Starting /dee2/code/volunteer_pipeline.sh SRR4237622 current disk space = 3051584790528 free memory = 1577791140 SRR4237622 SRAfilesize dc6b867664b2ef805d3ffd772f67ed0e SRR4237622.sra SRR4237622.sra file validated SRR4237622 is paired end SRR4237622 is conventional basespace SRR4237622 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237622_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3175 34.0 33.0 34.0 33.0 34.0 2 33.303 34.0 33.0 34.0 33.0 34.0 3 33.443 34.0 33.0 34.0 33.0 34.0 4 33.3445 34.0 33.0 34.0 33.0 34.0 5 33.33775 34.0 33.0 34.0 33.0 34.0 6 34.16075 38.0 37.0 38.0 27.0 38.0 7 36.66175 38.0 38.0 38.0 31.0 38.0 8 36.8525 38.0 38.0 38.0 31.0 38.0 9 37.36575 38.0 38.0 38.0 37.0 38.0 10-14 37.46315 38.0 38.0 38.0 37.6 38.0 15-19 37.492000000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.42235 38.0 38.0 38.0 37.4 38.0 25-29 37.4463 38.0 38.0 38.0 37.8 38.0 30-34 37.487700000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.23395 38.0 38.0 38.0 36.8 38.0 40-44 37.3058 38.0 38.0 38.0 37.0 38.0 45-49 37.15515 38.0 38.0 38.0 36.4 38.0 50-54 37.3027 38.0 38.0 38.0 37.0 38.0 55-59 37.285399999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.28345 38.0 38.0 38.0 36.8 38.0 65-69 37.29729999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.1291 38.0 38.0 38.0 36.8 38.0 75-79 36.7039 38.0 38.0 38.0 36.0 38.0 80-84 36.6385 38.0 38.0 38.0 36.0 38.0 85-89 36.589650000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.501850000000005 38.0 38.0 38.0 35.4 38.0 95-99 36.5188 38.0 38.0 38.0 35.6 38.0 100-104 36.14895 38.0 38.0 38.0 34.0 38.0 105-109 36.333850000000005 38.0 38.0 38.0 34.6 38.0 110-114 35.466449999999995 38.0 36.8 38.0 29.6 38.0 115-119 36.0479 38.0 38.0 38.0 33.8 38.0 120-124 36.12215 38.0 38.0 38.0 34.0 38.0 125-129 35.9765 38.0 38.0 38.0 34.0 38.0 130-134 36.0598 38.0 38.0 38.0 34.0 38.0 135-139 35.6785 38.0 37.6 38.0 33.0 38.0 140-144 35.643299999999996 38.0 38.0 38.0 33.0 38.0 145-149 35.334199999999996 38.0 38.0 38.0 32.2 38.0 150 31.43175 36.0 33.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 3.0 16 2.0 17 4.0 18 19.0 19 32.0 20 7.0 21 7.0 22 2.0 23 3.0 24 5.0 25 10.0 26 14.0 27 15.0 28 13.0 29 22.0 30 38.0 31 47.0 32 42.0 33 68.0 34 119.0 35 165.0 36 393.0 37 2969.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.521260630315155 11.5807903951976 8.87943971985993 37.01850925462731 2 23.45 15.049999999999999 34.65 26.85 3 20.175 18.075 26.85 34.9 4 23.5 25.825 23.175 27.500000000000004 5 25.324999999999996 30.4 24.125 20.150000000000002 6 19.191096634093377 35.12486427795874 24.267100977198698 21.416938110749186 7 13.850000000000001 28.000000000000004 41.349999999999994 16.8 8 16.375 28.375 30.525000000000002 24.725 9 19.05 24.224999999999998 32.375 24.349999999999998 10-14 19.395 30.555 26.615 23.435 15-19 19.400000000000002 29.73 27.265 23.605 20-24 19.72 29.81 27.11 23.36 25-29 19.439999999999998 29.01 27.415 24.135 30-34 20.3 28.785 26.950000000000003 23.965 35-39 20.345 29.365000000000002 27.045 23.244999999999997 40-44 19.77 29.625 27.18 23.425 45-49 20.325 29.154999999999998 27.485 23.035 50-54 20.015 28.835 26.88 24.27 55-59 19.79 28.970000000000002 27.894999999999996 23.345 60-64 19.75 29.04 27.29 23.919999999999998 65-69 19.38 29.770000000000003 27.6 23.25 70-74 20.1 30.075000000000003 26.575 23.25 75-79 19.72 29.835 26.99 23.455000000000002 80-84 20.064999999999998 29.270000000000003 27.205000000000002 23.46 85-89 19.91 27.98 28.49 23.62 90-94 19.835 28.345 27.625 24.195 95-99 20.265 29.075 27.265 23.395 100-104 20.06 28.82 27.43 23.69 105-109 20.630000000000003 28.910000000000004 27.36 23.1 110-114 20.51 29.335 27.0 23.155 115-119 20.49 29.34 26.76 23.41 120-124 20.315 29.285 26.779999999999998 23.62 125-129 20.415 28.544999999999998 27.060000000000002 23.98 130-134 20.885 29.115000000000002 26.479999999999997 23.52 135-139 21.375 28.044999999999998 26.32 24.26 140-144 21.175 28.735 26.779999999999998 23.31 145-149 21.19 28.615000000000002 26.615 23.580000000000002 150 22.05 27.474999999999998 26.674999999999997 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 2.0 24 2.0 25 3.5 26 4.5 27 7.5 28 10.0 29 14.0 30 21.5 31 26.5 32 43.0 33 54.5 34 64.5 35 82.5 36 97.5 37 106.5 38 120.0 39 146.5 40 179.5 41 206.0 42 234.0 43 275.5 44 286.0 45 258.5 46 264.5 47 270.0 48 226.5 49 205.5 50 184.0 51 141.0 52 108.5 53 90.5 54 69.0 55 49.0 56 41.5 57 34.5 58 22.5 59 12.0 60 7.0 61 6.0 62 7.0 63 3.5 64 2.0 65 2.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 7.9 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74580579562786 98.1 2 0.20335536349771224 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02541942043721403 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.02541942043721403 1.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 52 1.3 TruSeq Adapter, Index 9 (100% over 50bp) GATCGNAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 8 0.2 TruSeq Adapter, Index 9 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.0875000000000004 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 2.9125 0.0 0.0 0.0 0.0 122-123 3.35 0.0 0.0 0.0 0.0 124-125 3.8125 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.225 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.449999999999999 0.0 0.0 0.0 0.0 136-137 6.975 0.0 0.0 0.0 0.0 138 7.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237622 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237622_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8195 33.0 33.0 34.0 32.0 34.0 2 32.9185 34.0 33.0 34.0 32.0 34.0 3 32.96925 34.0 33.0 34.0 32.0 34.0 4 32.93275 34.0 33.0 34.0 32.0 34.0 5 32.9065 34.0 33.0 34.0 32.0 34.0 6 37.029 38.0 38.0 38.0 36.0 38.0 7 37.0955 38.0 38.0 38.0 37.0 38.0 8 37.0355 38.0 38.0 38.0 37.0 38.0 9 37.02825 38.0 38.0 38.0 37.0 38.0 10-14 37.0375 38.0 38.0 38.0 36.6 38.0 15-19 37.0435 38.0 38.0 38.0 37.0 38.0 20-24 37.00555 38.0 38.0 38.0 36.8 38.0 25-29 36.93945 38.0 38.0 38.0 36.0 38.0 30-34 36.90865 38.0 38.0 38.0 36.0 38.0 35-39 36.91685 38.0 38.0 38.0 36.2 38.0 40-44 36.9039 38.0 38.0 38.0 36.4 38.0 45-49 36.864850000000004 38.0 38.0 38.0 36.2 38.0 50-54 36.79325 38.0 38.0 38.0 36.0 38.0 55-59 36.7621 38.0 38.0 38.0 36.0 38.0 60-64 36.78555 38.0 38.0 38.0 36.0 38.0 65-69 36.5999 38.0 38.0 38.0 35.6 38.0 70-74 36.21355 38.0 38.0 38.0 35.2 38.0 75-79 36.244299999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.1037 38.0 38.0 38.0 34.4 38.0 85-89 36.04145 38.0 38.0 38.0 34.2 38.0 90-94 36.030150000000006 38.0 38.0 38.0 34.2 38.0 95-99 35.9014 38.0 38.0 38.0 34.0 38.0 100-104 35.864799999999995 38.0 38.0 38.0 34.0 38.0 105-109 35.71775000000001 38.0 38.0 38.0 33.6 38.0 110-114 35.731100000000005 38.0 38.0 38.0 33.6 38.0 115-119 35.57455 38.0 38.0 38.0 32.8 38.0 120-124 35.49720000000001 38.0 38.0 38.0 32.6 38.0 125-129 35.43 38.0 38.0 38.0 32.6 38.0 130-134 35.25345 38.0 38.0 38.0 31.4 38.0 135-139 35.17235000000001 38.0 38.0 38.0 31.0 38.0 140-144 34.9504 38.0 37.2 38.0 30.2 38.0 145-149 34.4563 38.0 36.4 38.0 27.6 38.0 150 29.61175 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 1.0 5 2.0 6 2.0 7 4.0 8 2.0 9 0.0 10 5.0 11 1.0 12 1.0 13 5.0 14 3.0 15 5.0 16 13.0 17 51.0 18 8.0 19 5.0 20 2.0 21 11.0 22 6.0 23 15.0 24 8.0 25 21.0 26 17.0 27 22.0 28 17.0 29 27.0 30 37.0 31 45.0 32 52.0 33 73.0 34 98.0 35 143.0 36 309.0 37 2977.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.0 20.375 13.55 24.075 2 28.325 28.349999999999998 28.325 15.0 3 22.45 26.950000000000003 32.074999999999996 18.525 4 25.4 32.4 22.825 19.375 5 26.424999999999997 35.949999999999996 21.45 16.175 6 22.3 38.3 22.6 16.8 7 20.349999999999998 22.925 39.425 17.299999999999997 8 22.725 27.0 26.825 23.45 9 22.825 25.624999999999996 29.799999999999997 21.75 10-14 23.925 28.78 26.525 20.77 15-19 24.19 27.71 27.560000000000002 20.54 20-24 23.64 28.215 27.045 21.099999999999998 25-29 23.455000000000002 28.660000000000004 27.185 20.7 30-34 23.645 27.865000000000002 28.26 20.23 35-39 22.205 27.965 28.544999999999998 21.285 40-44 24.345 27.445000000000004 27.839999999999996 20.369999999999997 45-49 23.705000000000002 26.855 28.025 21.415 50-54 22.99 28.18 27.884999999999998 20.945 55-59 22.935 28.575 28.105000000000004 20.385 60-64 23.015 28.575 28.060000000000002 20.349999999999998 65-69 23.385 28.815 28.075 19.725 70-74 23.56 28.23 27.655 20.555 75-79 23.47 28.21 28.175 20.145 80-84 23.599999999999998 27.87 28.165000000000003 20.365 85-89 23.830000000000002 27.72 28.025 20.424999999999997 90-94 23.53 27.42 28.904999999999998 20.145 95-99 23.494999999999997 28.494999999999997 27.855 20.155 100-104 23.875 27.825 28.425 19.875 105-109 23.799999999999997 27.825 27.99 20.385 110-114 23.96 27.73 28.439999999999998 19.869999999999997 115-119 24.0 27.79 28.075 20.135 120-124 24.115000000000002 28.08 27.49 20.315 125-129 24.34 28.005000000000003 27.315 20.34 130-134 24.685000000000002 27.55 27.655 20.11 135-139 24.925 27.755000000000003 27.72 19.6 140-144 24.855 28.235 26.915 19.994999999999997 145-149 25.255 27.584999999999997 27.36 19.8 150 24.474999999999998 28.549999999999997 27.200000000000003 19.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 2.0 24 3.5 25 2.0 26 4.0 27 5.5 28 5.5 29 8.0 30 14.5 31 19.0 32 22.5 33 33.0 34 41.0 35 62.5 36 82.5 37 91.0 38 133.5 39 180.5 40 192.5 41 224.0 42 266.0 43 289.5 44 293.5 45 271.5 46 277.0 47 277.5 48 234.5 49 192.0 50 173.5 51 143.0 52 112.5 53 94.0 54 66.5 55 48.0 56 33.0 57 26.0 58 20.5 59 13.0 60 10.5 61 7.0 62 3.5 63 3.5 64 4.0 65 2.5 66 3.0 67 2.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69426751592356 97.82499999999999 2 0.25477707006369427 0.5 3 0.025477707006369425 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025477707006369425 1.6 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 64 1.6 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.5875 0.0 0.0 0.0 0.0 126-127 4.012499999999999 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 5.0 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 6.2125 0.0 0.0 0.0 0.0 136-137 6.7375 0.0 0.0 0.0 0.0 138 7.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTCT 10 0.006973645 144.0 5 >>END_MODULE Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906348 spots for SRR4237622.sra Written 2906348 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra Read 2906335 spots for SRR4237622.sra Written 2906335 spots for SRR4237622.sra SRR ids: ['SRR4237622.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t0752d6o SRR4237622.sra spots: 58126713 blocks: [[1, 2906335], [2906336, 5812670], [5812671, 8719005], [8719006, 11625340], [11625341, 14531675], [14531676, 17438010], [17438011, 20344345], [20344346, 23250680], [23250681, 26157015], [26157016, 29063350], [29063351, 31969685], [31969686, 34876020], [34876021, 37782355], [37782356, 40688690], [40688691, 43595025], [43595026, 46501360], [46501361, 49407695], [49407696, 52314030], [52314031, 55220365], [55220366, 58126713]] SRR4237622 file size 19562006 SRR4237622 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237622 SRR4237622_1.fastq SRR4237622_2.fastq Input file: SRR4237622_1.fastq Paired file: SRR4237622_2.fastq trimmed: SRR4237622-trimmed-pair1.fastq, SRR4237622-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:02:18 2025 >> started Wed Feb 12 18:03:19 2025 >> done (61.247s) 58126713 read pairs processed; of these: 101800 ( 0.18%) short read pairs filtered out after trimming by size control 862089 ( 1.48%) empty read pairs filtered out after trimming by size control 57162824 (98.34%) read pairs available; of these: 18125788 (31.71%) trimmed read pairs available after processing 39037036 (68.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 19 0.00% 20 8 0.00% 21 13 0.00% 22 13 0.00% 23 18 0.00% 24 15 0.00% 25 11 0.00% 26 21 0.00% 27 18 0.00% 28 17 0.00% 29 28 0.00% 30 25 0.00% 31 20 0.00% 32 24 0.00% 33 27 0.00% 34 35 0.00% 35 38 0.00% 36 29 0.00% 37 45 0.00% 38 50 0.00% 39 51 0.00% 40 66 0.00% 41 76 0.00% 42 108 0.00% 43 109 0.00% 44 204 0.00% 45 283 0.00% 46 297 0.00% 47 313 0.00% 48 280 0.00% 49 332 0.00% 50 323 0.00% 51 348 0.00% 52 409 0.00% 53 418 0.00% 54 508 0.00% 55 554 0.00% 56 541 0.00% 57 637 0.00% 58 635 0.00% 59 722 0.00% 60 800 0.00% 61 845 0.00% 62 880 0.00% 63 984 0.00% 64 1152 0.00% 65 1278 0.00% 66 1474 0.00% 67 1728 0.00% 68 2280 0.00% 69 5984 0.01% 70 6364 0.01% 71 3327 0.01% 72 3204 0.01% 73 3312 0.01% 74 3619 0.01% 75 4003 0.01% 76 4490 0.01% 77 5029 0.01% 78 5606 0.01% 79 6201 0.01% 80 7002 0.01% 81 7998 0.01% 82 9313 0.02% 83 11161 0.02% 84 25586 0.04% 85 19243 0.03% 86 21502 0.04% 87 20767 0.04% 88 19454 0.03% 89 20979 0.04% 90 22575 0.04% 91 24781 0.04% 92 27238 0.05% 93 30520 0.05% 94 39557 0.07% 95 38588 0.07% 96 37420 0.07% 97 42706 0.07% 98 41694 0.07% 99 45137 0.08% 100 48488 0.08% 101 51102 0.09% 102 55011 0.10% 103 58445 0.10% 104 62337 0.11% 105 66679 0.12% 106 70990 0.12% 107 74476 0.13% 108 78974 0.14% 109 82625 0.14% 110 86361 0.15% 111 89360 0.16% 112 93952 0.16% 113 99278 0.17% 114 103110 0.18% 115 108794 0.19% 116 113211 0.20% 117 119425 0.21% 118 123246 0.22% 119 126975 0.22% 120 132611 0.23% 121 136372 0.24% 122 140740 0.25% 123 146196 0.26% 124 151837 0.27% 125 157533 0.28% 126 163380 0.29% 127 169744 0.30% 128 176392 0.31% 129 183479 0.32% 130 187796 0.33% 131 190948 0.33% 132 198415 0.35% 133 206369 0.36% 134 212369 0.37% 135 219763 0.38% 136 230051 0.40% 137 239661 0.42% 138 251111 0.44% 139 263480 0.46% 140 276695 0.48% 141 293798 0.51% 142 314623 0.55% 143 340766 0.60% 144 381348 0.67% 145 440215 0.77% 146 536086 0.94% 147 723553 1.27% 148 1243897 2.18% 149 7520243 13.16% 150 39037036 68.29% 57162824 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=15.14 fanout-score-rank=8 prefix-density=0.33 prefix-fanout=6.7 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=7 fanout-score=92.22 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=16.4 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=21.09 fanout-score-rank=8 prefix-density=0.40 prefix-fanout=8.2 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=203.90 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=24.5 sequence=GAAGAAGAAGAAA SRR4237622 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:04:03 Started mapping on | Feb 12 18:04:03 Finished on | Feb 12 18:08:18 Mapping speed, Million of reads per hour | 807.00 Number of input reads | 57162824 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 55108714 Uniquely mapped reads % | 96.41% Average mapped length | 292.29 Number of splices: Total | 47601301 Number of splices: Annotated (sjdb) | 46766484 Number of splices: GT/AG | 46878614 Number of splices: GC/AG | 559850 Number of splices: AT/AC | 47184 Number of splices: Non-canonical | 115653 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1186835 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 86917 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.33% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 914045 914045 914045 N_multimapping 1186835 1186835 1186835 N_noFeature 1619249 54323418 2043020 N_ambiguous 594521 4133 229839 UnstrandedReadsAssigned:52894944 PositiveStrandReadsAssigned:781163 NegativeStrandReadsAssigned:52835855 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237622 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237622-trimmed-pair1.fastq SRR4237622-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,162,824 reads, 52,670,874 reads pseudoaligned [quant] estimated average fragment length: 228.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52401 SRR4237622.ke.tsv 34699 SRR4237622.se.tsv 87100 total ==> SRR4237622.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.29 1213 12.6677 Potri.005G024800.1.v4.1 1035 807.291 195 4.51612 Potri.004G059700.1.v4.1 961 733.311 37 0.943353 Potri.007G009000.2.v4.1 1416 1188.29 0 0 Potri.003G141000.2.v4.1 2943 2715.29 796.097 5.48164 Potri.016G087400.1.v4.1 270 86.0567 6416.4 1394.02 Potri.015G069301.1.v4.1 564 340.185 0 0 Potri.010G195200.1.v4.1 1773 1545.29 176 2.12943 Potri.012G127500.1.v4.1 977 749.301 22965 573.021 ==> SRR4237622.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5889 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1087 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 32 SRR4237622 completed mapping pipeline successfully