Starting /dee2/code/volunteer_pipeline.sh SRR4237618 current disk space = 3051823407104 free memory = 1581987972 SRR4237618 SRAfilesize df7bdc6e4dbf5c12d2427ea1ac8da628 SRR4237618.sra SRR4237618.sra file validated SRR4237618 is paired end SRR4237618 is conventional basespace SRR4237618 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237618_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.24625 34.0 33.0 34.0 33.0 34.0 2 33.32175 34.0 33.0 34.0 33.0 34.0 3 33.2445 34.0 33.0 34.0 33.0 34.0 4 33.32275 34.0 33.0 34.0 33.0 34.0 5 33.37575 34.0 33.0 34.0 33.0 34.0 6 36.56225 38.0 37.0 38.0 35.0 38.0 7 37.20925 38.0 38.0 38.0 36.0 38.0 8 37.089 38.0 38.0 38.0 36.0 38.0 9 37.3795 38.0 38.0 38.0 37.0 38.0 10-14 37.03505 38.0 38.0 38.0 36.0 38.0 15-19 37.4657 38.0 38.0 38.0 37.4 38.0 20-24 37.46045 38.0 38.0 38.0 37.6 38.0 25-29 37.370400000000004 38.0 38.0 38.0 37.2 38.0 30-34 37.309900000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.15235 38.0 38.0 38.0 36.6 38.0 40-44 36.999 38.0 38.0 38.0 36.0 38.0 45-49 37.0705 38.0 38.0 38.0 36.2 38.0 50-54 37.109049999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.86559999999999 38.0 38.0 38.0 35.6 38.0 60-64 36.80795 38.0 38.0 38.0 35.2 38.0 65-69 36.9995 38.0 38.0 38.0 36.0 38.0 70-74 37.028650000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.8944 38.0 38.0 38.0 36.0 38.0 80-84 36.847899999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.65415 38.0 38.0 38.0 34.6 38.0 90-94 36.705799999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.589999999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.59315 38.0 38.0 38.0 34.6 38.0 105-109 36.53625 38.0 38.0 38.0 34.6 38.0 110-114 36.41155 38.0 38.0 38.0 34.0 38.0 115-119 36.2226 38.0 37.8 38.0 33.4 38.0 120-124 36.172450000000005 38.0 38.0 38.0 33.8 38.0 125-129 36.1804 38.0 38.0 38.0 33.8 38.0 130-134 36.04365 38.0 38.0 38.0 33.6 38.0 135-139 35.786 38.0 37.2 38.0 32.4 38.0 140-144 35.595850000000006 38.0 37.4 38.0 32.2 38.0 145-149 34.37670000000001 38.0 35.4 38.0 26.2 38.0 150 29.803 35.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 2.0 17 3.0 18 3.0 19 6.0 20 4.0 21 5.0 22 1.0 23 9.0 24 6.0 25 15.0 26 22.0 27 19.0 28 31.0 29 35.0 30 47.0 31 52.0 32 66.0 33 86.0 34 117.0 35 211.0 36 397.0 37 2859.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.52128192288433 11.266900350525788 9.514271407110666 31.69754631947922 2 23.7 13.750000000000002 33.775 28.775000000000002 3 20.45 20.925 26.55 32.074999999999996 4 23.3 29.349999999999998 22.575 24.775 5 21.125 35.375 23.95 19.55 6 18.30098311066297 35.61885555835644 25.25838164860096 20.82177968237963 7 13.725000000000001 27.200000000000003 40.775 18.3 8 15.825 25.85 32.35 25.974999999999998 9 17.7 24.725 33.125 24.45 10-14 20.18 30.555 26.685 22.58 15-19 19.8 29.42 27.35 23.43 20-24 19.505 29.09 27.71 23.695 25-29 19.195 29.439999999999998 27.779999999999998 23.585 30-34 20.355 29.075 27.639999999999997 22.93 35-39 20.32 29.07 26.97 23.64 40-44 19.305 29.625 27.54 23.53 45-49 20.549999999999997 29.17 27.405 22.875 50-54 20.365 29.609999999999996 26.834999999999997 23.189999999999998 55-59 20.865000000000002 29.115000000000002 26.915 23.105 60-64 19.82 29.39 27.045 23.745 65-69 19.939999999999998 29.115000000000002 27.505000000000003 23.44 70-74 19.900000000000002 29.154999999999998 27.52 23.425 75-79 20.25 28.610000000000003 27.025 24.115000000000002 80-84 20.200000000000003 28.189999999999998 27.944999999999997 23.665 85-89 20.72 28.305000000000003 27.375 23.599999999999998 90-94 20.02 28.939999999999998 27.515 23.525 95-99 20.3 28.694999999999997 27.134999999999998 23.87 100-104 20.674999999999997 28.7 27.474999999999998 23.150000000000002 105-109 20.474999999999998 28.994999999999997 27.125 23.405 110-114 20.845 28.89 26.91 23.355 115-119 20.465 28.754999999999995 27.200000000000003 23.580000000000002 120-124 21.099999999999998 27.97 27.045 23.885 125-129 20.54 28.895 27.21 23.355 130-134 21.005 28.235 27.235 23.525 135-139 20.935000000000002 28.335 26.665 24.065 140-144 20.615 28.895 26.71 23.78 145-149 20.505000000000003 28.46 26.985 24.05 150 20.0 27.750000000000004 27.474999999999998 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 1.0 25 1.5 26 6.0 27 8.5 28 10.5 29 15.0 30 20.5 31 26.5 32 39.5 33 56.5 34 55.5 35 64.5 36 87.5 37 111.0 38 146.5 39 179.5 40 199.0 41 215.5 42 243.0 43 258.5 44 264.0 45 262.5 46 267.5 47 257.5 48 215.5 49 184.0 50 170.0 51 143.5 52 113.5 53 93.0 54 75.5 55 61.0 56 39.5 57 26.5 58 19.0 59 15.0 60 10.0 61 7.0 62 4.5 63 5.0 64 6.5 65 2.5 66 2.0 67 2.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8250000000000001 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.2750000000000004 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.3875 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.112500000000001 0.0 0.0 0.0 0.0 134-135 5.6375 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138 6.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGCC 10 0.0067234724 145.74683 6 CTCCATC 10 0.0067234724 145.74683 1 >>END_MODULE SRR4237618 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237618_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6725 33.0 33.0 34.0 32.0 34.0 2 32.74475 34.0 33.0 34.0 32.0 34.0 3 32.75625 34.0 33.0 34.0 32.0 34.0 4 32.182 34.0 33.0 34.0 31.0 34.0 5 32.46975 34.0 33.0 34.0 32.0 34.0 6 36.51925 38.0 38.0 38.0 35.0 38.0 7 36.65775 38.0 38.0 38.0 36.0 38.0 8 36.63075 38.0 38.0 38.0 35.0 38.0 9 36.6115 38.0 38.0 38.0 36.0 38.0 10-14 36.68335 38.0 38.0 38.0 36.0 38.0 15-19 36.6388 38.0 38.0 38.0 35.8 38.0 20-24 36.56185 38.0 38.0 38.0 35.8 38.0 25-29 36.48365 38.0 38.0 38.0 35.4 38.0 30-34 36.49575 38.0 38.0 38.0 35.6 38.0 35-39 36.1152 38.0 37.8 38.0 33.2 38.0 40-44 36.03275 38.0 37.8 38.0 32.8 38.0 45-49 36.5404 38.0 38.0 38.0 36.0 38.0 50-54 36.384699999999995 38.0 38.0 38.0 35.0 38.0 55-59 36.19134999999999 38.0 38.0 38.0 33.6 38.0 60-64 36.4026 38.0 38.0 38.0 34.8 38.0 65-69 36.047250000000005 38.0 37.8 38.0 33.0 38.0 70-74 36.25789999999999 38.0 38.0 38.0 34.6 38.0 75-79 36.21785 38.0 38.0 38.0 34.2 38.0 80-84 36.15259999999999 38.0 38.0 38.0 34.2 38.0 85-89 36.06185000000001 38.0 38.0 38.0 34.0 38.0 90-94 35.95985 38.0 38.0 38.0 33.8 38.0 95-99 35.95295 38.0 38.0 38.0 33.6 38.0 100-104 35.91245 38.0 38.0 38.0 34.0 38.0 105-109 35.792449999999995 38.0 38.0 38.0 33.4 38.0 110-114 35.67965 38.0 38.0 38.0 32.8 38.0 115-119 35.61175 38.0 38.0 38.0 32.2 38.0 120-124 35.528600000000004 38.0 38.0 38.0 33.0 38.0 125-129 35.38125 38.0 38.0 38.0 31.4 38.0 130-134 35.2234 38.0 38.0 38.0 31.0 38.0 135-139 35.0323 38.0 37.4 38.0 30.6 38.0 140-144 34.80055 38.0 37.2 38.0 28.8 38.0 145-149 34.40335 38.0 36.4 38.0 27.0 38.0 150 29.41875 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 14.0 4 5.0 5 4.0 6 4.0 7 3.0 8 5.0 9 2.0 10 1.0 11 3.0 12 3.0 13 4.0 14 2.0 15 7.0 16 8.0 17 6.0 18 11.0 19 8.0 20 8.0 21 16.0 22 6.0 23 10.0 24 13.0 25 16.0 26 21.0 27 27.0 28 32.0 29 31.0 30 51.0 31 59.0 32 52.0 33 82.0 34 106.0 35 160.0 36 326.0 37 2875.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.725 22.6 11.825 19.85 2 27.975 24.875 30.3 16.85 3 21.775 26.724999999999998 32.875 18.625 4 26.450000000000003 32.9 22.55 18.099999999999998 5 25.7 37.225 20.825 16.25 6 20.125 38.224999999999994 23.1 18.55 7 20.45 20.8 39.574999999999996 19.175 8 22.075 25.35 28.525 24.05 9 23.275000000000002 25.05 29.275000000000002 22.400000000000002 10-14 23.630000000000003 28.24 27.065 21.065 15-19 24.065 27.065 28.395 20.474999999999998 20-24 23.669999999999998 28.015 27.815 20.5 25-29 23.24 28.105000000000004 28.235 20.419999999999998 30-34 22.915 27.810000000000002 28.255000000000003 21.02 35-39 24.37 27.700000000000003 27.67 20.26 40-44 23.555 27.810000000000002 27.950000000000003 20.685000000000002 45-49 22.62 27.834999999999997 28.59 20.955 50-54 23.919999999999998 27.35 28.22 20.51 55-59 23.18 27.52 28.51 20.79 60-64 23.119999999999997 28.105000000000004 28.49 20.285 65-69 23.685000000000002 27.82 28.415000000000003 20.080000000000002 70-74 24.05 27.43 28.084999999999997 20.435 75-79 23.255 27.36 29.28 20.105 80-84 23.365 27.415 28.410000000000004 20.810000000000002 85-89 23.385 27.794999999999998 28.89 19.93 90-94 24.035 27.500000000000004 28.050000000000004 20.415 95-99 23.465 28.51 27.76 20.265 100-104 24.07 27.805000000000003 27.79 20.335 105-109 23.435 27.76 28.18 20.625 110-114 23.59 27.860000000000003 28.335 20.215 115-119 23.825 27.83 27.894999999999996 20.45 120-124 23.815 27.97 28.15 20.064999999999998 125-129 24.205 27.27 28.125 20.4 130-134 24.295 26.900000000000002 28.505000000000003 20.3 135-139 24.83 27.529999999999998 28.17 19.470000000000002 140-144 24.785 27.175 28.09 19.950000000000003 145-149 24.845 27.665 27.589999999999996 19.900000000000002 150 25.724999999999998 26.875 27.575 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 0.5 19 0.5 20 1.5 21 1.0 22 1.0 23 1.5 24 1.0 25 2.0 26 3.5 27 5.0 28 7.0 29 9.0 30 17.0 31 23.0 32 26.5 33 31.5 34 39.0 35 57.0 36 77.0 37 108.5 38 137.0 39 153.0 40 195.0 41 245.5 42 257.5 43 274.5 44 302.0 45 288.0 46 275.5 47 253.0 48 222.0 49 191.0 50 155.5 51 143.5 52 126.0 53 93.0 54 66.5 55 52.0 56 35.0 57 31.0 58 26.0 59 14.5 60 12.5 61 9.0 62 5.0 63 6.5 64 5.5 65 2.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.6749999999999998 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.725 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.2875 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 4.074999999999999 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.550000000000001 0.0 0.0 0.0 0.0 136-137 5.949999999999999 0.0 0.0 0.0 0.0 138 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGTTT 10 0.006973645 144.0 6 GGGGGGG 35 0.0036813593 20.571428 65-69 >>END_MODULE Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra Read 2235172 spots for SRR4237618.sra Written 2235172 spots for SRR4237618.sra Read 2235154 spots for SRR4237618.sra Written 2235154 spots for SRR4237618.sra SRR ids: ['SRR4237618.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fsku8byd SRR4237618.sra spots: 44703098 blocks: [[1, 2235154], [2235155, 4470308], [4470309, 6705462], [6705463, 8940616], [8940617, 11175770], [11175771, 13410924], [13410925, 15646078], [15646079, 17881232], [17881233, 20116386], [20116387, 22351540], [22351541, 24586694], [24586695, 26821848], [26821849, 29057002], [29057003, 31292156], [31292157, 33527310], [33527311, 35762464], [35762465, 37997618], [37997619, 40232772], [40232773, 42467926], [42467927, 44703098]] SRR4237618 file size 15039401 SRR4237618 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237618 SRR4237618_1.fastq SRR4237618_2.fastq Input file: SRR4237618_1.fastq Paired file: SRR4237618_2.fastq trimmed: SRR4237618-trimmed-pair1.fastq, SRR4237618-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:33:46 2025 >> started Wed Feb 12 17:34:39 2025 >> done (52.331s) 44703098 read pairs processed; of these: 125679 ( 0.28%) short read pairs filtered out after trimming by size control 55289 ( 0.12%) empty read pairs filtered out after trimming by size control 44522130 (99.60%) read pairs available; of these: 13612569 (30.57%) trimmed read pairs available after processing 30909561 (69.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 9 0.00% 21 12 0.00% 22 18 0.00% 23 10 0.00% 24 11 0.00% 25 16 0.00% 26 14 0.00% 27 14 0.00% 28 13 0.00% 29 13 0.00% 30 22 0.00% 31 20 0.00% 32 18 0.00% 33 27 0.00% 34 30 0.00% 35 26 0.00% 36 27 0.00% 37 49 0.00% 38 34 0.00% 39 38 0.00% 40 44 0.00% 41 65 0.00% 42 61 0.00% 43 62 0.00% 44 79 0.00% 45 87 0.00% 46 82 0.00% 47 106 0.00% 48 111 0.00% 49 126 0.00% 50 143 0.00% 51 179 0.00% 52 190 0.00% 53 209 0.00% 54 262 0.00% 55 250 0.00% 56 307 0.00% 57 323 0.00% 58 386 0.00% 59 435 0.00% 60 468 0.00% 61 554 0.00% 62 655 0.00% 63 755 0.00% 64 783 0.00% 65 885 0.00% 66 1050 0.00% 67 1277 0.00% 68 1940 0.00% 69 5655 0.01% 70 5098 0.01% 71 2209 0.00% 72 2326 0.01% 73 2443 0.01% 74 2890 0.01% 75 3182 0.01% 76 3525 0.01% 77 3820 0.01% 78 4382 0.01% 79 4913 0.01% 80 5350 0.01% 81 6182 0.01% 82 7318 0.02% 83 8326 0.02% 84 21967 0.05% 85 21030 0.05% 86 16268 0.04% 87 16938 0.04% 88 18175 0.04% 89 19866 0.04% 90 21678 0.05% 91 22533 0.05% 92 32047 0.07% 93 26854 0.06% 94 29716 0.07% 95 29601 0.07% 96 30265 0.07% 97 31828 0.07% 98 33418 0.08% 99 35929 0.08% 100 37621 0.08% 101 39883 0.09% 102 43257 0.10% 103 45270 0.10% 104 47940 0.11% 105 51179 0.11% 106 53558 0.12% 107 55493 0.12% 108 60496 0.14% 109 62547 0.14% 110 64205 0.14% 111 66163 0.15% 112 70594 0.16% 113 72173 0.16% 114 76328 0.17% 115 79642 0.18% 116 82751 0.19% 117 85707 0.19% 118 89765 0.20% 119 90640 0.20% 120 94075 0.21% 121 97784 0.22% 122 101032 0.23% 123 104710 0.24% 124 108596 0.24% 125 111491 0.25% 126 115942 0.26% 127 118901 0.27% 128 122218 0.27% 129 126257 0.28% 130 129930 0.29% 131 133965 0.30% 132 139338 0.31% 133 145378 0.33% 134 150284 0.34% 135 157022 0.35% 136 162049 0.36% 137 169577 0.38% 138 178410 0.40% 139 186296 0.42% 140 195675 0.44% 141 210287 0.47% 142 225239 0.51% 143 247116 0.56% 144 279310 0.63% 145 323928 0.73% 146 401746 0.90% 147 552815 1.24% 148 941744 2.12% 149 5818202 13.07% 150 30909561 69.43% 44522130 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=351.63 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=19.3 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.53 fanout-score-rank=24 prefix-density=0.27 prefix-fanout=4.4 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=9 fanout-score=253.41 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=29.0 sequence=AAGAAGAAGAAA SRR4237618 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:35:22 Started mapping on | Feb 12 17:35:22 Finished on | Feb 12 17:39:41 Mapping speed, Million of reads per hour | 618.84 Number of input reads | 44522130 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 42437872 Uniquely mapped reads % | 95.32% Average mapped length | 292.52 Number of splices: Total | 37464481 Number of splices: Annotated (sjdb) | 36806933 Number of splices: GT/AG | 36888631 Number of splices: GC/AG | 446031 Number of splices: AT/AC | 33332 Number of splices: Non-canonical | 96487 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 767037 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 63162 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1403083 1403083 1403083 N_multimapping 767037 767037 767037 N_noFeature 1210355 41867662 1503800 N_ambiguous 467148 2502 188777 UnstrandedReadsAssigned:40760369 PositiveStrandReadsAssigned:567708 NegativeStrandReadsAssigned:40745295 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237618 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237618-trimmed-pair1.fastq SRR4237618-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,522,130 reads, 40,521,358 reads pseudoaligned [quant] estimated average fragment length: 236.025 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52401 SRR4237618.ke.tsv 34699 SRR4237618.se.tsv 87100 total ==> SRR4237618.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.98 914 12.6256 Potri.005G024800.1.v4.1 1035 799.975 102 3.14033 Potri.004G059700.1.v4.1 961 725.997 40 1.35699 Potri.007G009000.2.v4.1 1416 1180.98 0 0 Potri.003G141000.2.v4.1 2943 2707.98 623.069 5.66687 Potri.016G087400.1.v4.1 270 82.6848 5991.64 1784.73 Potri.015G069301.1.v4.1 564 333.892 0 0 Potri.010G195200.1.v4.1 1773 1537.98 53 0.848748 Potri.012G127500.1.v4.1 977 741.99 12636 419.434 ==> SRR4237618.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3877 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 614 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237618 completed mapping pipeline successfully