Starting /dee2/code/volunteer_pipeline.sh SRR4237616 current disk space = 2823414366208 free memory = 1581297872 SRR4237616 SRAfilesize 8b0c35449b4ae0b456a9aed5c94a25a0 SRR4237616.sra SRR4237616.sra file validated SRR4237616 is paired end SRR4237616 is conventional basespace SRR4237616 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237616_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28975 34.0 33.0 34.0 32.0 34.0 2 33.25825 34.0 33.0 34.0 33.0 34.0 3 33.28775 34.0 33.0 34.0 33.0 34.0 4 33.29475 34.0 33.0 34.0 33.0 34.0 5 33.30525 34.0 33.0 34.0 33.0 34.0 6 36.93075 38.0 37.0 38.0 36.0 38.0 7 37.294 38.0 38.0 38.0 36.0 38.0 8 37.33525 38.0 38.0 38.0 37.0 38.0 9 37.4255 38.0 38.0 38.0 37.0 38.0 10-14 37.4331 38.0 38.0 38.0 37.0 38.0 15-19 37.4625 38.0 38.0 38.0 37.4 38.0 20-24 37.4713 38.0 38.0 38.0 37.8 38.0 25-29 37.41959999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.407799999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.37215 38.0 38.0 38.0 37.0 38.0 40-44 37.29780000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.20275 38.0 38.0 38.0 36.6 38.0 50-54 37.198699999999995 38.0 38.0 38.0 36.8 38.0 55-59 37.17139999999999 38.0 38.0 38.0 36.2 38.0 60-64 37.18755 38.0 38.0 38.0 36.6 38.0 65-69 37.17785 38.0 38.0 38.0 36.0 38.0 70-74 37.0578 38.0 38.0 38.0 35.8 38.0 75-79 36.49935000000001 38.0 37.6 38.0 33.8 38.0 80-84 36.9036 38.0 38.0 38.0 35.8 38.0 85-89 36.46505 38.0 37.6 38.0 33.4 38.0 90-94 36.6751 38.0 37.8 38.0 34.4 38.0 95-99 36.710750000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.64125 38.0 38.0 38.0 34.6 38.0 105-109 36.6956 38.0 38.0 38.0 34.6 38.0 110-114 36.5415 38.0 38.0 38.0 34.4 38.0 115-119 36.5324 38.0 38.0 38.0 34.2 38.0 120-124 36.408950000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.2943 38.0 38.0 38.0 34.0 38.0 130-134 36.008050000000004 38.0 37.6 38.0 33.2 38.0 135-139 35.89645 38.0 37.0 38.0 33.0 38.0 140-144 35.669200000000004 38.0 36.4 38.0 32.2 38.0 145-149 35.322900000000004 38.0 36.0 38.0 31.8 38.0 150 29.9715 35.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 0.0 16 0.0 17 1.0 18 2.0 19 5.0 20 2.0 21 2.0 22 2.0 23 6.0 24 3.0 25 12.0 26 14.0 27 18.0 28 27.0 29 29.0 30 28.0 31 40.0 32 64.0 33 90.0 34 129.0 35 214.0 36 444.0 37 2863.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.8 12.725 8.475000000000001 37.0 2 22.12212212212212 16.09109109109109 34.25925925925926 27.52752752752753 3 19.35 21.525 26.474999999999998 32.65 4 22.925 30.175 23.05 23.849999999999998 5 22.45 33.875 23.599999999999998 20.075000000000003 6 17.917189460476788 36.03513174404015 24.742785445420328 21.304893350062734 7 13.825000000000001 25.974999999999998 41.475 18.725 8 16.325 26.075 32.25 25.35 9 16.5 24.05 34.150000000000006 25.3 10-14 19.335 30.325000000000003 27.35 22.99 15-19 19.6 28.98 27.955000000000002 23.465 20-24 19.46 29.615000000000002 27.58 23.345 25-29 19.555 30.075000000000003 27.095000000000002 23.275000000000002 30-34 19.475 29.054999999999996 27.639999999999997 23.830000000000002 35-39 19.955000000000002 29.220000000000002 27.474999999999998 23.35 40-44 19.81 29.675 27.650000000000002 22.865 45-49 19.55 29.7 26.99 23.76 50-54 19.875 29.62 27.02 23.485 55-59 19.74 29.435 27.1 23.724999999999998 60-64 19.220000000000002 29.565 27.325 23.89 65-69 20.235 28.875 27.215 23.674999999999997 70-74 19.655 28.93 27.525 23.89 75-79 19.74 28.83 27.644999999999996 23.785 80-84 19.855 28.895 27.450000000000003 23.799999999999997 85-89 20.24 28.705000000000002 27.54 23.515 90-94 19.994999999999997 28.035 27.750000000000004 24.22 95-99 20.200000000000003 28.935 27.075 23.79 100-104 19.84 29.304999999999996 27.22 23.635 105-109 20.45 28.255000000000003 27.355 23.94 110-114 20.535 28.775000000000002 27.29 23.400000000000002 115-119 20.255000000000003 29.099999999999998 26.52 24.125 120-124 20.79 28.449999999999996 26.5 24.26 125-129 20.95 28.365000000000002 26.884999999999998 23.799999999999997 130-134 20.865000000000002 28.71 26.41 24.015 135-139 20.96 28.310000000000002 26.645000000000003 24.085 140-144 20.935000000000002 29.160000000000004 26.290000000000003 23.615 145-149 21.32 28.310000000000002 25.990000000000002 24.38 150 21.367305751765894 26.992936427850655 25.6811301715439 25.958627648839556 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 1.5 24 2.5 25 5.5 26 8.0 27 5.5 28 8.0 29 12.5 30 19.5 31 34.5 32 42.0 33 54.0 34 69.0 35 78.5 36 104.0 37 128.5 38 152.5 39 162.5 40 187.0 41 233.0 42 254.0 43 263.5 44 263.5 45 253.0 46 233.0 47 220.0 48 213.0 49 199.0 50 165.0 51 137.5 52 120.0 53 88.5 54 68.0 55 53.5 56 42.5 57 34.0 58 23.0 59 15.0 60 8.0 61 5.5 62 6.0 63 3.5 64 1.5 65 4.0 66 4.0 67 1.5 68 1.5 69 3.5 70 2.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.375 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.8999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.9124999999999999 0.0 0.0 0.0 0.0 108-109 2.2375 0.0 0.0 0.0 0.0 110-111 2.575 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.225 0.0 0.0 0.0 0.0 116-117 3.65 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.6375 0.0 0.0 0.0 0.0 122-123 4.9625 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.7 0.0 0.0 0.0 0.0 128-129 6.175 0.0 0.0 0.0 0.0 130-131 6.75 0.0 0.0 0.0 0.0 132-133 7.25 0.0 0.0 0.0 0.0 134-135 8.1625 0.0 0.0 0.0 0.0 136-137 8.8875 0.0 0.0 0.0 0.0 138 9.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAACC 10 0.006973645 144.0 2 >>END_MODULE SRR4237616 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237616_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.443 33.0 33.0 34.0 31.0 34.0 2 32.63725 33.0 33.0 34.0 32.0 34.0 3 31.132 33.0 32.0 34.0 18.0 34.0 4 32.265 33.0 33.0 34.0 28.0 34.0 5 32.583 33.0 33.0 34.0 32.0 34.0 6 36.7935 38.0 38.0 38.0 35.0 38.0 7 36.9 38.0 38.0 38.0 36.0 38.0 8 36.78075 38.0 38.0 38.0 35.0 38.0 9 36.90175 38.0 38.0 38.0 36.0 38.0 10-14 36.4222 38.0 37.8 38.0 33.6 38.0 15-19 36.608650000000004 38.0 38.0 38.0 34.6 38.0 20-24 36.936499999999995 38.0 38.0 38.0 36.4 38.0 25-29 36.900850000000005 38.0 38.0 38.0 36.2 38.0 30-34 36.84705 38.0 38.0 38.0 36.0 38.0 35-39 36.33645 38.0 37.8 38.0 33.4 38.0 40-44 36.763 38.0 38.0 38.0 35.8 38.0 45-49 36.742200000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.818549999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.6741 38.0 38.0 38.0 35.8 38.0 60-64 36.694 38.0 38.0 38.0 35.6 38.0 65-69 36.5471 38.0 38.0 38.0 35.0 38.0 70-74 36.540749999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.552949999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.4566 38.0 38.0 38.0 34.4 38.0 85-89 36.416700000000006 38.0 38.0 38.0 34.6 38.0 90-94 36.4156 38.0 38.0 38.0 34.6 38.0 95-99 35.636050000000004 38.0 37.2 38.0 29.4 38.0 100-104 36.2423 38.0 38.0 38.0 34.2 38.0 105-109 36.19969999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.13105 38.0 38.0 38.0 34.0 38.0 115-119 33.7986 37.0 31.4 38.0 27.6 38.0 120-124 35.4124 38.0 36.8 38.0 31.0 38.0 125-129 35.70465 38.0 38.0 38.0 32.6 38.0 130-134 35.4334 38.0 37.4 38.0 31.4 38.0 135-139 35.24655 38.0 36.6 38.0 31.0 38.0 140-144 33.706100000000006 38.0 33.8 38.0 24.6 38.0 145-149 34.06355 38.0 35.2 38.0 26.0 38.0 150 27.8735 33.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 7.0 4 6.0 5 3.0 6 2.0 7 2.0 8 2.0 9 1.0 10 1.0 11 2.0 12 1.0 13 3.0 14 6.0 15 4.0 16 3.0 17 7.0 18 6.0 19 3.0 20 5.0 21 10.0 22 14.0 23 16.0 24 14.0 25 12.0 26 24.0 27 30.0 28 34.0 29 38.0 30 49.0 31 56.0 32 64.0 33 100.0 34 123.0 35 234.0 36 524.0 37 2592.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.325 21.65 12.325 23.7 2 28.275 25.900000000000002 30.45 15.375 3 21.349999999999998 28.025 31.025000000000002 19.6 4 24.425 35.75 21.825 18.0 5 25.174999999999997 38.4 21.125 15.299999999999999 6 20.0 38.525 24.65 16.825000000000003 7 19.825 20.3 41.325 18.55 8 21.475 25.174999999999997 29.725 23.625 9 21.349999999999998 24.8 30.25 23.599999999999998 10-14 23.615 29.065 26.69 20.630000000000003 15-19 23.755000000000003 28.075 27.765 20.405 20-24 23.53 27.97 27.694999999999997 20.805 25-29 23.705000000000002 28.175 27.474999999999998 20.645 30-34 23.165 28.02 28.389999999999997 20.424999999999997 35-39 23.845 27.575 27.83 20.75 40-44 24.11 28.595 27.665 19.63 45-49 23.94 27.355 28.549999999999997 20.155 50-54 23.794999999999998 27.355 28.48 20.369999999999997 55-59 24.285 27.650000000000002 28.050000000000004 20.015 60-64 23.505000000000003 27.205000000000002 28.82 20.47 65-69 23.325000000000003 28.095 28.225 20.355 70-74 23.79 27.33 28.78 20.1 75-79 23.674999999999997 27.985 28.499999999999996 19.84 80-84 23.849999999999998 27.345000000000002 28.549999999999997 20.255000000000003 85-89 24.05 27.855 27.944999999999997 20.150000000000002 90-94 23.96 26.974999999999998 29.125 19.939999999999998 95-99 23.24 27.305 28.775000000000002 20.68 100-104 23.615 27.665 28.425 20.294999999999998 105-109 23.830000000000002 27.67 28.565 19.935 110-114 23.98 27.675 29.025000000000002 19.32 115-119 24.66 27.435 27.655 20.25 120-124 24.610000000000003 27.955000000000002 28.21 19.225 125-129 24.545 27.63 27.815 20.01 130-134 25.055 27.425 27.875 19.645000000000003 135-139 24.95 27.034999999999997 28.18 19.835 140-144 25.005 28.065 27.565 19.365 145-149 25.255 28.139999999999997 27.284999999999997 19.32 150 25.650000000000002 27.250000000000004 27.0 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.5 24 6.5 25 7.0 26 4.0 27 6.5 28 10.5 29 11.0 30 15.5 31 23.5 32 30.0 33 36.0 34 47.0 35 69.0 36 77.5 37 98.0 38 130.5 39 166.0 40 203.5 41 232.0 42 258.0 43 266.0 44 271.5 45 269.0 46 260.5 47 254.5 48 241.0 49 209.0 50 170.0 51 143.0 52 117.5 53 92.5 54 72.0 55 55.5 56 42.5 57 27.0 58 17.0 59 17.0 60 14.5 61 6.0 62 3.5 63 3.5 64 2.0 65 2.5 66 2.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.5374999999999996 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.2625 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.7125 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 8.25 0.0 0.0 0.0 0.0 138 8.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGATC 10 0.006973645 144.0 1 AGACACT 10 0.006973645 144.0 2 >>END_MODULE Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379024 spots for SRR4237616.sra Written 2379024 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra Read 2379019 spots for SRR4237616.sra Written 2379019 spots for SRR4237616.sra SRR ids: ['SRR4237616.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8qk4on_h SRR4237616.sra spots: 47580385 blocks: [[1, 2379019], [2379020, 4758038], [4758039, 7137057], [7137058, 9516076], [9516077, 11895095], [11895096, 14274114], [14274115, 16653133], [16653134, 19032152], [19032153, 21411171], [21411172, 23790190], [23790191, 26169209], [26169210, 28548228], [28548229, 30927247], [30927248, 33306266], [33306267, 35685285], [35685286, 38064304], [38064305, 40443323], [40443324, 42822342], [42822343, 45201361], [45201362, 47580385]] SRR4237616 file size 16008800 SRR4237616 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237616 SRR4237616_1.fastq SRR4237616_2.fastq Input file: SRR4237616_1.fastq Paired file: SRR4237616_2.fastq trimmed: SRR4237616-trimmed-pair1.fastq, SRR4237616-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 14:37:05 2025 >> started Thu Apr 10 14:37:54 2025 >> done (49.821s) 47580385 read pairs processed; of these: 98512 ( 0.21%) short read pairs filtered out after trimming by size control 59750 ( 0.13%) empty read pairs filtered out after trimming by size control 47422123 (99.67%) read pairs available; of these: 17766323 (37.46%) trimmed read pairs available after processing 29655800 (62.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 8 0.00% 21 11 0.00% 22 10 0.00% 23 11 0.00% 24 19 0.00% 25 6 0.00% 26 10 0.00% 27 14 0.00% 28 13 0.00% 29 18 0.00% 30 24 0.00% 31 21 0.00% 32 25 0.00% 33 17 0.00% 34 30 0.00% 35 32 0.00% 36 33 0.00% 37 31 0.00% 38 35 0.00% 39 60 0.00% 40 58 0.00% 41 81 0.00% 42 78 0.00% 43 75 0.00% 44 114 0.00% 45 111 0.00% 46 131 0.00% 47 159 0.00% 48 177 0.00% 49 192 0.00% 50 211 0.00% 51 270 0.00% 52 286 0.00% 53 277 0.00% 54 323 0.00% 55 398 0.00% 56 435 0.00% 57 526 0.00% 58 585 0.00% 59 651 0.00% 60 794 0.00% 61 945 0.00% 62 1021 0.00% 63 1162 0.00% 64 1385 0.00% 65 1550 0.00% 66 1823 0.00% 67 2291 0.00% 68 2908 0.01% 69 5758 0.01% 70 3960 0.01% 71 3311 0.01% 72 3767 0.01% 73 4208 0.01% 74 4900 0.01% 75 5332 0.01% 76 6072 0.01% 77 6645 0.01% 78 7452 0.02% 79 8481 0.02% 80 9475 0.02% 81 10857 0.02% 82 12316 0.03% 83 14426 0.03% 84 23330 0.05% 85 26375 0.06% 86 23753 0.05% 87 27327 0.06% 88 32072 0.07% 89 27955 0.06% 90 29768 0.06% 91 33700 0.07% 92 37210 0.08% 93 37032 0.08% 94 40429 0.09% 95 43256 0.09% 96 46074 0.10% 97 47897 0.10% 98 50373 0.11% 99 54172 0.11% 100 56509 0.12% 101 59694 0.13% 102 63061 0.13% 103 67016 0.14% 104 70126 0.15% 105 74556 0.16% 106 78820 0.17% 107 81450 0.17% 108 85839 0.18% 109 90389 0.19% 110 93351 0.20% 111 94514 0.20% 112 98572 0.21% 113 102715 0.22% 114 106979 0.23% 115 111368 0.23% 116 115019 0.24% 117 119573 0.25% 118 123699 0.26% 119 125881 0.27% 120 130127 0.27% 121 134309 0.28% 122 136486 0.29% 123 140990 0.30% 124 146309 0.31% 125 151157 0.32% 126 155946 0.33% 127 160710 0.34% 128 165468 0.35% 129 169579 0.36% 130 176034 0.37% 131 177835 0.38% 132 184060 0.39% 133 191887 0.40% 134 196162 0.41% 135 202620 0.43% 136 211753 0.45% 137 220057 0.46% 138 230096 0.49% 139 240152 0.51% 140 251686 0.53% 141 266905 0.56% 142 284773 0.60% 143 310022 0.65% 144 350329 0.74% 145 399817 0.84% 146 486659 1.03% 147 666158 1.40% 148 1191170 2.51% 149 7510791 15.84% 150 29655800 62.54% 47422123 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=42 prefix-density=0.26 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=132.16 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=12.1 sequence=AAAAAAAGAGGGATCTAGCAGAGCACTGCCTCTATCCTGGCAATTCATGAGAAAACCATCACAAAAACGGCGACACAAGTACCGGCTAAAGCCACAAATGGGGAAATATTGATCCCTAAGGATGAATCGGGTACGTTGTTGGATGAAGGCTTGTAATTGGTGACGTTACTACCGGCCGGAGAAGTGGTAGTGCCATCAGAAGATGGAGTTCCGGAGGAGGGACTTGTGCTCGATCCTGCTGCTGCAACAGTGACTGCAACCTTCATGCCACTCCCACAGTGGCCAGGAACACCACAAATGAAATAATGAGTTCCGGCAGTCTTGAGGGCTATTGTGGTAGCACCACTGCTATCTGAAGTGATTGCATTGCCTGTAGTGCATGTGCTGTAGTCACTGGCTCTCACTTCATCTACCGTGTGGCCTCCTCCGTAGTTAAACACAAGGCTGTCGCCAACTGAAAAGGTCTTGCCACTAGTCCAGGTGCTATAATCCATACCAATTGCCCAGCCTG criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=22.48 fanout-score-rank=6 prefix-density=0.43 prefix-fanout=9.4 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=244.05 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=27.9 sequence=AAGAAGAAGAAA SRR4237616 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 14:38:42 Started mapping on | Apr 10 14:38:42 Finished on | Apr 10 14:43:08 Mapping speed, Million of reads per hour | 641.80 Number of input reads | 47422123 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 45250548 Uniquely mapped reads % | 95.42% Average mapped length | 290.48 Number of splices: Total | 37380922 Number of splices: Annotated (sjdb) | 36687937 Number of splices: GT/AG | 36793287 Number of splices: GC/AG | 450098 Number of splices: AT/AC | 35071 Number of splices: Non-canonical | 102466 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 906027 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 59953 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1325432 1325432 1325432 N_multimapping 906027 906027 906027 N_noFeature 1369511 44612591 1696068 N_ambiguous 493061 3198 179357 UnstrandedReadsAssigned:43387976 PositiveStrandReadsAssigned:634759 NegativeStrandReadsAssigned:43375123 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237616 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237616-trimmed-pair1.fastq SRR4237616-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,422,123 reads, 43,205,811 reads pseudoaligned [quant] estimated average fragment length: 218.488 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR4237616.ke.tsv 34699 SRR4237616.se.tsv 87100 total ==> SRR4237616.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.51 1000.45 12.7431 Potri.005G024800.1.v4.1 1035 817.512 161 4.51655 Potri.004G059700.1.v4.1 961 743.538 34 1.0487 Potri.007G009000.2.v4.1 1416 1198.51 0 0 Potri.003G141000.2.v4.1 2943 2725.51 799.225 6.72507 Potri.016G087400.1.v4.1 270 89.0069 4821 1242.19 Potri.015G069301.1.v4.1 564 349.09 0 0 Potri.010G195200.1.v4.1 1773 1555.51 301.63 4.44709 Potri.012G127500.1.v4.1 977 759.523 15728 474.907 ==> SRR4237616.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6335 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 773 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237616 completed mapping pipeline successfully