 35.7371 38.0 37.8 38.0 33.0 38.0 145-149 35.3001 38.0 37.6 38.0 32.0 38.0 150 29.764 35.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 4.0 17 0.0 18 3.0 19 3.0 20 2.0 21 4.0 22 2.0 23 8.0 24 9.0 25 7.0 26 12.0 27 12.0 28 29.0 29 25.0 30 28.0 31 52.0 32 69.0 33 63.0 34 122.0 35 178.0 36 411.0 37 2953.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.779011660188786 12.243198223209328 7.329261521377013 32.648528595224874 2 23.775 15.575 34.300000000000004 26.35 3 19.5 21.975 26.950000000000003 31.574999999999996 4 22.925 30.125 21.8 25.15 5 21.9 34.699999999999996 23.775 19.625 6 18.15 36.25 24.525 21.075 7 12.125 28.125 41.449999999999996 18.3 8 17.75 25.775 30.2 26.275 9 16.8 25.674999999999997 32.550000000000004 24.975 10-14 19.615 31.4 26.455000000000002 22.53 15-19 19.905 29.794999999999998 27.384999999999998 22.915 20-24 19.650000000000002 29.455 27.295 23.599999999999998 25-29 19.7 29.604999999999997 26.87 23.825 30-34 19.965 29.99 27.084999999999997 22.96 35-39 19.77 29.9 27.125 23.205000000000002 40-44 19.875 29.505 27.089999999999996 23.53 45-49 19.85 29.945 26.845000000000002 23.36 50-54 20.205000000000002 29.98 26.784999999999997 23.03 55-59 20.115 29.349999999999998 27.35 23.185 60-64 19.855 29.654999999999998 26.834999999999997 23.655 65-69 19.88 29.735 27.165 23.22 70-74 20.13 29.705 27.29 22.875 75-79 20.31 29.4 26.995 23.294999999999998 80-84 19.93199319931993 29.072907290729074 27.277727772777276 23.717371737173718 85-89 20.89 29.354999999999997 27.0 22.755 90-94 20.62 28.89 26.865 23.625 95-99 20.66 28.785 27.265 23.29 100-104 20.685000000000002 28.88 27.384999999999998 23.05 105-109 20.875 28.345 27.065 23.715 110-114 20.54 28.549999999999997 27.089999999999996 23.82 115-119 20.45 29.635 26.279999999999998 23.635 120-124 20.835 29.080000000000002 26.31 23.775 125-129 21.195 28.139999999999997 26.619999999999997 24.044999999999998 130-134 20.905 28.410000000000004 26.490000000000002 24.195 135-139 21.165 28.349999999999998 26.255 24.23 140-144 20.395 28.144999999999996 26.61 24.85 145-149 20.544999999999998 28.235 26.695 24.525 150 20.150000000000002 27.474999999999998 27.35 25.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.5 21 2.0 22 3.5 23 2.0 24 1.5 25 4.0 26 6.0 27 9.0 28 13.5 29 18.5 30 25.0 31 32.5 32 44.5 33 58.0 34 69.0 35 81.5 36 99.0 37 121.0 38 141.0 39 169.5 40 193.5 41 211.0 42 233.5 43 261.0 44 282.5 45 277.0 46 252.0 47 229.5 48 217.5 49 188.0 50 149.0 51 131.5 52 109.0 53 79.5 54 69.5 55 56.5 56 36.0 57 27.0 58 24.5 59 18.0 60 11.5 61 8.0 62 9.0 63 8.5 64 4.5 65 3.0 66 2.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.950000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.2375 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 2.125 0.0 0.0 0.0 0.0 98-99 2.3875 0.0 0.0 0.0 0.0 100-101 2.75 0.0 0.0 0.0 0.0 102-103 3.2 0.0 0.0 0.0 0.0 104-105 3.7125 0.0 0.0 0.0 0.0 106-107 4.3125 0.0 0.0 0.0 0.0 108-109 4.9375 0.0 0.0 0.0 0.0 110-111 5.525 0.0 0.0 0.0 0.0 112-113 6.275 0.0 0.0 0.0 0.0 114-115 7.2 0.0 0.0 0.0 0.0 116-117 8.0125 0.0 0.0 0.0 0.0 118-119 8.837499999999999 0.0 0.0 0.0 0.0 120-121 9.775 0.0 0.0 0.0 0.0 122-123 10.4375 0.0 0.0 0.0 0.0 124-125 11.675 0.0 0.0 0.0 0.0 126-127 12.925 0.0 0.0 0.0 0.0 128-129 13.725000000000001 0.0 0.0 0.0 0.0 130-131 14.5625 0.0 0.0 0.0 0.0 132-133 15.6 0.0 0.0 0.0 0.0 134-135 16.8375 0.0 0.0 0.0 0.0 136-137 17.9 0.0 0.0 0.0 0.0 138 18.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCTGA 60 0.0047168583 14.39375 140-144 >>END_MODULE SRR4237615 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237615_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82025 33.0 33.0 34.0 32.0 34.0 2 32.9255 34.0 33.0 34.0 32.0 34.0 3 32.9005 34.0 33.0 34.0 32.0 34.0 4 32.89475 34.0 33.0 34.0 32.0 34.0 5 32.929 34.0 33.0 34.0 32.0 34.0 6 37.03825 38.0 38.0 38.0 37.0 38.0 7 37.1545 38.0 38.0 38.0 37.0 38.0 8 37.012 38.0 38.0 38.0 36.0 38.0 9 37.03725 38.0 38.0 38.0 36.0 38.0 10-14 36.9733 38.0 38.0 38.0 36.0 38.0 15-19 36.9722 38.0 38.0 38.0 36.2 38.0 20-24 37.015499999999996 38.0 38.0 38.0 36.4 38.0 25-29 37.01055 38.0 38.0 38.0 36.4 38.0 30-34 36.95425 38.0 38.0 38.0 36.4 38.0 35-39 36.926300000000005 38.0 38.0 38.0 36.2 38.0 40-44 36.67100000000001 38.0 38.0 38.0 35.0 38.0 45-49 36.9154 38.0 38.0 38.0 36.0 38.0 50-54 36.875800000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.86325 38.0 38.0 38.0 36.0 38.0 60-64 36.81635 38.0 38.0 38.0 36.0 38.0 65-69 36.80055 38.0 38.0 38.0 36.0 38.0 70-74 36.667500000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.6317 38.0 38.0 38.0 35.8 38.0 80-84 36.61585 38.0 38.0 38.0 35.4 38.0 85-89 36.566050000000004 38.0 38.0 38.0 35.4 38.0 90-94 36.48909999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.414 38.0 38.0 38.0 34.8 38.0 100-104 36.302049999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.258050000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.17335 38.0 38.0 38.0 34.0 38.0 115-119 36.0092 38.0 38.0 38.0 33.8 38.0 120-124 35.74985 38.0 38.0 38.0 33.2 38.0 125-129 35.4869 38.0 37.8 38.0 31.8 38.0 130-134 35.2142 38.0 37.2 38.0 30.6 38.0 135-139 34.90045 38.0 36.0 38.0 30.0 38.0 140-144 34.21275000000001 38.0 35.6 38.0 25.0 38.0 145-149 33.2935 38.0 34.2 38.0 14.4 38.0 150 25.763 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 5.0 5 3.0 6 3.0 7 2.0 8 2.0 9 3.0 10 5.0 11 1.0 12 2.0 13 5.0 14 1.0 15 3.0 16 4.0 17 3.0 18 2.0 19 3.0 20 7.0 21 10.0 22 6.0 23 6.0 24 17.0 25 13.0 26 22.0 27 24.0 28 34.0 29 44.0 30 43.0 31 56.0 32 74.0 33 87.0 34 113.0 35 198.0 36 438.0 37 2754.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.95 22.25 10.875 20.925 2 30.275000000000002 24.325 29.95 15.45 3 21.275 28.225 31.7 18.8 4 24.875 34.5 22.525000000000002 18.099999999999998 5 25.3 36.475 22.075 16.150000000000002 6 20.025000000000002 38.550000000000004 22.775000000000002 18.65 7 19.925 20.150000000000002 40.175 19.75 8 20.75 24.85 29.125 25.275 9 23.325000000000003 25.1 28.7 22.875 10-14 23.669999999999998 28.9 26.765 20.665 15-19 23.5 27.74 28.325 20.435 20-24 23.435 28.389999999999997 27.215 20.96 25-29 23.71 28.449999999999996 27.67 20.169999999999998 30-34 23.345 28.42 27.875 20.36 35-39 23.255 27.779999999999998 28.7 20.265 40-44 23.14 28.22 28.43 20.21 45-49 23.345 27.595 28.544999999999998 20.515 50-54 22.68 28.110000000000003 28.815 20.395 55-59 23.75 27.650000000000002 28.185 20.415 60-64 23.474999999999998 27.060000000000002 29.165000000000003 20.3 65-69 23.285 27.315 29.04 20.36 70-74 23.445 27.47 28.67 20.415 75-79 23.47 27.92 28.499999999999996 20.11 80-84 23.315 28.410000000000004 28.38 19.895 85-89 24.055 27.265 28.305000000000003 20.375 90-94 23.205000000000002 27.700000000000003 29.154999999999998 19.939999999999998 95-99 24.11 27.474999999999998 28.215 20.200000000000003 100-104 24.855 27.389999999999997 28.444999999999997 19.31 105-109 24.07 27.61 28.49 19.830000000000002 110-114 24.585 27.6 28.155 19.66 115-119 24.62 27.6 27.905 19.875 120-124 24.455 27.655 28.075 19.814999999999998 125-129 25.66 27.38 27.725 19.235 130-134 25.895000000000003 27.855 27.08 19.17 135-139 27.18 27.400000000000002 26.51 18.91 140-144 27.400000000000002 27.63 26.645000000000003 18.325 145-149 27.525 27.515 26.66 18.3 150 26.974999999999998 28.025 26.974999999999998 18.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.5 20 1.5 21 2.0 22 1.5 23 2.0 24 2.0 25 3.5 26 5.0 27 6.0 28 11.0 29 12.0 30 19.0 31 29.0 32 36.0 33 40.5 34 46.5 35 61.5 36 77.5 37 103.0 38 135.5 39 170.0 40 201.0 41 229.5 42 264.0 43 272.0 44 277.0 45 289.0 46 263.0 47 247.0 48 247.0 49 204.0 50 148.0 51 117.0 52 107.0 53 97.0 54 72.0 55 50.0 56 38.0 57 25.5 58 19.0 59 18.0 60 12.0 61 5.5 62 4.5 63 6.0 64 5.0 65 4.0 66 2.5 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8374999999999999 0.0 0.0 0.0 0.0 90-91 1.075 0.0 0.0 0.0 0.0 92-93 1.2375 0.0 0.0 0.0 0.0 94-95 1.5375 0.0 0.0 0.0 0.0 96-97 2.1 0.0 0.0 0.0 0.0 98-99 2.3875 0.0 0.0 0.0 0.0 100-101 2.75 0.0 0.0 0.0 0.0 102-103 3.225 0.0 0.0 0.0 0.0 104-105 3.725 0.0 0.0 0.0 0.0 106-107 4.3375 0.0 0.0 0.0 0.0 108-109 4.9625 0.0 0.0 0.0 0.0 110-111 5.55 0.0 0.0 0.0 0.0 112-113 6.275 0.0 0.0 0.0 0.0 114-115 7.1875 0.0 0.0 0.0 0.0 116-117 7.9625 0.0 0.0 0.0 0.0 118-119 8.775 0.0 0.0 0.0 0.0 120-121 9.7 0.0 0.0 0.0 0.0 122-123 10.399999999999999 0.0 0.0 0.0 0.0 124-125 11.6 0.0 0.0 0.0 0.0 126-127 12.7625 0.0 0.0 0.0 0.0 128-129 13.524999999999999 0.0 0.0 0.0 0.0 130-131 14.3875 0.0 0.0 0.0 0.0 132-133 15.425 0.0 0.0 0.0 0.0 134-135 16.65 0.0 0.0 0.0 0.0 136-137 17.6625 0.0 0.0 0.0 0.0 138 18.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGGA 10 0.006973645 144.0 3 GTTACAG 10 0.006973645 144.0 7 TTTTTTT 20 0.006139246 28.8 40-44 GTGTAGG 60 0.0047032754 14.4 140-144 >>END_MODULE Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817503 spots for SRR4237615.sra Written 1817503 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra Read 1817496 spots for SRR4237615.sra Written 1817496 spots for SRR4237615.sra SRR ids: ['SRR4237615.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tkvhvj3l SRR4237615.sra spots: 36349927 blocks: [[1, 1817496], [1817497, 3634992], [3634993, 5452488], [5452489, 7269984], [7269985, 9087480], [9087481, 10904976], [10904977, 12722472], [12722473, 14539968], [14539969, 16357464], [16357465, 18174960], [18174961, 19992456], [19992457, 21809952], [21809953, 23627448], [23627449, 25444944], [25444945, 27262440], [27262441, 29079936], [29079937, 30897432], [30897433, 32714928], [32714929, 34532424], [34532425, 36349927]] SRR4237615 file size 12225101 SRR4237615 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237615 SRR4237615_1.fastq SRR4237615_2.fastq Input file: SRR4237615_1.fastq Paired file: SRR4237615_2.fastq trimmed: SRR4237615-trimmed-pair1.fastq, SRR4237615-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:52:02 2025 >> started Wed Feb 12 16:52:45 2025 >> done (43.315s) 36349927 read pairs processed; of these: 37623 ( 0.10%) short read pairs filtered out after trimming by size control 39768 ( 0.11%) empty read pairs filtered out after trimming by size control 36272536 (99.79%) read pairs available; of these: 16584601 (45.72%) trimmed read pairs available after processing 19687935 (54.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 8 0.00% 21 7 0.00% 22 13 0.00% 23 13 0.00% 24 15 0.00% 25 14 0.00% 26 23 0.00% 27 16 0.00% 28 26 0.00% 29 28 0.00% 30 25 0.00% 31 23 0.00% 32 36 0.00% 33 38 0.00% 34 46 0.00% 35 47 0.00% 36 52 0.00% 37 77 0.00% 38 72 0.00% 39 101 0.00% 40 111 0.00% 41 128 0.00% 42 131 0.00% 43 143 0.00% 44 155 0.00% 45 187 0.00% 46 216 0.00% 47 282 0.00% 48 314 0.00% 49 322 0.00% 50 388 0.00% 51 490 0.00% 52 529 0.00% 53 572 0.00% 54 567 0.00% 55 641 0.00% 56 772 0.00% 57 897 0.00% 58 1067 0.00% 59 1126 0.00% 60 1369 0.00% 61 1632 0.00% 62 1744 0.00% 63 2056 0.01% 64 2271 0.01% 65 2601 0.01% 66 2873 0.01% 67 3268 0.01% 68 3980 0.01% 69 6648 0.02% 70 6275 0.02% 71 5851 0.02% 72 6478 0.02% 73 7288 0.02% 74 7915 0.02% 75 8893 0.02% 76 9926 0.03% 77 10626 0.03% 78 12174 0.03% 79 13647 0.04% 80 15385 0.04% 81 17480 0.05% 82 20032 0.06% 83 22811 0.06% 84 27424 0.08% 85 29709 0.08% 86 32021 0.09% 87 34283 0.09% 88 37431 0.10% 89 40471 0.11% 90 44156 0.12% 91 48045 0.13% 92 53020 0.15% 93 57507 0.16% 94 62365 0.17% 95 66135 0.18% 96 70681 0.19% 97 74633 0.21% 98 77102 0.21% 99 82550 0.23% 100 87314 0.24% 101 92158 0.25% 102 97997 0.27% 103 104305 0.29% 104 109822 0.30% 105 116069 0.32% 106 120091 0.33% 107 122551 0.34% 108 126663 0.35% 109 128751 0.35% 110 132551 0.37% 111 139076 0.38% 112 143191 0.39% 113 148118 0.41% 114 153902 0.42% 115 159280 0.44% 116 160725 0.44% 117 165682 0.46% 118 167688 0.46% 119 167288 0.46% 120 170124 0.47% 121 175467 0.48% 122 177954 0.49% 123 182746 0.50% 124 186064 0.51% 125 190502 0.53% 126 193848 0.53% 127 193916 0.53% 128 195176 0.54% 129 198201 0.55% 130 199612 0.55% 131 201756 0.56% 132 204487 0.56% 133 209504 0.58% 134 213624 0.59% 135 218427 0.60% 136 221233 0.61% 137 224363 0.62% 138 229795 0.63% 139 233334 0.64% 140 238489 0.66% 141 246743 0.68% 142 256010 0.71% 143 268770 0.74% 144 295226 0.81% 145 329343 0.91% 146 379939 1.05% 147 492382 1.36% 148 851071 2.35% 149 5522779 15.23% 150 19687935 54.28% 36272536 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=8.56 fanout-score-rank=19 prefix-density=0.29 prefix-fanout=5.0 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=36 fanout-score=130.38 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=12.5 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=36 prefix-density=0.19 prefix-fanout=2.3 sequence=TCTAGCTAGTGGTTTAATAAAGGATTGTTATGCTAATGGGGGTGTAGGTATGGAAATGTTCCACTTGGATCAAACCAATGCGAACTCACCGCATGGATGCATTTGATCTTTGATTTGGAGCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=265.98 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=28.7 sequence=AAGAAGAAGAAA SRR4237615 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:53:38 Started mapping on | Feb 12 16:53:39 Finished on | Feb 12 16:58:52 Mapping speed, Million of reads per hour | 417.19 Number of input reads | 36272536 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 34209154 Uniquely mapped reads % | 94.31% Average mapped length | 284.50 Number of splices: Total | 27105790 Number of splices: Annotated (sjdb) | 26601336 Number of splices: GT/AG | 26691097 Number of splices: GC/AG | 315923 Number of splices: AT/AC | 27044 Number of splices: Non-canonical | 71726 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 717993 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 65760 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1383480 1383480 1383480 N_multimapping 717993 717993 717993 N_noFeature 1007746 33695200 1291715 N_ambiguous 369645 2642 137587 UnstrandedReadsAssigned:32831763 PositiveStrandReadsAssigned:511312 NegativeStrandReadsAssigned:32779852 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR4237615 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237615-trimmed-pair1.fastq SRR4237615-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,272,536 reads, 32,794,724 reads pseudoaligned [quant] estimated average fragment length: 199.499 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR4237615.ke.tsv 34699 SRR4237615.se.tsv 87100 total ==> SRR4237615.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1819.5 746 13.386 Potri.005G024800.1.v4.1 1035 836.501 117 4.5665 Potri.004G059700.1.v4.1 961 762.52 22 0.941966 Potri.007G009000.2.v4.1 1416 1217.5 0 0 Potri.003G141000.2.v4.1 2943 2744.5 604.114 7.18653 Potri.016G087400.1.v4.1 270 103.483 5072 1600.21 Potri.015G069301.1.v4.1 564 368.208 0 0 Potri.010G195200.1.v4.1 1773 1574.5 126 2.61271 Potri.012G127500.1.v4.1 977 778.515 8110 340.109 ==> SRR4237615.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4175 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 605 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR4237615 completed mapping pipeline successfully