Starting /dee2/code/volunteer_pipeline.sh SRR4237619 current disk space = 3051988209664 free memory = 1477156092 SRR4237619 SRAfilesize bc764e303bc3956f171f93ac7d57bc08 SRR4237619.sra SRR4237619.sra file validated SRR4237619 is paired end SRR4237619 is conventional basespace SRR4237619 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237619_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.91625 33.0 32.0 34.0 2.0 34.0 2 31.94475 34.0 31.0 34.0 27.0 34.0 3 32.28825 34.0 32.0 34.0 27.0 34.0 4 32.821 34.0 33.0 34.0 32.0 34.0 5 32.64325 33.0 33.0 34.0 32.0 34.0 6 36.7 38.0 37.0 38.0 34.0 38.0 7 37.10675 38.0 38.0 38.0 36.0 38.0 8 37.20775 38.0 38.0 38.0 36.0 38.0 9 37.217 38.0 38.0 38.0 36.0 38.0 10-14 37.2998 38.0 38.0 38.0 37.0 38.0 15-19 37.31505 38.0 38.0 38.0 37.0 38.0 20-24 37.288799999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.1623 38.0 38.0 38.0 36.4 38.0 30-34 37.260149999999996 38.0 38.0 38.0 37.0 38.0 35-39 36.238550000000004 38.0 36.8 38.0 31.0 38.0 40-44 37.18345 38.0 38.0 38.0 36.4 38.0 45-49 36.8643 38.0 37.8 38.0 35.0 38.0 50-54 37.1449 38.0 38.0 38.0 36.4 38.0 55-59 36.168600000000005 38.0 37.0 38.0 30.4 38.0 60-64 36.97735 38.0 38.0 38.0 35.8 38.0 65-69 36.9764 38.0 38.0 38.0 35.8 38.0 70-74 36.978300000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.9277 38.0 38.0 38.0 36.0 38.0 80-84 36.97235 38.0 38.0 38.0 35.8 38.0 85-89 36.86365 38.0 38.0 38.0 35.6 38.0 90-94 36.788850000000004 38.0 38.0 38.0 35.0 38.0 95-99 35.7447 38.0 36.6 38.0 29.4 38.0 100-104 35.830650000000006 38.0 37.2 38.0 30.6 38.0 105-109 36.406299999999995 38.0 37.8 38.0 34.0 38.0 110-114 36.40915 38.0 38.0 38.0 34.0 38.0 115-119 36.332750000000004 38.0 38.0 38.0 33.8 38.0 120-124 36.185500000000005 38.0 38.0 38.0 33.6 38.0 125-129 36.1175 38.0 37.8 38.0 33.4 38.0 130-134 35.96005 38.0 37.2 38.0 33.0 38.0 135-139 35.69445 38.0 36.8 38.0 31.8 38.0 140-144 35.392199999999995 38.0 36.0 38.0 31.0 38.0 145-149 34.772200000000005 38.0 36.0 38.0 29.8 38.0 150 29.206 34.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 3.0 21 3.0 22 3.0 23 5.0 24 7.0 25 9.0 26 17.0 27 24.0 28 28.0 29 46.0 30 50.0 31 63.0 32 87.0 33 121.0 34 151.0 35 258.0 36 565.0 37 2552.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.27148194271482 11.145703611457037 8.468244084682441 36.1145703611457 2 24.375 14.174999999999999 35.099999999999994 26.35 3 20.125 21.325 26.674999999999997 31.874999999999996 4 23.825 28.15 23.325000000000003 24.7 5 23.05 33.375 24.05 19.525000000000002 6 17.150000000000002 35.3 25.324999999999996 22.225 7 13.950000000000001 26.474999999999998 42.199999999999996 17.375 8 16.475 25.55 31.6 26.375 9 17.825 22.650000000000002 34.050000000000004 25.474999999999998 10-14 19.725 29.659999999999997 26.939999999999998 23.674999999999997 15-19 20.505000000000003 27.875 27.845 23.775 20-24 20.195 28.405 27.965 23.435 25-29 19.755 29.03 27.3 23.915 30-34 19.939999999999998 29.095 27.37 23.595 35-39 19.919999999999998 29.03 27.52 23.53 40-44 19.665 29.01 26.99 24.335 45-49 19.8 28.565 27.950000000000003 23.685000000000002 50-54 19.64 29.235 27.055 24.07 55-59 19.77 28.71 27.55 23.97 60-64 19.45 28.48 27.779999999999998 24.29 65-69 20.055 28.155 27.91 23.880000000000003 70-74 19.805 28.575 28.050000000000004 23.57 75-79 19.375 28.560000000000002 27.665 24.4 80-84 20.47 28.015 27.625 23.89 85-89 19.695 28.95 27.694999999999997 23.66 90-94 20.02 28.560000000000002 27.35 24.07 95-99 20.385 28.27 27.839999999999996 23.505000000000003 100-104 20.645 28.425 27.855 23.075000000000003 105-109 20.05 28.444999999999997 28.015 23.49 110-114 20.119999999999997 28.994999999999997 27.205000000000002 23.68 115-119 20.695 28.275 27.634999999999998 23.395 120-124 20.095 28.544999999999998 27.42 23.94 125-129 20.385 28.785 27.26 23.57 130-134 20.57 28.02 27.474999999999998 23.935000000000002 135-139 20.515 28.599999999999998 27.11 23.775 140-144 20.525 28.735 26.8 23.94 145-149 20.424999999999997 28.685 27.105 23.785 150 20.625 28.925 26.125 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 3.5 26 3.5 27 5.0 28 8.5 29 16.5 30 23.0 31 27.5 32 32.0 33 36.0 34 49.5 35 68.0 36 99.5 37 117.5 38 132.5 39 155.0 40 180.5 41 218.0 42 243.5 43 264.5 44 283.5 45 284.5 46 266.5 47 245.0 48 234.5 49 224.0 50 184.5 51 135.0 52 113.0 53 92.5 54 71.0 55 52.0 56 32.0 57 22.5 58 15.0 59 14.5 60 13.5 61 8.0 62 4.5 63 3.5 64 3.5 65 2.5 66 1.0 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 19.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.225 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.55 0.0 0.0 0.0 0.0 138 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 20 0.006181078 28.76 115-119 >>END_MODULE SRR4237619 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237619_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.537 33.0 33.0 34.0 31.0 34.0 2 32.6705 33.0 33.0 34.0 32.0 34.0 3 32.65575 33.0 33.0 34.0 31.0 34.0 4 32.56775 33.0 33.0 34.0 32.0 34.0 5 32.644 33.0 33.0 34.0 32.0 34.0 6 36.79525 38.0 38.0 38.0 35.0 38.0 7 36.7645 38.0 38.0 38.0 35.0 38.0 8 36.672 38.0 38.0 38.0 35.0 38.0 9 36.7635 38.0 38.0 38.0 35.0 38.0 10-14 36.6846 38.0 38.0 38.0 34.8 38.0 15-19 36.7064 38.0 38.0 38.0 35.0 38.0 20-24 36.735 38.0 38.0 38.0 35.0 38.0 25-29 36.64335 38.0 38.0 38.0 34.8 38.0 30-34 36.5645 38.0 38.0 38.0 34.4 38.0 35-39 36.66105 38.0 38.0 38.0 35.2 38.0 40-44 36.73395 38.0 38.0 38.0 34.8 38.0 45-49 36.25675 38.0 37.8 38.0 33.0 38.0 50-54 36.57835 38.0 38.0 38.0 34.4 38.0 55-59 36.457100000000004 38.0 38.0 38.0 34.0 38.0 60-64 36.074400000000004 38.0 37.6 38.0 32.2 38.0 65-69 36.18765 38.0 37.6 38.0 32.6 38.0 70-74 35.758050000000004 38.0 37.0 38.0 29.2 38.0 75-79 36.2285 38.0 38.0 38.0 33.4 38.0 80-84 36.050749999999994 38.0 37.8 38.0 32.4 38.0 85-89 36.177150000000005 38.0 38.0 38.0 33.4 38.0 90-94 36.09895 38.0 38.0 38.0 33.2 38.0 95-99 36.044050000000006 38.0 38.0 38.0 33.4 38.0 100-104 35.8255 38.0 37.4 38.0 31.8 38.0 105-109 35.76235 38.0 37.0 38.0 31.2 38.0 110-114 35.7406 38.0 37.0 38.0 31.8 38.0 115-119 35.48675 38.0 37.0 38.0 30.6 38.0 120-124 35.321349999999995 38.0 37.0 38.0 29.8 38.0 125-129 34.88175 38.0 36.0 38.0 27.0 38.0 130-134 34.3601 38.0 35.4 38.0 24.0 38.0 135-139 34.153800000000004 38.0 34.2 38.0 24.0 38.0 140-144 33.80045 38.0 34.4 38.0 22.2 38.0 145-149 32.28005 38.0 33.0 38.0 8.4 38.0 150 24.65425 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 2.0 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 2.0 12 5.0 13 2.0 14 4.0 15 3.0 16 6.0 17 6.0 18 0.0 19 5.0 20 7.0 21 11.0 22 15.0 23 19.0 24 20.0 25 26.0 26 32.0 27 37.0 28 47.0 29 66.0 30 61.0 31 105.0 32 89.0 33 117.0 34 183.0 35 253.0 36 536.0 37 2331.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.525 21.125 11.85 24.5 2 26.924999999999997 26.125 32.275 14.674999999999999 3 22.45 28.025 30.9 18.625 4 24.224999999999998 35.85 22.8 17.125 5 24.75 38.800000000000004 20.849999999999998 15.6 6 19.975 38.75 24.2 17.075000000000003 7 20.849999999999998 20.45 39.7 19.0 8 21.15 24.5 29.625 24.725 9 22.625 24.45 28.95 23.974999999999998 10-14 23.28 29.23 26.47 21.02 15-19 23.31 28.105000000000004 28.305000000000003 20.28 20-24 23.22 28.405 27.560000000000002 20.815 25-29 23.425 28.515 27.889999999999997 20.169999999999998 30-34 23.075000000000003 27.950000000000003 28.37 20.605 35-39 23.474999999999998 28.205000000000002 28.13 20.19 40-44 23.615 28.375 27.694999999999997 20.315 45-49 23.13 28.34 27.775 20.755000000000003 50-54 23.44 28.325 27.950000000000003 20.285 55-59 23.29 27.375 29.01 20.325 60-64 23.48 27.765 28.53 20.225 65-69 23.825 28.410000000000004 27.555000000000003 20.21 70-74 23.575 27.894999999999996 27.62 20.91 75-79 23.595 28.055000000000003 28.395 19.955000000000002 80-84 23.23 28.065 28.205000000000002 20.5 85-89 24.29 28.03 28.04 19.64 90-94 23.830000000000002 27.485 28.58 20.105 95-99 24.060000000000002 27.529999999999998 28.18 20.23 100-104 23.77 28.685 28.03 19.515 105-109 23.73 27.705000000000002 28.005000000000003 20.560000000000002 110-114 23.755000000000003 28.17 27.800000000000004 20.275000000000002 115-119 24.36 27.889999999999997 27.810000000000002 19.939999999999998 120-124 24.54 27.99 27.85 19.62 125-129 24.529999999999998 27.67 27.93 19.869999999999997 130-134 24.87 27.67 27.675 19.785 135-139 25.130000000000003 28.27 26.66 19.939999999999998 140-144 25.155 28.28 27.084999999999997 19.48 145-149 25.474999999999998 28.08 27.52 18.925 150 24.925 27.500000000000004 28.775000000000002 18.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 2.0 24 2.0 25 2.0 26 4.0 27 5.5 28 8.0 29 13.0 30 17.5 31 17.0 32 22.0 33 37.0 34 47.5 35 57.5 36 78.0 37 104.5 38 149.0 39 183.0 40 203.0 41 245.5 42 264.0 43 265.5 44 279.0 45 283.0 46 265.5 47 244.5 48 243.0 49 218.5 50 168.0 51 136.0 52 115.0 53 87.0 54 62.5 55 46.0 56 36.0 57 25.5 58 17.5 59 14.0 60 6.5 61 4.0 62 5.5 63 4.5 64 2.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 3.025 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.6624999999999996 0.0 0.0 0.0 0.0 126-127 3.9749999999999996 0.0 0.0 0.0 0.0 128-129 4.550000000000001 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 6.012499999999999 0.0 0.0 0.0 0.0 136-137 6.45 0.0 0.0 0.0 0.0 138 6.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGGTT 10 0.006973645 144.0 6 GAGGGCA 10 0.006973645 144.0 7 >>END_MODULE Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491043 spots for SRR4237619.sra Written 3491043 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra Read 3491042 spots for SRR4237619.sra Written 3491042 spots for SRR4237619.sra SRR ids: ['SRR4237619.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mu0nc78u SRR4237619.sra spots: 69820841 blocks: [[1, 3491042], [3491043, 6982084], [6982085, 10473126], [10473127, 13964168], [13964169, 17455210], [17455211, 20946252], [20946253, 24437294], [24437295, 27928336], [27928337, 31419378], [31419379, 34910420], [34910421, 38401462], [38401463, 41892504], [41892505, 45383546], [45383547, 48874588], [48874589, 52365630], [52365631, 55856672], [55856673, 59347714], [59347715, 62838756], [62838757, 66329798], [66329799, 69820841]] SRR4237619 file size 23501922 SRR4237619 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237619 SRR4237619_1.fastq SRR4237619_2.fastq Input file: SRR4237619_1.fastq Paired file: SRR4237619_2.fastq trimmed: SRR4237619-trimmed-pair1.fastq, SRR4237619-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:06:08 2025 >> started Wed Feb 12 17:07:35 2025 >> done (87.702s) 69820841 read pairs processed; of these: 62185 ( 0.09%) short read pairs filtered out after trimming by size control 39918 ( 0.06%) empty read pairs filtered out after trimming by size control 69718738 (99.85%) read pairs available; of these: 25790940 (36.99%) trimmed read pairs available after processing 43927798 (63.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 21 0.00% 20 8 0.00% 21 15 0.00% 22 11 0.00% 23 12 0.00% 24 10 0.00% 25 17 0.00% 26 17 0.00% 27 26 0.00% 28 20 0.00% 29 25 0.00% 30 33 0.00% 31 29 0.00% 32 23 0.00% 33 31 0.00% 34 27 0.00% 35 43 0.00% 36 62 0.00% 37 50 0.00% 38 46 0.00% 39 47 0.00% 40 88 0.00% 41 82 0.00% 42 92 0.00% 43 94 0.00% 44 113 0.00% 45 111 0.00% 46 114 0.00% 47 167 0.00% 48 179 0.00% 49 185 0.00% 50 219 0.00% 51 251 0.00% 52 260 0.00% 53 279 0.00% 54 349 0.00% 55 336 0.00% 56 377 0.00% 57 436 0.00% 58 470 0.00% 59 514 0.00% 60 578 0.00% 61 716 0.00% 62 772 0.00% 63 863 0.00% 64 1016 0.00% 65 1164 0.00% 66 1254 0.00% 67 1411 0.00% 68 1686 0.00% 69 2514 0.00% 70 2748 0.00% 71 2482 0.00% 72 2620 0.00% 73 3054 0.00% 74 3303 0.00% 75 3811 0.01% 76 4188 0.01% 77 4675 0.01% 78 5200 0.01% 79 6060 0.01% 80 6788 0.01% 81 7640 0.01% 82 8869 0.01% 83 10412 0.01% 84 15837 0.02% 85 17236 0.02% 86 18233 0.03% 87 19586 0.03% 88 21593 0.03% 89 22797 0.03% 90 24940 0.04% 91 27036 0.04% 92 29224 0.04% 93 31445 0.05% 94 34656 0.05% 95 36876 0.05% 96 40392 0.06% 97 43397 0.06% 98 45976 0.07% 99 49287 0.07% 100 52885 0.08% 101 55927 0.08% 102 60996 0.09% 103 64707 0.09% 104 68364 0.10% 105 73842 0.11% 106 79083 0.11% 107 82705 0.12% 108 86849 0.12% 109 91927 0.13% 110 95685 0.14% 111 101397 0.15% 112 106561 0.15% 113 111874 0.16% 114 117640 0.17% 115 124228 0.18% 116 128358 0.18% 117 136545 0.20% 118 141814 0.20% 119 145034 0.21% 120 151663 0.22% 121 157423 0.23% 122 162820 0.23% 123 170435 0.24% 124 176109 0.25% 125 183359 0.26% 126 191432 0.27% 127 199032 0.29% 128 205291 0.29% 129 214083 0.31% 130 222282 0.32% 131 229913 0.33% 132 239975 0.34% 133 250666 0.36% 134 260126 0.37% 135 273101 0.39% 136 286880 0.41% 137 302223 0.43% 138 320286 0.46% 139 337909 0.48% 140 359436 0.52% 141 385889 0.55% 142 420771 0.60% 143 463701 0.67% 144 530477 0.76% 145 630689 0.90% 146 797343 1.14% 147 1110134 1.59% 148 1992011 2.86% 149 12071421 17.31% 150 43927798 63.01% 69718738 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=32 prefix-density=0.18 prefix-fanout=2.7 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=261.16 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=28.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.3 sequence=TGCTTTATTTTCCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=238.45 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=26.4 sequence=GAAGAAGAAGAAA SRR4237619 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:08:23 Started mapping on | Feb 12 17:08:23 Finished on | Feb 12 17:14:41 Mapping speed, Million of reads per hour | 663.99 Number of input reads | 69718738 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 67392522 Uniquely mapped reads % | 96.66% Average mapped length | 292.59 Number of splices: Total | 62540609 Number of splices: Annotated (sjdb) | 61465887 Number of splices: GT/AG | 61612017 Number of splices: GC/AG | 724218 Number of splices: AT/AC | 56520 Number of splices: Non-canonical | 147854 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1238177 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 64847 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.45% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1161857 1161857 1161857 N_multimapping 1238177 1238177 1238177 N_noFeature 1884140 66580111 2353274 N_ambiguous 645504 4010 299110 UnstrandedReadsAssigned:64862878 PositiveStrandReadsAssigned:808401 NegativeStrandReadsAssigned:64740138 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237619 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237619-trimmed-pair1.fastq SRR4237619-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 69,718,738 reads, 64,347,396 reads pseudoaligned [quant] estimated average fragment length: 232.181 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR4237619.ke.tsv 34699 SRR4237619.se.tsv 87100 total ==> SRR4237619.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.82 1458 13.4927 Potri.005G024800.1.v4.1 1035 803.819 139 2.85941 Potri.004G059700.1.v4.1 961 729.841 9 0.203908 Potri.007G009000.2.v4.1 1416 1184.82 0 0 Potri.003G141000.2.v4.1 2943 2711.82 1081.24 6.59297 Potri.016G087400.1.v4.1 270 84.1806 9347 1836.04 Potri.015G069301.1.v4.1 564 337.341 0 0 Potri.010G195200.1.v4.1 1773 1541.82 192 2.05915 Potri.012G127500.1.v4.1 977 745.83 12801 283.808 ==> SRR4237619.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9121 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 825 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 44 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 135 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237619 completed mapping pipeline successfully