Starting /dee2/code/volunteer_pipeline.sh SRR4237617 current disk space = 3051817848832 free memory = 1581989336 SRR4237617 SRAfilesize 613d2e1e770f0b7d1614b20d6df47cc9 SRR4237617.sra SRR4237617.sra file validated SRR4237617 is paired end SRR4237617 is conventional basespace SRR4237617 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237617_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.656 34.0 33.0 34.0 32.0 34.0 2 33.07625 34.0 33.0 34.0 32.0 34.0 3 33.203 34.0 33.0 34.0 32.0 34.0 4 33.324 34.0 33.0 34.0 33.0 34.0 5 33.347 34.0 33.0 34.0 33.0 34.0 6 37.02075 38.0 37.0 38.0 36.0 38.0 7 37.34325 38.0 38.0 38.0 37.0 38.0 8 37.4725 38.0 38.0 38.0 37.0 38.0 9 37.55125 38.0 38.0 38.0 38.0 38.0 10-14 37.41935 38.0 38.0 38.0 37.4 38.0 15-19 36.9571 38.0 37.8 38.0 35.2 38.0 20-24 37.43885 38.0 38.0 38.0 37.0 38.0 25-29 37.416 38.0 38.0 38.0 37.2 38.0 30-34 37.063050000000004 38.0 38.0 38.0 36.0 38.0 35-39 37.38265 38.0 38.0 38.0 37.0 38.0 40-44 37.2413 38.0 38.0 38.0 37.0 38.0 45-49 37.15465 38.0 38.0 38.0 36.2 38.0 50-54 37.1402 38.0 38.0 38.0 36.2 38.0 55-59 36.63595 38.0 37.8 38.0 34.2 38.0 60-64 37.0796 38.0 38.0 38.0 36.0 38.0 65-69 37.019 38.0 38.0 38.0 36.0 38.0 70-74 36.98025 38.0 38.0 38.0 36.0 38.0 75-79 36.90605000000001 38.0 38.0 38.0 35.8 38.0 80-84 36.05265 38.0 37.2 38.0 30.0 38.0 85-89 36.7518 38.0 37.8 38.0 35.2 38.0 90-94 36.852 38.0 38.0 38.0 35.2 38.0 95-99 36.68245 38.0 38.0 38.0 34.8 38.0 100-104 36.66835 38.0 38.0 38.0 34.6 38.0 105-109 36.53895000000001 38.0 38.0 38.0 34.2 38.0 110-114 36.50515 38.0 38.0 38.0 34.0 38.0 115-119 36.37094999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.29415 38.0 38.0 38.0 34.0 38.0 125-129 36.1143 38.0 38.0 38.0 33.6 38.0 130-134 35.851 38.0 37.0 38.0 32.6 38.0 135-139 35.64110000000001 38.0 36.4 38.0 31.6 38.0 140-144 35.56875 38.0 36.2 38.0 32.2 38.0 145-149 35.0221 38.0 36.0 38.0 31.0 38.0 150 30.1705 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 3.0 16 0.0 17 0.0 18 4.0 19 2.0 20 1.0 21 3.0 22 5.0 23 7.0 24 3.0 25 9.0 26 13.0 27 16.0 28 29.0 29 25.0 30 43.0 31 52.0 32 82.0 33 87.0 34 124.0 35 217.0 36 532.0 37 2738.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.54533439069522 12.080359503039915 8.485329103885805 39.888977002379065 2 24.675 15.049999999999999 35.449999999999996 24.825 3 20.1 19.125 26.55 34.225 4 23.3 27.825 22.775000000000002 26.1 5 23.592694520890667 33.049787340505375 23.617713284963724 19.73980485364023 6 18.86886886886887 36.63663663663664 23.2982982982983 21.196196196196198 7 14.475 27.400000000000002 41.325 16.8 8 16.25 27.175 31.15 25.424999999999997 9 17.675 24.675 33.925 23.724999999999998 10-14 19.115 30.869999999999997 27.33 22.685 15-19 19.82 29.505 27.650000000000002 23.025000000000002 20-24 19.615 29.134999999999998 27.325 23.925 25-29 19.205 29.825000000000003 27.82 23.150000000000002 30-34 19.195 29.415000000000003 27.834999999999997 23.555 35-39 19.615 30.264999999999997 26.97 23.150000000000002 40-44 19.545 29.535 27.465 23.455000000000002 45-49 19.725 29.13 27.700000000000003 23.445 50-54 20.36 29.49 26.905 23.244999999999997 55-59 19.605 29.349999999999998 27.439999999999998 23.605 60-64 19.81 29.099999999999998 27.450000000000003 23.64 65-69 19.53 29.285 27.505000000000003 23.68 70-74 19.615 29.909999999999997 27.37 23.105 75-79 19.915 28.99 27.575 23.52 80-84 19.93 29.310000000000002 27.200000000000003 23.56 85-89 20.405 28.605000000000004 27.61 23.380000000000003 90-94 19.900000000000002 28.965000000000003 27.845 23.29 95-99 19.905 28.645 27.375 24.075 100-104 19.705000000000002 29.054999999999996 27.765 23.474999999999998 105-109 20.105 28.725 27.339999999999996 23.830000000000002 110-114 19.955000000000002 28.98 26.484999999999996 24.58 115-119 20.13 29.455 27.47 22.945 120-124 20.51 28.685 26.99 23.815 125-129 20.785 28.71 26.784999999999997 23.72 130-134 20.715 29.29 26.38 23.615 135-139 20.305 28.4 27.3 23.995 140-144 21.07 28.189999999999998 27.015 23.724999999999998 145-149 20.87 28.175 27.075 23.880000000000003 150 20.498614958448755 28.80886426592798 26.945353815159912 23.74716696046336 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.0 24 3.0 25 4.5 26 9.0 27 13.0 28 14.5 29 18.0 30 25.5 31 33.0 32 47.0 33 66.0 34 74.0 35 77.0 36 94.5 37 124.5 38 141.0 39 172.0 40 214.0 41 227.5 42 228.5 43 244.5 44 252.0 45 257.5 46 251.5 47 230.0 48 215.0 49 187.5 50 160.5 51 132.0 52 108.5 53 94.5 54 79.5 55 58.0 56 39.5 57 27.5 58 18.5 59 12.5 60 8.5 61 9.0 62 7.5 63 4.0 64 2.5 65 2.5 66 1.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.425 2 0.0 3 0.0 4 0.0 5 0.075 6 0.1 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.7250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.3375000000000004 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.3375 0.0 0.0 0.0 0.0 126-127 3.7375 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.6875 0.0 0.0 0.0 0.0 132-133 5.075 0.0 0.0 0.0 0.0 134-135 5.6 0.0 0.0 0.0 0.0 136-137 6.3875 0.0 0.0 0.0 0.0 138 6.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGTAT 10 0.005077987 159.88889 1 TTGTATT 10 0.0069881454 143.9 2 >>END_MODULE SRR4237617 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237617_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62375 33.0 33.0 34.0 32.0 34.0 2 32.8805 33.0 33.0 34.0 32.0 34.0 3 32.984 34.0 33.0 34.0 32.0 34.0 4 32.755 34.0 33.0 34.0 32.0 34.0 5 32.753 34.0 33.0 34.0 32.0 34.0 6 37.025 38.0 38.0 38.0 36.0 38.0 7 37.14275 38.0 38.0 38.0 37.0 38.0 8 37.10075 38.0 38.0 38.0 37.0 38.0 9 37.13975 38.0 38.0 38.0 37.0 38.0 10-14 37.11305 38.0 38.0 38.0 37.0 38.0 15-19 37.040299999999995 38.0 38.0 38.0 36.4 38.0 20-24 36.9285 38.0 38.0 38.0 36.2 38.0 25-29 37.001200000000004 38.0 38.0 38.0 36.6 38.0 30-34 37.00535000000001 38.0 38.0 38.0 36.6 38.0 35-39 37.032650000000004 38.0 38.0 38.0 36.4 38.0 40-44 37.018299999999996 38.0 38.0 38.0 36.6 38.0 45-49 36.979299999999995 38.0 38.0 38.0 36.4 38.0 50-54 37.01215 38.0 38.0 38.0 36.6 38.0 55-59 36.92835 38.0 38.0 38.0 36.2 38.0 60-64 36.987100000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.88719999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.7787 38.0 38.0 38.0 36.0 38.0 75-79 36.83265 38.0 38.0 38.0 36.0 38.0 80-84 36.73375 38.0 38.0 38.0 35.6 38.0 85-89 36.60225 38.0 38.0 38.0 34.8 38.0 90-94 36.66355 38.0 38.0 38.0 35.0 38.0 95-99 36.50935 38.0 38.0 38.0 35.0 38.0 100-104 36.38975 38.0 38.0 38.0 34.4 38.0 105-109 36.243550000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.273799999999994 38.0 38.0 38.0 34.0 38.0 115-119 36.13164999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.1057 38.0 38.0 38.0 34.0 38.0 125-129 35.842 38.0 38.0 38.0 33.2 38.0 130-134 35.633849999999995 38.0 37.6 38.0 32.6 38.0 135-139 35.53595 38.0 37.6 38.0 32.2 38.0 140-144 33.8678 37.4 32.2 38.0 28.0 38.0 145-149 33.46554999999999 37.6 33.4 38.0 24.2 38.0 150 29.1545 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 2.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 5.0 15 4.0 16 7.0 17 5.0 18 7.0 19 5.0 20 9.0 21 8.0 22 6.0 23 10.0 24 8.0 25 18.0 26 21.0 27 24.0 28 27.0 29 45.0 30 41.0 31 56.0 32 57.0 33 79.0 34 115.0 35 183.0 36 434.0 37 2815.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.91457286432161 20.376884422110553 13.040201005025127 28.668341708542716 2 28.67150362772079 24.043032274205654 31.973980485364024 15.31148361270953 3 21.065799349512133 28.57142857142857 30.497873405053788 19.864898674005506 4 24.81203007518797 34.91228070175438 22.63157894736842 17.644110275689222 5 25.80160320641283 37.399799599198396 21.668336673346694 15.130260521042086 6 21.05 38.824999999999996 22.6 17.525 7 21.25 20.525 39.825 18.4 8 22.175 25.3 28.7 23.825 9 21.475 25.05 30.925000000000004 22.55 10-14 23.57 29.14 26.490000000000002 20.8 15-19 23.47 28.105000000000004 27.815 20.61 20-24 23.41 28.055000000000003 27.935 20.599999999999998 25-29 23.86 27.894999999999996 27.845 20.4 30-34 23.53 28.065 28.155 20.25 35-39 23.49 28.055000000000003 28.095 20.36 40-44 23.150000000000002 27.74 28.199999999999996 20.91 45-49 23.49 28.060000000000002 28.23 20.22 50-54 23.7 27.79 27.805000000000003 20.705000000000002 55-59 23.89 27.750000000000004 28.395 19.965 60-64 23.189999999999998 27.855 28.185 20.77 65-69 24.0 28.02 27.860000000000003 20.119999999999997 70-74 24.12 27.060000000000002 28.349999999999998 20.47 75-79 23.385 27.755000000000003 28.58 20.28 80-84 23.285 27.310000000000002 28.52 20.885 85-89 23.3023302330233 27.947794779477945 28.442844284428443 20.307030703070307 90-94 23.21 27.474999999999998 29.26 20.055 95-99 23.79 28.035 28.000000000000004 20.175 100-104 24.125 27.935 28.24 19.7 105-109 24.0 28.060000000000002 28.189999999999998 19.75 110-114 23.535 27.91 28.660000000000004 19.895 115-119 24.154999999999998 27.515 27.85 20.48 120-124 24.08 27.715 28.000000000000004 20.205000000000002 125-129 24.145 27.905 27.92 20.03 130-134 24.305 27.63 28.27 19.794999999999998 135-139 24.575 27.279999999999998 28.075 20.07 140-144 24.946182728410513 27.47434292866083 28.155193992490613 19.424280350438046 145-149 25.009999999999998 27.455000000000002 27.985 19.55 150 24.250063019914293 27.653138391731787 28.91353667759012 19.1832619107638 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 1.0 23 1.5 24 1.5 25 2.5 26 2.5 27 6.5 28 8.5 29 6.0 30 12.5 31 23.5 32 30.0 33 36.5 34 50.0 35 66.0 36 93.0 37 127.5 38 145.5 39 168.0 40 198.0 41 231.0 42 256.5 43 253.0 44 249.0 45 250.5 46 278.0 47 266.0 48 220.5 49 197.5 50 174.5 51 155.0 52 125.5 53 97.0 54 70.0 55 53.0 56 42.0 57 27.0 58 19.5 59 14.0 60 8.5 61 7.0 62 2.5 63 3.5 64 4.5 65 1.5 66 2.0 67 2.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.075 3 0.075 4 0.25 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.125 145-149 0.0 150 0.8250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.6500000000000004 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.3125 0.0 0.0 0.0 0.0 126-127 3.75 0.0 0.0 0.0 0.0 128-129 4.2625 0.0 0.0 0.0 0.0 130-131 4.7375 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.2375 0.0 0.0 0.0 0.0 138 6.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTATTG 10 0.006973645 144.0 6 >>END_MODULE Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084760 spots for SRR4237617.sra Written 2084760 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra Read 2084748 spots for SRR4237617.sra Written 2084748 spots for SRR4237617.sra SRR ids: ['SRR4237617.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yhwnc1ey SRR4237617.sra spots: 41694972 blocks: [[1, 2084748], [2084749, 4169496], [4169497, 6254244], [6254245, 8338992], [8338993, 10423740], [10423741, 12508488], [12508489, 14593236], [14593237, 16677984], [16677985, 18762732], [18762733, 20847480], [20847481, 22932228], [22932229, 25016976], [25016977, 27101724], [27101725, 29186472], [29186473, 31271220], [31271221, 33355968], [33355969, 35440716], [35440717, 37525464], [37525465, 39610212], [39610213, 41694972]] SRR4237617 file size 14025922 SRR4237617 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237617 SRR4237617_1.fastq SRR4237617_2.fastq Input file: SRR4237617_1.fastq Paired file: SRR4237617_2.fastq trimmed: SRR4237617-trimmed-pair1.fastq, SRR4237617-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:34:30 2025 >> started Wed Feb 12 17:35:15 2025 >> done (44.532s) 41694972 read pairs processed; of these: 21323 ( 0.05%) short read pairs filtered out after trimming by size control 23154 ( 0.06%) empty read pairs filtered out after trimming by size control 41650495 (99.89%) read pairs available; of these: 13486399 (32.38%) trimmed read pairs available after processing 28164096 (67.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 6 0.00% 21 9 0.00% 22 7 0.00% 23 10 0.00% 24 12 0.00% 25 13 0.00% 26 6 0.00% 27 18 0.00% 28 7 0.00% 29 12 0.00% 30 17 0.00% 31 33 0.00% 32 13 0.00% 33 26 0.00% 34 18 0.00% 35 30 0.00% 36 28 0.00% 37 34 0.00% 38 30 0.00% 39 38 0.00% 40 59 0.00% 41 57 0.00% 42 37 0.00% 43 69 0.00% 44 76 0.00% 45 73 0.00% 46 73 0.00% 47 105 0.00% 48 116 0.00% 49 122 0.00% 50 157 0.00% 51 148 0.00% 52 172 0.00% 53 205 0.00% 54 216 0.00% 55 262 0.00% 56 300 0.00% 57 300 0.00% 58 388 0.00% 59 389 0.00% 60 475 0.00% 61 563 0.00% 62 593 0.00% 63 658 0.00% 64 754 0.00% 65 845 0.00% 66 981 0.00% 67 1098 0.00% 68 1370 0.00% 69 2670 0.01% 70 2552 0.01% 71 1840 0.00% 72 1969 0.00% 73 2207 0.01% 74 2452 0.01% 75 2698 0.01% 76 3109 0.01% 77 3469 0.01% 78 3763 0.01% 79 4276 0.01% 80 4607 0.01% 81 5311 0.01% 82 6176 0.01% 83 7194 0.02% 84 9238 0.02% 85 10264 0.02% 86 11628 0.03% 87 12697 0.03% 88 13829 0.03% 89 15356 0.04% 90 15525 0.04% 91 17643 0.04% 92 18135 0.04% 93 19570 0.05% 94 21507 0.05% 95 23446 0.06% 96 25406 0.06% 97 26526 0.06% 98 28309 0.07% 99 30383 0.07% 100 32066 0.08% 101 33504 0.08% 102 35882 0.09% 103 38304 0.09% 104 40969 0.10% 105 44138 0.11% 106 46976 0.11% 107 49198 0.12% 108 51363 0.12% 109 52804 0.13% 110 55139 0.13% 111 57622 0.14% 112 60792 0.15% 113 63687 0.15% 114 67272 0.16% 115 71431 0.17% 116 74245 0.18% 117 77973 0.19% 118 81541 0.20% 119 84537 0.20% 120 86319 0.21% 121 90027 0.22% 122 92183 0.22% 123 96175 0.23% 124 99976 0.24% 125 103478 0.25% 126 108725 0.26% 127 113099 0.27% 128 116768 0.28% 129 121191 0.29% 130 125394 0.30% 131 129376 0.31% 132 133901 0.32% 133 138805 0.33% 134 144211 0.35% 135 150556 0.36% 136 158502 0.38% 137 167054 0.40% 138 176936 0.42% 139 188719 0.45% 140 197592 0.47% 141 209283 0.50% 142 226219 0.54% 143 247174 0.59% 144 278559 0.67% 145 326597 0.78% 146 394867 0.95% 147 547124 1.31% 148 1006689 2.42% 149 6026663 14.47% 150 28164096 67.62% 41650495 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=239.12 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=18.7 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=23.38 fanout-score-rank=5 prefix-density=0.41 prefix-fanout=9.6 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=123.97 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.0 sequence=CTTTGGAGAGGTAGGAATGGGAGTATTTGCACTTGTGGTAACGGTATTTGCATTATTGATGGTTTTTACTATGTTGGGTATGCTGTTCGATTTCTTAAAGGACTGAATATTCGGTGGCAGTATGGGATTTCTAAAAATAATGTTAAGAATTTTTGCTGGTTTTTTGCGACGTTGGTGTTGTATTCTATAGCTCCATTATGGCCGTTATATGGAATCATTGGAGTGCCAGTAATTCTACCACGCCTTATATTTAAAGACAAAAAGAAGTGTCTAACAACAACATCCACACTACTACTCCTTGTCATATTTCTTCCTGAATTGCTGATTCTTATTGGATTTCTGATATTTCCTATTGTTATGGGCTATTACATCTCTAAGGAATTGGTGAAGTAAAATGGTGAA SRR4237617 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:35:58 Started mapping on | Feb 12 17:35:58 Finished on | Feb 12 17:40:38 Mapping speed, Million of reads per hour | 535.51 Number of input reads | 41650495 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 39521723 Uniquely mapped reads % | 94.89% Average mapped length | 292.87 Number of splices: Total | 32517263 Number of splices: Annotated (sjdb) | 31899624 Number of splices: GT/AG | 32012776 Number of splices: GC/AG | 382540 Number of splices: AT/AC | 28809 Number of splices: Non-canonical | 93138 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.36 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 749412 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 96709 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1403524 1403524 1403524 N_multimapping 749412 749412 749412 N_noFeature 1215525 38922392 1540161 N_ambiguous 440969 2729 164431 UnstrandedReadsAssigned:37865229 PositiveStrandReadsAssigned:596602 NegativeStrandReadsAssigned:37817131 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237617 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237617-trimmed-pair1.fastq SRR4237617-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,650,495 reads, 37,631,005 reads pseudoaligned [quant] estimated average fragment length: 229.728 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR4237617.ke.tsv 34699 SRR4237617.se.tsv 87100 total ==> SRR4237617.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.27 843 12.8843 Potri.005G024800.1.v4.1 1035 806.272 59 2.00115 Potri.004G059700.1.v4.1 961 732.291 25 0.933611 Potri.007G009000.2.v4.1 1416 1187.27 0 0 Potri.003G141000.2.v4.1 2943 2714.27 441.061 4.44381 Potri.016G087400.1.v4.1 270 82.8024 6183 2042.05 Potri.015G069301.1.v4.1 564 338.733 0 0 Potri.010G195200.1.v4.1 1773 1544.27 100 1.77087 Potri.012G127500.1.v4.1 977 748.277 6755 246.873 ==> SRR4237617.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6874 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 511 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237617 completed mapping pipeline successfully