Starting /dee2/code/volunteer_pipeline.sh SRR4237620 current disk space = 3051735351296 free memory = 1581976172 SRR4237620 SRAfilesize 6bd9ab1d397fa8006df9b443ce58fed6 SRR4237620.sra SRR4237620.sra file validated SRR4237620 is paired end SRR4237620 is conventional basespace SRR4237620 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237620_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.42475 34.0 33.0 34.0 33.0 34.0 2 33.46175 34.0 33.0 34.0 33.0 34.0 3 33.506 34.0 34.0 34.0 33.0 34.0 4 33.5125 34.0 34.0 34.0 33.0 34.0 5 33.5005 34.0 34.0 34.0 33.0 34.0 6 36.8965 38.0 38.0 38.0 36.0 38.0 7 37.41175 38.0 38.0 38.0 37.0 38.0 8 37.55775 38.0 38.0 38.0 38.0 38.0 9 37.603 38.0 38.0 38.0 38.0 38.0 10-14 37.60435 38.0 38.0 38.0 38.0 38.0 15-19 37.58710000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.511700000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.52225 38.0 38.0 38.0 38.0 38.0 30-34 37.51649999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.47605 38.0 38.0 38.0 38.0 38.0 40-44 37.307 38.0 38.0 38.0 37.0 38.0 45-49 37.27315 38.0 38.0 38.0 37.0 38.0 50-54 37.25905 38.0 38.0 38.0 37.0 38.0 55-59 37.2446 38.0 38.0 38.0 36.8 38.0 60-64 37.204899999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.1371 38.0 38.0 38.0 36.4 38.0 70-74 37.0494 38.0 38.0 38.0 35.8 38.0 75-79 36.90745 38.0 38.0 38.0 35.6 38.0 80-84 36.99294999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.60845 38.0 37.8 38.0 34.2 38.0 90-94 36.463049999999996 38.0 37.8 38.0 33.8 38.0 95-99 36.86565 38.0 38.0 38.0 35.8 38.0 100-104 36.85385 38.0 38.0 38.0 36.0 38.0 105-109 36.66675 38.0 38.0 38.0 35.0 38.0 110-114 36.43945 38.0 38.0 38.0 34.2 38.0 115-119 36.615500000000004 38.0 38.0 38.0 35.0 38.0 120-124 36.42045 38.0 38.0 38.0 34.4 38.0 125-129 36.282 38.0 38.0 38.0 34.0 38.0 130-134 36.193900000000006 38.0 38.0 38.0 33.8 38.0 135-139 35.98094999999999 38.0 37.8 38.0 32.8 38.0 140-144 35.856849999999994 38.0 37.8 38.0 33.0 38.0 145-149 35.473349999999996 38.0 37.6 38.0 32.6 38.0 150 31.2505 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 1.0 16 1.0 17 2.0 18 3.0 19 4.0 20 2.0 21 2.0 22 4.0 23 5.0 24 14.0 25 12.0 26 12.0 27 15.0 28 17.0 29 25.0 30 33.0 31 44.0 32 47.0 33 72.0 34 113.0 35 158.0 36 380.0 37 3029.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.63690922730683 13.228307076769191 7.276819204801201 31.857964491122782 2 23.075000000000003 14.35 34.875 27.700000000000003 3 19.775000000000002 19.950000000000003 26.525 33.75 4 22.8 29.375 23.275000000000002 24.55 5 21.9 34.2 23.575 20.325 6 17.54209600402111 36.642372455390806 23.925609449610455 21.88992209097763 7 13.775 26.325 42.075 17.825 8 15.85 26.625 31.874999999999996 25.650000000000002 9 17.525 25.424999999999997 32.85 24.2 10-14 20.155 30.555 26.700000000000003 22.59 15-19 19.625 29.599999999999998 27.615000000000002 23.16 20-24 19.55 29.310000000000002 27.534999999999997 23.605 25-29 19.555 29.705 27.169999999999998 23.57 30-34 19.6 29.515 26.8 24.085 35-39 19.685 29.15 27.825 23.34 40-44 19.905 29.69 26.86 23.544999999999998 45-49 20.22 29.404999999999998 27.145000000000003 23.23 50-54 19.855 29.43 27.005000000000003 23.71 55-59 19.77 29.81 27.49 22.93 60-64 19.875 29.705 26.810000000000002 23.61 65-69 19.835 29.29 27.04 23.835 70-74 19.85 29.985 27.284999999999997 22.88 75-79 19.650000000000002 29.5 27.04 23.810000000000002 80-84 20.185 29.585 26.46 23.77 85-89 20.07 29.189999999999998 27.279999999999998 23.46 90-94 19.925 29.035 27.68 23.36 95-99 19.295 29.165000000000003 27.32 24.22 100-104 20.810000000000002 29.195 26.790000000000003 23.205000000000002 105-109 20.1 28.389999999999997 27.529999999999998 23.98 110-114 20.419999999999998 28.384999999999998 27.29 23.905 115-119 20.52 29.01 26.8 23.669999999999998 120-124 20.14 28.65 27.555000000000003 23.655 125-129 20.495 28.675 27.084999999999997 23.745 130-134 20.215 29.035 26.790000000000003 23.96 135-139 20.635 28.84 26.939999999999998 23.585 140-144 20.34 28.355000000000004 27.185 24.12 145-149 20.86 27.96 26.995 24.185000000000002 150 20.45 28.349999999999998 26.575 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 0.5 21 0.0 22 0.0 23 1.5 24 2.0 25 5.0 26 10.0 27 14.0 28 15.5 29 16.0 30 22.0 31 33.5 32 46.5 33 51.5 34 64.5 35 81.5 36 99.0 37 119.0 38 134.5 39 161.0 40 189.0 41 211.5 42 243.5 43 255.5 44 260.0 45 267.5 46 252.5 47 253.0 48 225.0 49 194.0 50 167.0 51 128.5 52 114.5 53 95.5 54 68.5 55 43.0 56 31.5 57 32.0 58 24.0 59 11.0 60 8.5 61 9.0 62 9.0 63 5.5 64 4.0 65 3.0 66 1.5 67 2.0 68 2.5 69 2.0 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.525 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.3624999999999998 0.0 0.0 0.0 0.0 116-117 1.575 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.0 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 3.0999999999999996 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.05 0.0 0.0 0.0 0.0 136-137 4.5 0.0 0.0 0.0 0.0 138 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACCTT 10 0.0067234724 145.74683 5 GGGAACA 10 0.0067234724 145.74683 1 TCAAGCA 10 0.0069845165 143.925 7 >>END_MODULE SRR4237620 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237620_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.989 33.0 33.0 34.0 32.0 34.0 2 32.9625 34.0 33.0 34.0 32.0 34.0 3 33.10875 34.0 33.0 34.0 32.0 34.0 4 33.03325 34.0 33.0 34.0 33.0 34.0 5 33.079 34.0 33.0 34.0 33.0 34.0 6 37.251 38.0 38.0 38.0 37.0 38.0 7 37.265 38.0 38.0 38.0 37.0 38.0 8 37.09075 38.0 38.0 38.0 37.0 38.0 9 37.18925 38.0 38.0 38.0 37.0 38.0 10-14 37.100100000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.1203 38.0 38.0 38.0 37.0 38.0 20-24 37.1306 38.0 38.0 38.0 37.0 38.0 25-29 36.5809 38.0 38.0 38.0 34.4 38.0 30-34 36.94835 38.0 38.0 38.0 36.6 38.0 35-39 36.7857 38.0 38.0 38.0 35.8 38.0 40-44 36.82015 38.0 38.0 38.0 35.8 38.0 45-49 36.58895 38.0 38.0 38.0 35.2 38.0 50-54 36.87689999999999 38.0 38.0 38.0 36.2 38.0 55-59 36.97795 38.0 38.0 38.0 36.8 38.0 60-64 36.9207 38.0 38.0 38.0 36.4 38.0 65-69 36.936150000000005 38.0 38.0 38.0 36.8 38.0 70-74 36.852999999999994 38.0 38.0 38.0 36.2 38.0 75-79 36.940999999999995 38.0 38.0 38.0 36.6 38.0 80-84 36.813700000000004 38.0 38.0 38.0 36.4 38.0 85-89 36.78825 38.0 38.0 38.0 36.0 38.0 90-94 36.7938 38.0 38.0 38.0 36.0 38.0 95-99 36.67705 38.0 38.0 38.0 36.0 38.0 100-104 36.6625 38.0 38.0 38.0 35.8 38.0 105-109 36.4571 38.0 38.0 38.0 35.0 38.0 110-114 36.483599999999996 38.0 38.0 38.0 34.8 38.0 115-119 36.3657 38.0 38.0 38.0 34.8 38.0 120-124 36.273450000000004 38.0 38.0 38.0 34.6 38.0 125-129 36.228500000000004 38.0 38.0 38.0 34.6 38.0 130-134 36.11455 38.0 38.0 38.0 34.4 38.0 135-139 35.95694999999999 38.0 38.0 38.0 34.0 38.0 140-144 35.61695 38.0 38.0 38.0 33.0 38.0 145-149 35.46155 38.0 38.0 38.0 33.2 38.0 150 30.85 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 5.0 4 1.0 5 2.0 6 1.0 7 2.0 8 0.0 9 0.0 10 0.0 11 1.0 12 5.0 13 5.0 14 4.0 15 3.0 16 3.0 17 3.0 18 7.0 19 10.0 20 11.0 21 6.0 22 7.0 23 12.0 24 13.0 25 13.0 26 6.0 27 18.0 28 16.0 29 24.0 30 35.0 31 40.0 32 51.0 33 61.0 34 78.0 35 145.0 36 308.0 37 3099.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.225 23.474999999999998 11.35 21.95 2 28.1 25.624999999999996 30.95 15.325 3 21.349999999999998 27.925 32.800000000000004 17.925 4 24.9 34.4 22.900000000000002 17.8 5 24.7 38.1 21.975 15.225 6 20.65 38.574999999999996 23.05 17.724999999999998 7 21.025 20.5 39.675 18.8 8 21.65 25.45 28.999999999999996 23.9 9 22.15 25.85 29.15 22.85 10-14 23.395 29.755 26.400000000000002 20.45 15-19 23.87 27.67 28.015 20.445 20-24 23.580000000000002 28.32 27.83 20.27 25-29 23.125 27.845 28.71 20.32 30-34 24.015 28.175 27.43 20.380000000000003 35-39 22.89 28.38 27.87 20.86 40-44 22.759999999999998 28.78 27.905 20.555 45-49 23.419999999999998 27.775 28.52 20.285 50-54 23.39 27.305 28.634999999999998 20.669999999999998 55-59 23.74 27.900000000000002 28.444999999999997 19.915 60-64 23.235 27.92 28.335 20.51 65-69 23.845 28.01 27.900000000000002 20.244999999999997 70-74 23.335 27.825 28.54 20.3 75-79 23.345 27.529999999999998 28.43 20.695 80-84 23.380000000000003 27.87 28.785 19.965 85-89 23.990000000000002 27.105 28.04 20.865000000000002 90-94 23.35 28.105000000000004 28.07 20.474999999999998 95-99 23.810000000000002 27.47 28.74 19.98 100-104 23.805 27.584999999999997 28.17 20.44 105-109 24.23 27.0 28.444999999999997 20.325 110-114 23.89 27.384999999999998 28.425 20.3 115-119 24.42 28.244999999999997 27.560000000000002 19.775000000000002 120-124 24.585 27.0 28.835 19.580000000000002 125-129 24.125 28.15 27.525 20.200000000000003 130-134 24.135 28.365000000000002 27.894999999999996 19.605 135-139 24.58 27.68 28.105000000000004 19.634999999999998 140-144 24.66 27.63 27.950000000000003 19.759999999999998 145-149 24.635 27.815 27.744999999999997 19.805 150 23.95 27.575 29.15 19.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.5 23 3.0 24 3.0 25 1.5 26 1.5 27 5.0 28 6.0 29 7.5 30 11.0 31 15.0 32 24.0 33 41.0 34 60.5 35 71.0 36 91.0 37 111.5 38 128.5 39 158.5 40 195.5 41 239.5 42 266.0 43 283.0 44 294.0 45 286.5 46 278.0 47 263.0 48 227.0 49 195.5 50 166.0 51 131.0 52 99.5 53 78.0 54 63.0 55 43.5 56 34.5 57 29.5 58 22.0 59 16.0 60 12.0 61 9.0 62 5.0 63 1.0 64 3.0 65 5.0 66 2.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.6125 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.8125 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.525 0.0 0.0 0.0 0.0 138 4.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102087 spots for SRR4237620.sra Written 2102087 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra Read 2102079 spots for SRR4237620.sra Written 2102079 spots for SRR4237620.sra SRR ids: ['SRR4237620.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_df2rvjqn SRR4237620.sra spots: 42041588 blocks: [[1, 2102079], [2102080, 4204158], [4204159, 6306237], [6306238, 8408316], [8408317, 10510395], [10510396, 12612474], [12612475, 14714553], [14714554, 16816632], [16816633, 18918711], [18918712, 21020790], [21020791, 23122869], [23122870, 25224948], [25224949, 27327027], [27327028, 29429106], [29429107, 31531185], [31531186, 33633264], [33633265, 35735343], [35735344, 37837422], [37837423, 39939501], [39939502, 42041588]] SRR4237620 file size 14142701 SRR4237620 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237620 SRR4237620_1.fastq SRR4237620_2.fastq Input file: SRR4237620_1.fastq Paired file: SRR4237620_2.fastq trimmed: SRR4237620-trimmed-pair1.fastq, SRR4237620-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:39:40 2025 >> started Wed Feb 12 17:40:25 2025 >> done (45.408s) 42041588 read pairs processed; of these: 92589 ( 0.22%) short read pairs filtered out after trimming by size control 29205 ( 0.07%) empty read pairs filtered out after trimming by size control 41919794 (99.71%) read pairs available; of these: 11243129 (26.82%) trimmed read pairs available after processing 30676665 (73.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 6 0.00% 21 9 0.00% 22 9 0.00% 23 8 0.00% 24 11 0.00% 25 10 0.00% 26 13 0.00% 27 20 0.00% 28 18 0.00% 29 20 0.00% 30 28 0.00% 31 14 0.00% 32 22 0.00% 33 14 0.00% 34 25 0.00% 35 21 0.00% 36 20 0.00% 37 28 0.00% 38 24 0.00% 39 29 0.00% 40 38 0.00% 41 38 0.00% 42 29 0.00% 43 41 0.00% 44 49 0.00% 45 51 0.00% 46 85 0.00% 47 66 0.00% 48 73 0.00% 49 85 0.00% 50 90 0.00% 51 108 0.00% 52 111 0.00% 53 123 0.00% 54 130 0.00% 55 176 0.00% 56 181 0.00% 57 210 0.00% 58 246 0.00% 59 236 0.00% 60 326 0.00% 61 347 0.00% 62 355 0.00% 63 395 0.00% 64 486 0.00% 65 580 0.00% 66 572 0.00% 67 716 0.00% 68 905 0.00% 69 2537 0.01% 70 2099 0.01% 71 1176 0.00% 72 1297 0.00% 73 1361 0.00% 74 1591 0.00% 75 1790 0.00% 76 1813 0.00% 77 2127 0.01% 78 2369 0.01% 79 2621 0.01% 80 3020 0.01% 81 3496 0.01% 82 4001 0.01% 83 5140 0.01% 84 14431 0.03% 85 11050 0.03% 86 10764 0.03% 87 12836 0.03% 88 13792 0.03% 89 10838 0.03% 90 11888 0.03% 91 12764 0.03% 92 16417 0.04% 93 15705 0.04% 94 18634 0.04% 95 17926 0.04% 96 18526 0.04% 97 19592 0.05% 98 20511 0.05% 99 21801 0.05% 100 23458 0.06% 101 24747 0.06% 102 26632 0.06% 103 28491 0.07% 104 30444 0.07% 105 32296 0.08% 106 34836 0.08% 107 38581 0.09% 108 39453 0.09% 109 40249 0.10% 110 41980 0.10% 111 44716 0.11% 112 47335 0.11% 113 49335 0.12% 114 52483 0.13% 115 55801 0.13% 116 58284 0.14% 117 61359 0.15% 118 63983 0.15% 119 65949 0.16% 120 70469 0.17% 121 72115 0.17% 122 77849 0.19% 123 77344 0.18% 124 81375 0.19% 125 83702 0.20% 126 87297 0.21% 127 90703 0.22% 128 94085 0.22% 129 97421 0.23% 130 101298 0.24% 131 103922 0.25% 132 109605 0.26% 133 113258 0.27% 134 118216 0.28% 135 124363 0.30% 136 134700 0.32% 137 136309 0.33% 138 143345 0.34% 139 149684 0.36% 140 159676 0.38% 141 171758 0.41% 142 185492 0.44% 143 200161 0.48% 144 226368 0.54% 145 264298 0.63% 146 322271 0.77% 147 472019 1.13% 148 762010 1.82% 149 5260478 12.55% 150 30676665 73.18% 41919794 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=39 prefix-density=0.26 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=232.21 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=13.8 sequence=AAAAAAAGAGGGATCTAGCAGAGCACTGCCTCTATCCTGGCAATTCATGAGAAAACCATCACAAAAACGGCGACACAAGTACCGGCTAAAGCCACAAATGGGGAAATATTGATCCCTAAGGATGAATCGGGTACGTTGTTGGATGAAGGCTTGTAATTGGTGACGTTACTACCGGCCGGAGAAGTGGTAGTGCCATCAGAAGATGGAGTTCC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=41 prefix-density=0.19 prefix-fanout=2.1 sequence=AGTTCCAATGGCCACTGTTGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=266.31 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=29.1 sequence=AAGAAGAAGAAA SRR4237620 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:41:08 Started mapping on | Feb 12 17:41:08 Finished on | Feb 12 17:44:16 Mapping speed, Million of reads per hour | 802.72 Number of input reads | 41919794 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 40322329 Uniquely mapped reads % | 96.19% Average mapped length | 294.11 Number of splices: Total | 36086386 Number of splices: Annotated (sjdb) | 35435958 Number of splices: GT/AG | 35529405 Number of splices: GC/AG | 428710 Number of splices: AT/AC | 33570 Number of splices: Non-canonical | 94701 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 801390 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 48472 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.76% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 842431 842431 842431 N_multimapping 801390 801390 801390 N_noFeature 1104375 39831398 1338785 N_ambiguous 428062 2137 170089 UnstrandedReadsAssigned:38789892 PositiveStrandReadsAssigned:488794 NegativeStrandReadsAssigned:38813455 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237620 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237620-trimmed-pair1.fastq SRR4237620-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,919,794 reads, 38,591,580 reads pseudoaligned [quant] estimated average fragment length: 240.741 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR4237620.ke.tsv 34699 SRR4237620.se.tsv 87100 total ==> SRR4237620.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.26 875 12.2994 Potri.005G024800.1.v4.1 1035 795.259 85 2.67166 Potri.004G059700.1.v4.1 961 721.292 22 0.762397 Potri.007G009000.2.v4.1 1416 1176.26 0 0 Potri.003G141000.2.v4.1 2943 2703.26 597.108 5.52122 Potri.016G087400.1.v4.1 270 78.6506 6879 2186.22 Potri.015G069301.1.v4.1 564 329.095 0 0 Potri.010G195200.1.v4.1 1773 1533.26 160 2.6084 Potri.012G127500.1.v4.1 977 737.27 7746 262.616 ==> SRR4237620.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5630 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 607 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR4237620 completed mapping pipeline successfully