Starting /dee2/code/volunteer_pipeline.sh SRR4237621 current disk space = 2796418781184 free memory = 1575039976 SRR4237621_1.fastq is conventional basespace SRR4237621_1.fastq read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237621_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 54998219 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 5.4998219E7 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.515324089089965 11.798158088708092 9.399321646393636 37.287196175808305 2 23.317765980749304 14.664085758849755 35.21337118207409 26.804777078326847 3 20.232682443771495 20.264450745214134 25.957211450792617 33.54565536022175 4 23.639545491464006 28.317356967504708 22.740249097884423 25.302848443146857 5 22.981598731406194 33.45910164836429 23.665757249339293 19.893542370890227 6 18.101494812287655 35.78433481706097 24.37722701447552 21.73694335617585 7 13.916623372840492 27.234594632964388 41.36128844463127 17.48749354956385 8 17.0821513329368 25.359550279255405 32.04946327443803 25.50883511336976 9 17.094789924015537 24.201818244332603 34.08223819029486 24.621153641357004 10-14 19.678689231736758 30.334098273254995 27.002512935918887 22.984699559089357 15-19 19.650460681281334 29.00849134769255 27.6994998692594 23.641548101766713 20-24 19.74995808500635 29.073192715567753 27.56456277247814 23.612286426947755 25-29 19.656320143748655 29.304752577533467 27.490880750156656 23.548046528561226 30-34 19.68339011123251 29.137806080593265 27.515537548588618 23.663266259585605 35-39 19.779927886596653 29.072034902605903 27.412875407727373 23.735161803070074 40-44 19.87200694996472 29.166472646333336 27.43411545893646 23.527404944765486 45-49 19.89578722350074 28.96590890585567 27.406370951770803 23.731932918872783 50-54 19.870639447433742 28.988876167062795 27.4652450109339 23.675239374569564 55-59 19.919870859818207 29.081290432332 27.32944679535895 23.669391912490838 60-64 19.87829533170883 28.97969877897319 27.371165964483325 23.770839924834657 65-69 19.911348765675484 28.912714064431793 27.451254376073525 23.724682793819195 70-74 19.98599772839917 28.93057864291933 27.427293600180036 23.65613002850147 75-79 19.963571911301344 28.79600592157357 27.452149314144155 23.78827285298093 80-84 20.00480561015985 28.762408106342498 27.42983440972879 23.80295187376886 85-89 20.05766113989982 28.79765688412565 27.47210777861734 23.67257419735719 90-94 20.089658539670165 28.777203494534977 27.346481892440917 23.78665607335394 95-99 20.04281956839366 28.63758879173887 27.543405360089935 23.776186279777534 100-104 20.227147719092503 28.73245550005901 27.389574196938995 23.650822583909488 105-109 20.187529345268434 28.56717778442971 27.471932863862374 23.773360006439482 110-114 20.20396805940207 28.60265602418871 27.417490373642828 23.775885542766396 115-119 20.30981653532349 28.72283768319385 27.284158696066967 23.683187085415693 120-124 20.359834134853898 28.617750265995202 27.201798503379376 23.820617095771528 125-129 20.42119727549723 28.448676856245108 27.26023509961295 23.86989076864471 130-134 20.523106030033446 28.52506660261126 27.172867179571757 23.778960187783536 135-139 20.496108064881156 28.50471030707376 27.029896731746895 23.969284896298188 140-144 20.57192686085433 28.405890313434938 26.963247108485206 24.058935717225523 145-149 20.610525951758547 28.55034887584269 26.78640230149998 24.052722870898783 150 20.346228958866412 28.23167963007855 26.765812565945318 24.656278845109718 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 719.0 1 682.5 2 568.0 3 490.5 4 583.0 5 736.0 6 846.5 7 906.0 8 952.0 9 1006.0 10 1048.5 11 1147.0 12 1353.0 13 1631.0 14 2011.0 15 2600.0 16 3268.5 17 4125.0 18 5544.0 19 7383.0 20 9490.5 21 12328.0 22 16696.0 23 23464.0 24 34296.5 25 49356.5 26 72486.0 27 107665.5 28 147886.5 29 201789.5 30 277613.5 31 376418.0 32 497922.5 33 641722.5 34 810284.5 35 1020575.0 36 1270801.0 37 1543016.5 38 1856007.0 39 2213004.0 40 2589590.5 41 2956766.5 42 3301168.0 43 3568047.0 44 3704538.5 45 3708860.5 46 3638935.5 47 3485466.5 48 3177486.5 49 2778823.5 50 2345177.5 51 1936507.5 52 1604783.0 53 1302309.5 54 1004993.0 55 731811.0 56 521637.5 57 390173.0 58 288367.0 59 204794.0 60 144204.0 61 98048.0 62 70520.0 63 54264.0 64 43018.5 65 34674.0 66 25920.0 67 18799.0 68 16198.5 69 13192.0 70 9226.0 71 4969.5 72 2727.0 73 1339.0 74 469.5 75 136.5 76 74.5 77 36.0 78 21.5 79 18.0 80 12.5 81 8.0 82 4.0 83 4.5 84 4.0 85 4.0 86 4.0 87 4.0 88 4.0 89 1.0 90 1.0 91 2.0 92 1.5 93 0.5 94 0.5 95 1.5 96 1.0 97 0.0 98 1.0 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.12501313906183037 2 0.0 3 0.0 4 0.0 5 0.0 6 0.016802362272858327 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 1.8909703239663088E-5 40-44 0.007242052692651738 45-49 0.003299379567181985 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 1.0363971967892269E-4 120-124 8.363907202158674E-5 125-129 0.0 130-134 0.0 135-139 0.0 140-144 8.727555341382963E-6 145-149 0.0 150 0.0034455661191501495 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 5.4998219E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 28.698319474818817 #Duplication Level Percentage of deduplicated Percentage of total 1 61.9932631023538 17.791024697978468 2 15.119058247817554 8.677831275085252 3 6.7239084637739515 5.788946196384693 4 3.7435665495238903 4.297362752539271 5 2.3999140513606 3.443675007902662 6 1.6902569962874785 2.910452116440342 7 1.2247342838507633 2.460347102479885 8 0.9638453029312202 2.212859234225894 9 0.7501077881939088 1.9374149651524668 >10 4.738043876424701 25.816537846708222 >50 0.41158714748459424 8.142504136365543 >100 0.22430110299384096 11.942745387592309 >500 0.012951666381044752 2.4937211564108255 >1k 0.0044360279340576 2.0373075727862155 >5k 2.5392688583979258E-5 0.04727055194818807 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 2.0182471726948103E-4 6.0001942972007875E-5 0.0 1.2727684872850155E-5 0.0 2 2.0546119866172394E-4 9.273027550219399E-5 0.0 1.6364166265093057E-5 0.0 3 2.327348091035457E-4 9.818499759055834E-5 0.0 1.6364166265093057E-5 0.0 4 2.9819147416391793E-4 1.0182147898280124E-4 0.0 2.545536974570031E-5 0.0 5 3.14555640429011E-4 1.0182147898280124E-4 0.0 3.4546573226307564E-5 0.0 6 3.3819276947858986E-4 1.036397196789227E-4 0.0 5.091073949140062E-5 0.0 7 3.5092045435144E-4 1.254586080323801E-4 0.0 7.272962784485803E-5 0.0 8 3.600116578320473E-4 1.254586080323801E-4 0.0 1.145491638556514E-4 0.0 9 3.781940647932618E-4 1.29095089424623E-4 0.0 1.400045336013517E-4 0.0 10-11 4.181953601079337E-4 1.3000420977268373E-4 0.0 1.7364198647959854E-4 0.0 12-13 4.500145722900591E-4 1.3454981151298734E-4 0.0 2.145524021423312E-4 0.0 14-15 4.8092466412412373E-4 1.3909541325329098E-4 0.0 2.254618463190599E-4 0.0 16-17 5.036526728256418E-4 1.572778202145055E-4 0.0 2.336439294516064E-4 0.0 18-19 5.227442001349171E-4 1.8182406961214507E-4 0.0 2.4091689223609223E-4 0.0 20-21 5.845643838030465E-4 1.890970323966309E-4 0.0 2.4546249397639587E-4 0.0 22-23 6.327477622502649E-4 1.9818823587723812E-4 0.0 2.5000809571669945E-4 0.0 24-25 6.709308168688153E-4 2.036429579656025E-4 0.0 2.545536974570031E-4 0.0 26-27 7.136594732276695E-4 2.0637031900978467E-4 0.0 2.6909962302597474E-4 0.0 28-29 7.609337313268271E-4 2.0909768005396683E-4 0.0 2.8091818755076415E-4 0.0 30-31 8.227539149949564E-4 2.0909768005396683E-4 0.0 2.972823538158572E-4 0.0 32-33 8.854832190111465E-4 2.0909768005396683E-4 0.0 3.3455628808634695E-4 0.0 34-35 9.391213195467294E-4 2.154615224903919E-4 0.0 3.572842967878651E-4 0.0 36-37 0.001035488076441166 2.2364360562293845E-4 0.0 3.663755002684723E-4 0.0 38-39 0.0011127633060263279 2.290983277113028E-4 0.0 3.727393427048974E-4 0.0 40-41 0.0012427675157990117 2.4364425328027439E-4 0.0 3.7728494444520106E-4 0.0 42-43 0.001380044688356181 2.7455434511433906E-4 0.0 3.909217496661119E-4 0.0 44-45 0.001569141720752812 3.0546443694840376E-4 0.0 3.9455823105835483E-4 0.0 46-47 0.0017718755583703539 3.14555640429011E-4 0.0 4.191044804559944E-4 0.0 48-49 0.0020373387000040856 3.20919482865436E-4 0.0 4.254683228924195E-4 0.0 50-51 0.0023973503578361326 3.327380473902255E-4 0.0 4.400142484613911E-4 0.0 52-53 0.0028373646062975237 3.5273869504756145E-4 0.0 4.545601740303627E-4 0.0 54-55 0.003347381121559591 3.8183054618550464E-4 1.8182406961214508E-6 4.709243402954558E-4 0.0 56-57 0.0039610373565005805 3.900126293180512E-4 1.8182406961214508E-6 4.909249879527916E-4 0.0 58-59 0.004726516689567711 4.018311938428406E-4 3.6364813922429016E-6 5.072891542178847E-4 0.0 60-61 0.0057356402759151165 4.53651053682302E-4 3.6364813922429016E-6 5.145621170023706E-4 0.0 62-63 0.0071493224171495446 4.763790623838201E-4 3.6364813922429016E-6 5.472904495325567E-4 0.0 64-65 0.008881196680205226 4.909249879527917E-4 3.6364813922429016E-6 5.972920686758966E-4 0.0 66-67 0.010983992045269684 5.036526728256418E-4 3.6364813922429016E-6 6.65476094780451E-4 0.0 68-69 0.013657714988916277 5.109256356101276E-4 3.6364813922429016E-6 6.809311406974832E-4 0.0 70-71 0.01711600879293928 5.2638068152716E-4 3.6364813922429016E-6 6.872949831339083E-4 0.0 72-73 0.021769795854662127 5.500178105767388E-4 3.6364813922429016E-6 7.036591493990015E-4 0.0 74-75 0.027789990799520253 5.700184582340749E-4 3.6364813922429016E-6 7.236597970563374E-4 0.0 76-77 0.03560569843179831 5.782005413666213E-4 3.6364813922429016E-6 7.427513243656126E-4 0.0 78-79 0.0451450982439995 5.8910998554335E-4 3.6364813922429016E-6 7.727522958516166E-4 0.0 80-81 0.057357311879499225 6.19110957029354E-4 3.6364813922429016E-6 7.972985452492561E-4 0.0 82-83 0.07290417895168569 6.41838965730872E-4 3.6364813922429016E-6 8.191174336027136E-4 0.0 84-85 0.09322029136979872 6.672943354765724E-4 3.6364813922429016E-6 8.382089609119888E-4 0.0 86-87 0.11848383672205823 6.963861866145156E-4 3.6364813922429016E-6 8.50936645784839E-4 0.0 88-89 0.14876299903456874 7.100229918354265E-4 3.6364813922429016E-6 8.682099323979928E-4 0.0 90-91 0.18506326541228543 7.254780377524588E-4 3.6364813922429016E-6 9.154841904971504E-4 0.0 92-93 0.22973562107529336 7.363874819291876E-4 3.6364813922429016E-6 9.454851619831544E-4 0.0 94-95 0.2848801340276128 7.545698888904021E-4 3.6364813922429016E-6 9.473034026792758E-4 0.0 96-97 0.34987314771047406 7.663884534151915E-4 3.6364813922429016E-6 9.482125230273365E-4 0.0 98-99 0.42523649720366397 7.800252586361024E-4 3.6364813922429016E-6 9.60031087552126E-4 0.0 100-101 0.5119893064173587 8.04571508033742E-4 3.6364813922429016E-6 9.709405317288547E-4 0.0 102-103 0.6095242829590537 8.40936321956171E-4 3.6364813922429016E-6 9.882138183420087E-4 0.0 104-105 0.7217151886318356 8.927561817956323E-4 3.6364813922429016E-6 9.963959014745551E-4 0.0 106-107 0.8498275189602049 9.245753939777577E-4 3.6364813922429016E-6 0.0010073053456512836 0.0 108-109 0.9933294385405462 9.518490044195794E-4 3.6364813922429016E-6 0.0010100327066954657 0.0 110-111 1.1495535882716492 9.60031087552126E-4 3.6364813922429016E-6 0.001012760067739648 0.0 112-113 1.3191045331849747 9.654858096404904E-4 3.6364813922429016E-6 0.0010182147898280124 0.0 114-115 1.5054114752334071 9.718496520769155E-4 3.6364813922429016E-6 0.0010236695119163767 0.0 116-117 1.7126609136197666 9.86395577645887E-4 3.6364813922429016E-6 0.0010454884002698342 0.0 118-119 1.9377182013839394 0.001042761039225652 3.6364813922429016E-6 0.0010545796037504415 0.0 120-121 2.1788023717640748 0.0010636708072310488 4.545601740303627E-6 0.0010618525665349273 0.0 122-123 2.4357616016620467 0.0010736711310597167 5.454722088364352E-6 0.0010709437700155344 0.0 124-125 2.7109623313438567 0.0010927626583689919 5.454722088364352E-6 0.0011109450653302064 0.0 126-127 3.008905615652754 0.0011200362688108137 5.454722088364352E-6 0.0011645831658657893 1.8182406961214508E-6 128-129 3.329353265057547 0.0011345821943797854 5.454722088364352E-6 0.001181856452478943 1.8182406961214508E-6 130-131 3.667428758011237 0.0011436733978603926 5.454722088364352E-6 0.0011954932576998538 1.8182406961214508E-6 132-133 4.022317522681962 0.001145491638556514 5.454722088364352E-6 0.001201857100136279 1.8182406961214508E-6 134-135 4.396021442076151 0.001148218999600696 5.454722088364352E-6 0.0012673137651966512 1.8182406961214508E-6 136-137 4.7924460972090746 0.0011600375641254855 5.454722088364352E-6 0.0012800414500695014 1.8182406961214508E-6 138 5.103963457434867 0.0011654922862138499 5.454722088364352E-6 0.0012800414500695014 1.8182406961214508E-6 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCGTT 8545 0.0 12.993148 1 GTCGGCT 10140 0.0 12.726847 1 GTCCGCT 12275 0.0 12.686388 1 GTCGGTT 12460 0.0 12.671611 1 GTCCGAT 11550 0.0 12.234319 1 GTCCCGT 8140 0.0 12.133942 1 GTCCGGA 8290 0.0 11.740457 1 GTCCGCC 4920 0.0 11.576245 1 GGGGGAT 20215 0.0 11.519525 1 GTCCGGG 5920 0.0 11.203967 1 GTCGGAT 15345 0.0 10.900009 1 GTCGGTA 9130 0.0 10.897179 1 CCCGTAT 10920 0.0 10.89349 1 GTCCGCA 13945 0.0 10.650119 1 CCCGTCT 12010 0.0 10.505115 1 GTGCGCT 9765 0.0 10.483875 1 GGGGGCT 24650 0.0 10.382864 1 GTCCGAC 6115 0.0 10.375092 1 GGGGTAT 23735 0.0 10.35788 1 GGGGAAT 28515 0.0 10.340837 1 >>END_MODULE SRR4237621 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237621_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 54998219 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 5.4998219E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.70914369063478 20.251466688403127 13.334229968428616 25.705159652533478 2 28.896661180973876 24.36385258220816 31.421404754943065 15.318081481874895 3 21.31999219829282 28.004725025732196 31.5178660603537 19.15741671562128 4 24.961606484020873 34.045455181012315 23.16359553388447 17.82934280108234 5 25.66592383655187 36.71567619307818 21.95868197113801 15.65971799923194 6 20.132888303164872 38.89079753655296 23.638145446127993 17.338168714154182 7 20.346422490517373 20.62024226639048 40.26132918958703 18.772006053505113 8 21.66870894492056 24.83968253590175 29.130886947448243 24.360721571729442 9 22.39858894339833 24.819096414740265 29.955037271297826 22.827277370563582 10-14 23.750579178416686 28.850344711959906 26.585136198874785 20.81393991074862 15-19 23.514870784996972 27.87482351034143 27.987667759529604 20.62263794513199 20-24 23.39206459590628 28.163799037588404 27.801423043085737 20.642713323419574 25-29 23.46148926812289 28.10746577407831 27.878832141701615 20.552212816097185 30-34 23.282302598082357 28.000422691794448 28.105240357370736 20.612034352752463 35-39 23.305099954479775 27.985081488952616 28.05939549453135 20.650423062036253 40-44 23.443223308538975 27.884224092396458 28.1138226875173 20.558729911547267 45-49 23.371310530556134 27.829545709232516 28.258634928873022 20.540508831338325 50-54 23.36780258939548 27.944111519172182 28.152013994997205 20.536071896435132 55-59 23.566875713237607 27.839032754356246 28.21135579240126 20.382735740004886 60-64 23.400082855449718 27.813828850523898 28.391327475879972 20.394760818146416 65-69 23.488504917420073 27.828262603435306 28.305682211601628 20.377550267542997 70-74 23.6187900564469 27.718113474311984 28.194569206285596 20.468527262955526 75-79 23.462461044425105 27.70829143644274 28.443667541253166 20.385579977878987 80-84 23.570276796933438 27.75943957999949 28.2712539702137 20.39902965285337 85-89 23.68124354255971 27.75387273460478 28.26272895181691 20.3021547710186 90-94 23.601611609845865 27.7023916743942 28.359159577151726 20.336837138608214 95-99 23.647367459360584 27.773909270020823 28.261395870478317 20.31732740014028 100-104 23.898562742747195 27.754070074429904 28.12779556988009 20.21957161294281 105-109 23.798420455888635 27.72190719121494 28.18002298879051 20.299649364105914 110-114 23.8488736501601 27.77816930709205 28.120167775733336 20.252789267014514 115-119 24.05433901781683 27.79824578472735 28.01821643228627 20.12919876516955 120-124 23.994192145610842 27.8119484056673 28.047216770807825 20.146642677914027 125-129 24.18391018874579 27.904357128226486 27.81887270885112 20.092859974176598 130-134 24.47218488208878 27.812917687129968 27.77746469681644 19.937432733964812 135-139 24.379959334953497 27.79470827753296 27.80782626937653 20.017506118137018 140-144 24.601885935014604 27.885444859975138 27.63909106332824 19.873578141682017 145-149 24.87960850918868 27.844360461555574 27.523483775878766 19.752547253376974 150 24.65630073689163 27.836414558646705 27.777367984960854 19.729916719500814 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 134.0 1 158.5 2 283.0 3 689.5 4 1671.0 5 3356.0 6 5384.0 7 6928.5 8 7423.5 9 7018.5 10 6010.5 11 4951.5 12 4300.0 13 3989.5 14 3920.5 15 4164.5 16 4539.5 17 5053.0 18 6328.0 19 7566.5 20 8724.0 21 11135.5 22 14820.5 23 19844.5 24 26911.0 25 36313.5 26 50619.0 27 71790.5 28 99606.0 29 137135.0 30 190683.5 31 261223.5 32 354234.0 33 486482.5 34 649874.0 35 861083.5 36 1137349.0 37 1468572.5 38 1843947.5 39 2284669.0 40 2763979.0 41 3179158.5 42 3533616.5 43 3803272.5 44 3917108.0 45 3908893.0 46 3807163.5 47 3587308.5 48 3225908.0 49 2767176.0 50 2300334.5 51 1893860.0 52 1553039.5 53 1235700.5 54 937775.5 55 681279.0 56 496593.5 57 373811.5 58 272528.5 59 188775.0 60 127566.5 61 86498.5 62 63130.0 63 50308.0 64 40040.0 65 29657.0 66 20700.0 67 15169.5 68 11916.5 69 8969.0 70 6412.5 71 4207.0 72 2559.5 73 1544.0 74 1062.0 75 690.5 76 458.5 77 319.0 78 230.5 79 168.5 80 123.0 81 75.0 82 47.5 83 34.5 84 26.0 85 24.5 86 17.0 87 15.0 88 15.5 89 11.5 90 9.5 91 9.5 92 12.0 93 10.5 94 8.5 95 8.5 96 6.0 97 7.0 98 10.5 99 9.5 100 16.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0032379230316530797 15-19 0.03468657775990892 20-24 0.08396526440247092 25-29 0.08288704766967091 30-34 0.08300268777794423 35-39 0.10271132597948308 40-44 0.10986973960011323 45-49 0.13349159542784467 50-54 0.12668846603923664 55-59 0.12503713983901915 60-64 0.11635467686690001 65-69 0.10872497525783516 70-74 0.13660660538843994 75-79 0.12134211109636114 80-84 0.11858347631220569 85-89 0.12958419617187966 90-94 0.13384142493777845 95-99 0.13887940625859177 100-104 0.14438212990133373 105-109 0.1289630851500846 110-114 0.14485741801929986 115-119 0.16873746402588055 120-124 0.1570487218867942 125-129 0.14061109869757782 130-134 0.12264142589780953 135-139 0.1256037036399306 140-144 0.14849826318921344 145-149 0.1518969186984037 150 0.11875111810438807 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 5.4998219E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 30.44238113693478 #Duplication Level Percentage of deduplicated Percentage of total 1 65.18825427402996 19.844856822614375 2 13.533993556413323 8.240139802983077 3 6.0326250070459455 5.509424091620896 4 3.5700060154733047 4.3471793513675285 5 2.3232856961577486 3.5363174326211513 6 1.56434105887148 2.8573360045393033 7 1.158104356215022 2.467881794576953 8 0.9060719690026846 2.2066390574298147 9 0.6939255759971681 1.9012272178655514 >10 4.43498703740838 25.310021104481716 >50 0.3711443506161775 7.793551040860184 >100 0.20823635965718507 11.62034385831022 >500 0.0113351524377298 2.320765141947105 >1k 0.003570214355448542 1.78309692978962 >5k 1.0743880154618069E-4 0.21478245763382497 >10k+ 1.1937516775588365E-5 0.04643789135869105 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 2.0182471726948103E-4 3.6364813922429016E-6 0.0 1.8182406961214508E-6 0.0 2 2.0546119866172394E-4 2.181888835345741E-5 1.8182406961214508E-6 2.727361044182176E-5 0.0 3 2.145524021423312E-4 2.181888835345741E-5 1.8182406961214508E-6 3.6364813922429014E-5 0.0 4 2.3818953119191004E-4 2.181888835345741E-5 1.8182406961214508E-6 3.818305461855046E-5 0.0 5 2.472807346725173E-4 2.181888835345741E-5 5.454722088364352E-6 4.727425809915772E-5 0.0 6 2.58190178849246E-4 2.363712904957886E-5 5.454722088364352E-6 5.272898018752207E-5 0.0 7 2.636449009376104E-4 2.545536974570031E-5 5.454722088364352E-6 5.8183702275886426E-5 0.0 8 2.672813823298533E-4 2.9091851137943213E-5 5.454722088364352E-6 6.182018366812933E-5 0.0 9 2.818273078988249E-4 3.2728332530186115E-5 5.454722088364352E-6 6.363842436425077E-5 0.0 10-11 2.9546411311973575E-4 3.5455693574368286E-5 5.454722088364352E-6 7.272962784485803E-5 1.8182406961214508E-6 12-13 3.1001003868870734E-4 3.818305461855047E-5 5.454722088364352E-6 8.636643306576892E-5 1.8182406961214508E-6 14-15 3.227377235615575E-4 4.363777670691482E-5 5.454722088364352E-6 9.818499759055833E-5 1.8182406961214508E-6 16-17 3.4182925087083277E-4 4.818337844721845E-5 5.454722088364352E-6 1.1273092315952995E-4 1.8182406961214508E-6 18-19 3.600116578320472E-4 5.363810053558279E-5 5.454722088364352E-6 1.145491638556514E-4 1.8182406961214508E-6 20-21 3.9728559210253696E-4 5.6365461579764976E-5 5.454722088364352E-6 1.1636740455177284E-4 1.8182406961214508E-6 22-23 4.2001360080405517E-4 6.0001942972007875E-5 5.454722088364352E-6 1.3454981151298737E-4 1.8182406961214508E-6 24-25 4.500145722900591E-4 6.545666506037223E-5 5.454722088364352E-6 1.545504591703233E-4 1.8182406961214508E-6 26-27 4.836520251683059E-4 6.636578540843296E-5 5.454722088364352E-6 1.7364198647959854E-4 1.8182406961214508E-6 28-29 5.218350797868564E-4 6.909314645261513E-5 5.454722088364352E-6 1.8364231030826652E-4 1.8182406961214508E-6 30-31 5.572907733612247E-4 7.000226680067586E-5 5.454722088364352E-6 2.0637031900978467E-4 1.8182406961214508E-6 32-33 6.100197535487467E-4 7.636610923710094E-5 5.454722088364352E-6 2.3909865153997077E-4 1.8182406961214508E-6 34-35 6.563848912998437E-4 8.182083132546528E-5 5.454722088364352E-6 2.4273513293221368E-4 1.8182406961214508E-6 36-37 7.436604447136734E-4 8.363907202158674E-5 5.454722088364352E-6 2.490989753686387E-4 1.8182406961214508E-6 38-39 8.200265539507743E-4 8.363907202158674E-5 5.454722088364352E-6 2.5364457710894237E-4 1.8182406961214508E-6 40-41 9.454851619831545E-4 8.363907202158674E-5 5.454722088364352E-6 2.5637193815312455E-4 1.8182406961214508E-6 42-43 0.0010745802514077773 8.636643306576892E-5 5.454722088364352E-6 2.572810585011853E-4 1.8182406961214508E-6 44-45 0.0012264033495339186 9.00029144580118E-5 5.454722088364352E-6 2.636449009376104E-4 1.8182406961214508E-6 46-47 0.0014045909377538206 9.363939585025472E-5 7.272962784485803E-6 2.645540212856711E-4 1.8182406961214508E-6 48-49 0.0016482351910340953 9.63667568944369E-5 9.091203480607253E-6 2.818273078988249E-4 1.8182406961214508E-6 50-51 0.0019991556453855352 9.818499759055834E-5 9.091203480607253E-6 2.9273675207555356E-4 1.8182406961214508E-6 52-53 0.0024309878107143796 1.0182147898280124E-4 9.091203480607253E-6 3.436474915669542E-4 1.8182406961214508E-6 54-55 0.0029264584004074752 1.0545796037504414E-4 9.091203480607253E-6 4.0637679558314425E-4 1.8182406961214508E-6 56-57 0.0035437511167407077 1.072762010711656E-4 9.091203480607253E-6 4.200136008040551E-4 1.8182406961214508E-6 58-59 0.004303775727719474 1.0818532141922631E-4 1.0909444176728704E-5 4.545601740303627E-4 1.8182406961214508E-6 60-61 0.005310171953022697 1.1454916385565141E-4 1.0909444176728704E-5 5.081982745659455E-4 1.8182406961214508E-6 62-63 0.006692944002423061 1.1636740455177285E-4 1.0909444176728704E-5 5.181985983946135E-4 1.8182406961214508E-6 64-65 0.00840936321956171 1.181856452478943E-4 1.0909444176728704E-5 5.318354036155244E-4 1.8182406961214508E-6 66-67 0.010482157613140163 1.218221266401372E-4 1.0909444176728704E-5 5.409266070961316E-4 1.8182406961214508E-6 68-69 0.013166790000963486 1.29095089424623E-4 1.0909444176728704E-5 5.609272547534676E-4 1.8182406961214508E-6 70-71 0.016603264916633026 1.29095089424623E-4 1.0909444176728704E-5 6.036559111123217E-4 1.8182406961214508E-6 72-73 0.021208868599908663 1.318224504688052E-4 1.2727684872850155E-5 6.41838965730872E-4 1.8182406961214508E-6 74-75 0.027213608498849753 1.363680522091088E-4 1.2727684872850155E-5 6.545666506037222E-4 1.8182406961214508E-6 76-77 0.034912039606227976 1.3909541325329098E-4 1.2727684872850155E-5 6.636578540843295E-4 1.8182406961214508E-6 78-79 0.044407801641722255 1.472774963858375E-4 1.2727684872850155E-5 6.85476742437787E-4 1.8182406961214508E-6 80-81 0.056562740695294156 1.545504591703233E-4 1.2727684872850155E-5 6.982044273106371E-4 1.8182406961214508E-6 82-83 0.07208960711982328 1.6364166265093056E-4 1.2727684872850155E-5 7.172959546199124E-4 1.8182406961214508E-6 84-85 0.09230480717930156 1.6545990334705202E-4 1.2727684872850155E-5 7.291145191447017E-4 1.8182406961214508E-6 86-87 0.11748744082058366 1.7091462543541639E-4 1.545504591703233E-5 7.354783615811268E-4 1.8182406961214508E-6 88-89 0.14766659989480752 1.7818758821990218E-4 1.8182406961214507E-5 7.38205722625309E-4 1.8182406961214508E-6 90-91 0.1838514079883205 1.7818758821990218E-4 1.9091527309275235E-5 7.436604447136734E-4 1.8182406961214508E-6 92-93 0.22831012036953413 1.7818758821990218E-4 2.000064765733596E-5 7.58206370282645E-4 1.8182406961214508E-6 94-95 0.2830791666181045 1.7818758821990218E-4 2.000064765733596E-5 7.74570536547738E-4 1.8182406961214508E-6 96-97 0.3475357992956099 1.8000582891602364E-4 2.000064765733596E-5 7.782070179399809E-4 1.8182406961214508E-6 98-99 0.422152760983042 1.8000582891602364E-4 2.000064765733596E-5 7.84570860376406E-4 1.8182406961214508E-6 100-101 0.5079182654987427 1.8000582891602364E-4 2.000064765733596E-5 7.891164621167097E-4 1.8182406961214508E-6 102-103 0.604425026926781 1.8455143065632725E-4 2.000064765733596E-5 8.10935350470167E-4 1.8182406961214508E-6 104-105 0.7155204425801498 1.936426341369345E-4 2.000064765733596E-5 8.191174336027136E-4 1.8182406961214508E-6 106-107 0.8421618161853568 1.963699951811167E-4 2.000064765733596E-5 8.263903963871994E-4 1.8182406961214508E-6 108-109 0.9847073411595383 2.0909768005396686E-4 2.000064765733596E-5 8.391180812600495E-4 1.8182406961214508E-6 110-111 1.140010551978056 2.1637064283845265E-4 2.000064765733596E-5 8.454819236964746E-4 1.8182406961214508E-6 112-113 1.308463279510924 2.1818888353457408E-4 2.0909768005396684E-5 8.554822475251426E-4 1.8182406961214508E-6 114-115 1.4940456526419519 2.2637096666712063E-4 2.181888835345741E-5 8.709372934421749E-4 1.8182406961214508E-6 116-117 1.7005932501196084 2.290983277113028E-4 2.181888835345741E-5 8.782102562266607E-4 1.8182406961214508E-6 118-119 1.924928696327421 2.3182568875548497E-4 2.181888835345741E-5 8.954835428398145E-4 1.8182406961214508E-6 120-121 2.16534557237208 2.3546217014772786E-4 2.181888835345741E-5 9.000291445801182E-4 1.8182406961214508E-6 122-123 2.421441137939394 2.4546249397639587E-4 2.181888835345741E-5 9.091203480607254E-4 1.8182406961214508E-6 124-125 2.695432737558283 2.5000809571669945E-4 2.181888835345741E-5 9.163933108452112E-4 1.8182406961214508E-6 126-127 2.9917096042691855 2.509172160647602E-4 2.181888835345741E-5 9.218480329335755E-4 1.8182406961214508E-6 128-129 3.310520837047469 2.545536974570031E-4 2.181888835345741E-5 9.318483567622435E-4 1.8182406961214508E-6 130-131 3.646562627782547 2.545536974570031E-4 2.363712904957886E-5 9.445760416350936E-4 1.8182406961214508E-6 132-133 3.99991952466679 2.5637193815312455E-4 2.363712904957886E-5 9.491216433753973E-4 1.8182406961214508E-6 134-135 4.3722261260860105 2.618266602414889E-4 2.363712904957886E-5 9.563946061598831E-4 1.8182406961214508E-6 136-137 4.766701627192692 2.645540212856711E-4 2.363712904957886E-5 9.763952538172191E-4 1.8182406961214508E-6 138 5.076989856707906 2.6546314163373183E-4 2.545536974570031E-5 0.001012760067739648 1.8182406961214508E-6 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCACGC 13835 0.0 15.694856 5 GCACGCA 15390 0.0 14.342646 6 CTGCACG 16685 0.0 12.8847065 4 ATAGGCG 8695 0.0 12.817155 6 CACGCAA 18520 0.0 12.22923 7 GGCGTCT 14060 0.0 11.764223 9 ACGCAAA 20480 0.0 11.4468155 8 AGGCGTC 15275 0.0 10.874963 8 TAGGCGT 11385 0.0 9.915078 7 GCCGTAT 28050 0.0 8.827578 140-144 CGCAAAG 28850 0.0 8.749476 9 GCGCAAA 20025 0.0 8.439027 8 AGCGCAA 20300 0.0 8.429667 7 CGCCGTA 32050 0.0 8.283156 140-144 GGAAAAT 131760 0.0 8.229005 1 GGGGAAT 43210 0.0 8.153449 1 CGGGCGT 5650 0.0 7.889923 1 GTCGCCG 40820 0.0 7.8797836 140-144 GGTCGCC 46010 0.0 7.66404 140-144 GGGAAAT 84365 0.0 7.5935507 1 >>END_MODULE skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237621 SRR4237621_1.fastq SRR4237621_2.fastq Input file: SRR4237621_1.fastq Paired file: SRR4237621_2.fastq trimmed: SRR4237621-trimmed-pair1.fastq, SRR4237621-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Apr 15 04:36:07 2025 >> started Tue Apr 15 04:37:08 2025 >> done (61.017s) 54998219 read pairs processed; of these: 111 ( 0.00%) short read pairs filtered out after trimming by size control 6498 ( 0.01%) empty read pairs filtered out after trimming by size control 54991610 (99.99%) read pairs available; of these: 4538062 ( 8.25%) trimmed read pairs available after processing 50453548 (91.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 13 0.00% 20 11 0.00% 21 7 0.00% 22 8 0.00% 23 10 0.00% 24 8 0.00% 25 10 0.00% 26 12 0.00% 27 12 0.00% 28 7 0.00% 29 11 0.00% 30 10 0.00% 31 15 0.00% 32 14 0.00% 33 8 0.00% 34 24 0.00% 35 25 0.00% 36 24 0.00% 37 22 0.00% 38 17 0.00% 39 38 0.00% 40 47 0.00% 41 36 0.00% 42 29 0.00% 43 52 0.00% 44 39 0.00% 45 51 0.00% 46 50 0.00% 47 77 0.00% 48 79 0.00% 49 100 0.00% 50 117 0.00% 51 114 0.00% 52 140 0.00% 53 138 0.00% 54 146 0.00% 55 173 0.00% 56 203 0.00% 57 210 0.00% 58 239 0.00% 59 285 0.00% 60 338 0.00% 61 401 0.00% 62 417 0.00% 63 487 0.00% 64 547 0.00% 65 570 0.00% 66 674 0.00% 67 752 0.00% 68 841 0.00% 69 966 0.00% 70 1091 0.00% 71 1299 0.00% 72 1522 0.00% 73 1659 0.00% 74 1954 0.00% 75 2168 0.00% 76 2433 0.00% 77 2672 0.00% 78 2984 0.01% 79 3508 0.01% 80 3797 0.01% 81 4375 0.01% 82 5068 0.01% 83 5678 0.01% 84 6480 0.01% 85 7167 0.01% 86 7737 0.01% 87 8554 0.02% 88 9373 0.02% 89 10178 0.02% 90 11278 0.02% 91 12554 0.02% 92 13996 0.03% 93 15616 0.03% 94 16850 0.03% 95 18200 0.03% 96 20005 0.04% 97 21166 0.04% 98 22635 0.04% 99 24603 0.04% 100 25886 0.05% 101 27271 0.05% 102 29558 0.05% 103 31729 0.06% 104 33781 0.06% 105 36035 0.07% 106 38758 0.07% 107 40504 0.07% 108 42457 0.08% 109 44174 0.08% 110 45693 0.08% 111 47776 0.09% 112 50186 0.09% 113 52468 0.10% 114 55735 0.10% 115 59192 0.11% 116 60741 0.11% 117 63846 0.12% 118 66457 0.12% 119 68174 0.12% 120 70409 0.13% 121 72797 0.13% 122 75063 0.14% 123 77698 0.14% 124 81139 0.15% 125 84184 0.15% 126 87189 0.16% 127 91147 0.17% 128 92900 0.17% 129 95604 0.17% 130 98009 0.18% 131 100311 0.18% 132 102941 0.19% 133 105947 0.19% 134 108623 0.20% 135 112016 0.20% 136 115783 0.21% 137 117841 0.21% 138 122239 0.22% 139 125287 0.23% 140 127813 0.23% 141 130184 0.24% 142 133971 0.24% 143 134520 0.24% 144 139571 0.25% 145 142922 0.26% 146 143764 0.26% 147 147467 0.27% 148 151138 0.27% 149 153932 0.28% 150 50453548 91.75% 54991610 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=8.59 fanout-score-rank=15 prefix-density=0.29 prefix-fanout=5.1 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=136.07 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=18.8 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=2.8 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=272.53 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=30.2 sequence=AAGAAGAAGAAA SRR4237621 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 15 04:38:07 Started mapping on | Apr 15 04:38:07 Finished on | Apr 15 04:44:12 Mapping speed, Million of reads per hour | 542.38 Number of input reads | 54991610 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 52053998 Uniquely mapped reads % | 94.66% Average mapped length | 295.30 Number of splices: Total | 47905787 Number of splices: Annotated (sjdb) | 47109223 Number of splices: GT/AG | 47194422 Number of splices: GC/AG | 558801 Number of splices: AT/AC | 43728 Number of splices: Non-canonical | 108836 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1024711 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 65274 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1912901 1912901 1912901 N_multimapping 1024711 1024711 1024711 N_noFeature 1396350 51386122 1765339 N_ambiguous 513378 2646 212628 UnstrandedReadsAssigned:50144270 PositiveStrandReadsAssigned:665230 NegativeStrandReadsAssigned:50076031 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR4237621 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237621-trimmed-pair1.fastq SRR4237621-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 54,991,610 reads, 50,123,484 reads pseudoaligned [quant] estimated average fragment length: 244.376 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR4237621.ke.tsv 34699 SRR4237621.se.tsv 87100 total ==> SRR4237621.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.62 1069 12.083 Potri.005G024800.1.v4.1 1035 791.624 155 3.9275 Potri.004G059700.1.v4.1 961 717.666 33 0.92235 Potri.007G009000.2.v4.1 1416 1172.62 0 0 Potri.003G141000.2.v4.1 2943 2699.62 930.169 6.91135 Potri.016G087400.1.v4.1 270 78.3648 5939.3 1520.26 Potri.015G069301.1.v4.1 564 325.559 0 0 Potri.010G195200.1.v4.1 1773 1529.62 88 1.15399 Potri.012G127500.1.v4.1 977 733.645 16831 460.18 ==> SRR4237621.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7816 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 884 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 36 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR4237621 completed mapping pipeline successfully