Starting /dee2/code/volunteer_pipeline.sh SRR4237623 current disk space = 3051793059840 free memory = 1489785744 SRR4237623 SRAfilesize d9dbf52ea90e5c12d4ccb827182d0c6f SRR4237623.sra SRR4237623.sra file validated SRR4237623 is paired end SRR4237623 is conventional basespace SRR4237623 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237623_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01625 34.0 33.0 34.0 32.0 34.0 2 33.14275 34.0 33.0 34.0 32.0 34.0 3 33.15925 34.0 33.0 34.0 32.0 34.0 4 33.13175 34.0 33.0 34.0 32.0 34.0 5 33.19575 34.0 33.0 34.0 32.0 34.0 6 35.01375 38.0 37.0 38.0 31.0 38.0 7 36.713 38.0 37.0 38.0 33.0 38.0 8 36.901 38.0 38.0 38.0 34.0 38.0 9 37.11625 38.0 38.0 38.0 36.0 38.0 10-14 37.3016 38.0 38.0 38.0 37.0 38.0 15-19 37.14685 38.0 38.0 38.0 36.4 38.0 20-24 37.1809 38.0 38.0 38.0 36.6 38.0 25-29 37.15075 38.0 38.0 38.0 36.2 38.0 30-34 35.385000000000005 37.8 34.4 38.0 28.4 38.0 35-39 36.4945 38.0 37.4 38.0 33.4 38.0 40-44 37.0638 38.0 38.0 38.0 36.0 38.0 45-49 36.029300000000006 38.0 36.8 38.0 30.4 38.0 50-54 36.9618 38.0 38.0 38.0 35.8 38.0 55-59 36.864999999999995 38.0 38.0 38.0 35.0 38.0 60-64 36.879149999999996 38.0 38.0 38.0 35.2 38.0 65-69 36.7845 38.0 38.0 38.0 34.8 38.0 70-74 36.60645 38.0 37.8 38.0 34.2 38.0 75-79 36.73005 38.0 38.0 38.0 34.6 38.0 80-84 36.660349999999994 38.0 38.0 38.0 34.4 38.0 85-89 35.348400000000005 37.6 35.2 38.0 30.4 38.0 90-94 35.6645 37.8 35.8 38.0 31.0 38.0 95-99 35.4143 37.8 35.8 38.0 29.0 38.0 100-104 36.165049999999994 38.0 37.0 38.0 33.2 38.0 105-109 35.5764 38.0 36.4 38.0 30.0 38.0 110-114 34.67705 37.8 34.6 38.0 26.0 38.0 115-119 36.01155 38.0 37.0 38.0 32.8 38.0 120-124 34.00285 37.4 31.0 38.0 25.8 38.0 125-129 35.77375 38.0 36.8 38.0 31.8 38.0 130-134 35.6871 38.0 36.4 38.0 31.4 38.0 135-139 35.5623 38.0 36.0 38.0 31.2 38.0 140-144 35.13645 38.0 36.0 38.0 29.8 38.0 145-149 33.5707 38.0 34.6 38.0 21.6 38.0 150 28.6605 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 2.0 20 7.0 21 3.0 22 10.0 23 7.0 24 12.0 25 8.0 26 22.0 27 37.0 28 32.0 29 54.0 30 54.0 31 87.0 32 96.0 33 151.0 34 201.0 35 327.0 36 910.0 37 1973.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.2962962962963 12.887887887887889 7.7327327327327335 33.08308308308308 2 23.175 15.75 33.85 27.224999999999998 3 19.650000000000002 21.05 25.275 34.025 4 23.45 29.525000000000002 22.900000000000002 24.125 5 22.275 34.0 23.425 20.3 6 18.298766080336044 36.41375689157259 23.890784982935152 21.39669204515621 7 13.775 26.450000000000003 42.65 17.125 8 17.2 25.124999999999996 32.45 25.224999999999998 9 16.75 24.925 33.675 24.65 10-14 20.24 29.609999999999996 27.04 23.11 15-19 19.61 29.18 27.85 23.36 20-24 19.535 28.999999999999996 27.685 23.78 25-29 20.105 28.999999999999996 27.24 23.655 30-34 19.98 28.735 28.09 23.195 35-39 20.035 28.715000000000003 27.27 23.98 40-44 20.015 29.395 27.565 23.025000000000002 45-49 20.06 29.43 27.145000000000003 23.365 50-54 19.6 29.15 27.49 23.76 55-59 20.549999999999997 29.125 27.32 23.005 60-64 20.119999999999997 29.185 26.790000000000003 23.905 65-69 20.064999999999998 29.165000000000003 27.0 23.77 70-74 20.150000000000002 28.08 27.505000000000003 24.265 75-79 20.105 28.63 27.375 23.89 80-84 19.855 28.975 27.229999999999997 23.94 85-89 20.465 29.2 27.04 23.294999999999998 90-94 19.985 28.775000000000002 27.73 23.51 95-99 20.064999999999998 28.325 27.279999999999998 24.33 100-104 20.49 28.73 27.605 23.175 105-109 20.79 27.800000000000004 27.560000000000002 23.849999999999998 110-114 20.51 28.435 27.560000000000002 23.494999999999997 115-119 19.73 28.775000000000002 27.584999999999997 23.91 120-124 20.135 28.525 27.6 23.74 125-129 20.669999999999998 28.139999999999997 27.97 23.22 130-134 20.445 28.77 27.77 23.015 135-139 20.595 28.415000000000003 27.47 23.52 140-144 20.75 27.775 27.584999999999997 23.89 145-149 20.571028551427574 28.16640832041602 27.26136306815341 24.001200060003 150 19.979994998749685 28.507126781695426 27.53188297074269 23.980995248812203 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.0 23 3.0 24 3.5 25 2.5 26 5.0 27 9.5 28 11.5 29 15.0 30 22.0 31 28.5 32 35.0 33 46.0 34 64.0 35 70.0 36 77.5 37 104.0 38 128.0 39 146.0 40 174.0 41 224.0 42 240.5 43 264.0 44 283.5 45 269.0 46 278.5 47 258.0 48 225.5 49 202.5 50 165.0 51 150.5 52 135.5 53 101.5 54 71.0 55 50.0 56 39.5 57 31.0 58 21.0 59 11.0 60 7.0 61 3.5 62 2.5 63 2.5 64 3.0 65 2.0 66 0.0 67 1.5 68 3.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 4.775 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.1124999999999998 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 2.025 0.0 0.0 0.0 0.0 134-135 2.2750000000000004 0.0 0.0 0.0 0.0 136-137 2.65 0.0 0.0 0.0 0.0 138 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGCA 10 0.0064790826 147.53847 1 ACGTCTG 20 0.0061705867 28.769999 130-134 CCAGTCA 20 0.0061705867 28.769999 140-144 TCCAGTC 20 0.0061705867 28.769999 140-144 GAACTCC 20 0.0061705867 28.769999 135-139 CGTCTGA 20 0.0061705867 28.769999 130-134 >>END_MODULE SRR4237623 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237623_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.52175 33.0 32.0 34.0 27.0 34.0 2 32.32825 33.0 33.0 34.0 31.0 34.0 3 32.4425 33.0 33.0 34.0 31.0 34.0 4 32.361 33.0 33.0 34.0 31.0 34.0 5 32.475 33.0 33.0 34.0 32.0 34.0 6 33.7125 38.0 34.0 38.0 16.0 38.0 7 36.11025 38.0 37.0 38.0 31.0 38.0 8 36.455 38.0 38.0 38.0 34.0 38.0 9 36.222 38.0 38.0 38.0 33.0 38.0 10-14 36.620799999999996 38.0 38.0 38.0 34.4 38.0 15-19 36.722500000000004 38.0 38.0 38.0 35.6 38.0 20-24 36.686350000000004 38.0 38.0 38.0 35.4 38.0 25-29 36.660199999999996 38.0 38.0 38.0 35.4 38.0 30-34 36.5431 38.0 38.0 38.0 34.8 38.0 35-39 36.598200000000006 38.0 38.0 38.0 34.8 38.0 40-44 36.57365 38.0 38.0 38.0 35.2 38.0 45-49 36.49804999999999 38.0 38.0 38.0 34.8 38.0 50-54 36.435050000000004 38.0 38.0 38.0 34.0 38.0 55-59 36.557500000000005 38.0 38.0 38.0 35.0 38.0 60-64 35.876400000000004 38.0 37.4 38.0 29.8 38.0 65-69 36.37714999999999 38.0 38.0 38.0 34.0 38.0 70-74 36.38085 38.0 38.0 38.0 34.2 38.0 75-79 36.3019 38.0 38.0 38.0 34.0 38.0 80-84 35.4853 38.0 36.8 38.0 28.4 38.0 85-89 36.02305 38.0 37.8 38.0 32.8 38.0 90-94 35.96329999999999 38.0 37.8 38.0 33.0 38.0 95-99 35.81945 38.0 37.4 38.0 32.6 38.0 100-104 35.9707 38.0 38.0 38.0 33.4 38.0 105-109 35.87215 38.0 38.0 38.0 33.0 38.0 110-114 35.68155 38.0 37.8 38.0 32.2 38.0 115-119 35.415949999999995 38.0 37.0 38.0 30.2 38.0 120-124 33.711 37.6 32.8 38.0 24.8 38.0 125-129 35.2518 38.0 36.8 38.0 30.6 38.0 130-134 35.043899999999994 38.0 36.2 38.0 28.4 38.0 135-139 34.8671 38.0 36.0 38.0 28.8 38.0 140-144 34.7076 38.0 36.0 38.0 28.6 38.0 145-149 34.08625000000001 38.0 36.0 38.0 25.6 38.0 150 27.89475 33.0 25.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 3.0 5 4.0 6 3.0 7 2.0 8 3.0 9 2.0 10 1.0 11 5.0 12 4.0 13 2.0 14 2.0 15 6.0 16 8.0 17 9.0 18 8.0 19 6.0 20 8.0 21 11.0 22 11.0 23 11.0 24 14.0 25 17.0 26 29.0 27 27.0 28 38.0 29 58.0 30 56.0 31 61.0 32 75.0 33 106.0 34 150.0 35 240.0 36 536.0 37 2473.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.1 20.7 11.875 23.325000000000003 2 29.4 25.724999999999998 29.775000000000002 15.1 3 21.05 28.999999999999996 31.8 18.15 4 24.9 34.475 22.325 18.3 5 24.375 37.175000000000004 22.7 15.75 6 20.325 38.275 23.799999999999997 17.599999999999998 7 19.950000000000003 19.575 40.849999999999994 19.625 8 21.575 23.9 29.599999999999998 24.925 9 21.525 24.224999999999998 30.875000000000004 23.375 10-14 23.805 28.275 26.715 21.205 15-19 23.794999999999998 27.21 28.13 20.865000000000002 20-24 23.69 28.17 27.83 20.31 25-29 23.015 28.15 28.165000000000003 20.669999999999998 30-34 22.85 28.51 27.825 20.815 35-39 23.395 28.439999999999998 28.02 20.145 40-44 23.205000000000002 27.560000000000002 28.27 20.965 45-49 23.31 28.155 28.134999999999998 20.4 50-54 23.189999999999998 27.965 28.075 20.77 55-59 23.29 27.744999999999997 28.76 20.205000000000002 60-64 23.23 28.02 28.355000000000004 20.395 65-69 23.265 27.985 28.155 20.595 70-74 23.395 28.17 28.01 20.424999999999997 75-79 22.919999999999998 27.384999999999998 28.494999999999997 21.2 80-84 23.02 28.310000000000002 27.865000000000002 20.805 85-89 23.75 27.675 28.48 20.095 90-94 23.669999999999998 27.97 28.375 19.985 95-99 23.474999999999998 27.744999999999997 28.675 20.105 100-104 23.5 27.994999999999997 28.09 20.415 105-109 24.18 28.244999999999997 27.755000000000003 19.82 110-114 23.9 27.725 28.27 20.105 115-119 23.5 28.205000000000002 28.194999999999997 20.1 120-124 23.369999999999997 27.595 28.675 20.36 125-129 24.44 27.644999999999996 27.61 20.305 130-134 23.515 27.88 28.625 19.98 135-139 23.669999999999998 27.529999999999998 28.285 20.515 140-144 23.935000000000002 27.845 27.71 20.51 145-149 24.58 27.74 27.750000000000004 19.93 150 25.775 28.050000000000004 26.724999999999998 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 2.0 23 2.0 24 1.0 25 2.5 26 4.5 27 4.5 28 7.5 29 12.0 30 14.5 31 19.0 32 22.5 33 29.5 34 48.0 35 71.5 36 89.5 37 106.0 38 133.5 39 159.5 40 179.5 41 222.0 42 267.0 43 280.5 44 285.0 45 288.5 46 287.0 47 265.5 48 235.5 49 214.5 50 176.5 51 134.0 52 107.5 53 89.5 54 66.0 55 46.5 56 36.0 57 24.0 58 14.5 59 8.5 60 8.5 61 6.5 62 4.5 63 4.5 64 3.0 65 2.5 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.5249999999999999 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.3625 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.75 0.0 0.0 0.0 0.0 130-131 1.875 0.0 0.0 0.0 0.0 132-133 2.05 0.0 0.0 0.0 0.0 134-135 2.325 0.0 0.0 0.0 0.0 136-137 2.725 0.0 0.0 0.0 0.0 138 3.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGG 20 0.006139246 28.8 130-134 AGGGAAA 20 0.006139246 28.8 135-139 CGTGTAG 20 0.006139246 28.8 130-134 GGGAAAG 20 0.006139246 28.8 135-139 GAAGAGC 40 0.007966741 18.0 120-124 >>END_MODULE Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093809 spots for SRR4237623.sra Written 3093809 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra Read 3093793 spots for SRR4237623.sra Written 3093793 spots for SRR4237623.sra SRR ids: ['SRR4237623.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bl117882 SRR4237623.sra spots: 61875876 blocks: [[1, 3093793], [3093794, 6187586], [6187587, 9281379], [9281380, 12375172], [12375173, 15468965], [15468966, 18562758], [18562759, 21656551], [21656552, 24750344], [24750345, 27844137], [27844138, 30937930], [30937931, 34031723], [34031724, 37125516], [37125517, 40219309], [40219310, 43313102], [43313103, 46406895], [46406896, 49500688], [49500689, 52594481], [52594482, 55688274], [55688275, 58782067], [58782068, 61875876]] SRR4237623 file size 20825152 SRR4237623 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237623 SRR4237623_1.fastq SRR4237623_2.fastq Input file: SRR4237623_1.fastq Paired file: SRR4237623_2.fastq trimmed: SRR4237623-trimmed-pair1.fastq, SRR4237623-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:37:20 2025 >> started Wed Feb 12 17:38:27 2025 >> done (67.090s) 61875876 read pairs processed; of these: 116231 ( 0.19%) short read pairs filtered out after trimming by size control 49817 ( 0.08%) empty read pairs filtered out after trimming by size control 61709828 (99.73%) read pairs available; of these: 20356270 (32.99%) trimmed read pairs available after processing 41353558 (67.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 13 0.00% 20 8 0.00% 21 11 0.00% 22 11 0.00% 23 11 0.00% 24 13 0.00% 25 17 0.00% 26 4 0.00% 27 14 0.00% 28 14 0.00% 29 19 0.00% 30 31 0.00% 31 15 0.00% 32 23 0.00% 33 28 0.00% 34 26 0.00% 35 32 0.00% 36 26 0.00% 37 33 0.00% 38 31 0.00% 39 41 0.00% 40 51 0.00% 41 68 0.00% 42 62 0.00% 43 65 0.00% 44 68 0.00% 45 65 0.00% 46 93 0.00% 47 94 0.00% 48 94 0.00% 49 127 0.00% 50 124 0.00% 51 154 0.00% 52 168 0.00% 53 184 0.00% 54 186 0.00% 55 226 0.00% 56 226 0.00% 57 270 0.00% 58 280 0.00% 59 356 0.00% 60 416 0.00% 61 429 0.00% 62 509 0.00% 63 555 0.00% 64 558 0.00% 65 656 0.00% 66 733 0.00% 67 900 0.00% 68 1335 0.00% 69 2389 0.00% 70 2058 0.00% 71 1420 0.00% 72 1590 0.00% 73 1766 0.00% 74 1881 0.00% 75 2138 0.00% 76 2377 0.00% 77 2677 0.00% 78 2844 0.00% 79 3448 0.01% 80 3891 0.01% 81 4551 0.01% 82 5179 0.01% 83 7648 0.01% 84 31598 0.05% 85 12477 0.02% 86 15437 0.03% 87 14908 0.02% 88 14317 0.02% 89 15317 0.02% 90 19930 0.03% 91 23713 0.04% 92 18599 0.03% 93 23041 0.04% 94 19261 0.03% 95 21495 0.03% 96 23429 0.04% 97 23166 0.04% 98 24555 0.04% 99 28632 0.05% 100 27822 0.05% 101 29171 0.05% 102 31260 0.05% 103 32985 0.05% 104 35196 0.06% 105 37240 0.06% 106 40198 0.07% 107 42992 0.07% 108 45587 0.07% 109 47910 0.08% 110 49050 0.08% 111 52418 0.08% 112 55048 0.09% 113 58072 0.09% 114 61195 0.10% 115 64937 0.11% 116 68464 0.11% 117 70514 0.11% 118 74210 0.12% 119 79276 0.13% 120 79280 0.13% 121 83631 0.14% 122 89751 0.15% 123 92309 0.15% 124 96605 0.16% 125 101313 0.16% 126 107370 0.17% 127 112378 0.18% 128 117541 0.19% 129 124426 0.20% 130 130702 0.21% 131 137382 0.22% 132 144386 0.23% 133 152101 0.25% 134 162208 0.26% 135 172238 0.28% 136 184855 0.30% 137 197359 0.32% 138 214063 0.35% 139 229339 0.37% 140 251606 0.41% 141 277681 0.45% 142 311224 0.50% 143 356368 0.58% 144 422715 0.69% 145 516761 0.84% 146 679838 1.10% 147 983378 1.59% 148 1845429 2.99% 149 10593278 17.17% 150 41353558 67.01% 61709828 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.14 sequence-density-rank=5 fanout-score=67.25 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=14.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=11.86 fanout-score-rank=14 prefix-density=0.33 prefix-fanout=6.8 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAAAAATCAAAGCTTGGTTTCACTGTATATCCATCCCCGCAAGTTTCCACATCAGTTGTAGAGCCCTACAACAGTGTCCTTTCAACTCACTCTCTCCTTGAGCATACTGATGTTGCTGTGCTCCTTGACAATGAGGCCATCTATGACATTTGCAGGCGCTCTCTTGACATTGAGCGTCCCACTTACACCAATCTTAACCGCCTTGTTTCTCAGGTGATCTCATCTTTGACTGCCTCATTAAGGTTTGATGGAGCTCTTAATGTGGATGTTACTGAGTTCCAAACCAACTTGGTTCCATACCCCAGGATCCATTTCATGCTTTCCTCTTATGCCCCTGTCATCTCCGCAGAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACG criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=209.93 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=24.9 sequence=GAAGAAGAAGAAA SRR4237623 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:39:09 Started mapping on | Feb 12 17:39:09 Finished on | Feb 12 17:43:40 Mapping speed, Million of reads per hour | 819.76 Number of input reads | 61709828 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 59545344 Uniquely mapped reads % | 96.49% Average mapped length | 294.58 Number of splices: Total | 55328514 Number of splices: Annotated (sjdb) | 54390833 Number of splices: GT/AG | 54544465 Number of splices: GC/AG | 620334 Number of splices: AT/AC | 47015 Number of splices: Non-canonical | 116700 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1044208 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 73312 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.67% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1209478 1209478 1209478 N_multimapping 1044208 1044208 1044208 N_noFeature 1611989 58824011 1989763 N_ambiguous 607953 2970 262298 UnstrandedReadsAssigned:57325402 PositiveStrandReadsAssigned:718363 NegativeStrandReadsAssigned:57293283 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR4237623 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237623-trimmed-pair1.fastq SRR4237623-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,709,828 reads, 56,877,026 reads pseudoaligned [quant] estimated average fragment length: 249.871 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR4237623.ke.tsv 34699 SRR4237623.se.tsv 87100 total ==> SRR4237623.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.13 1022 10.8095 Potri.005G024800.1.v4.1 1035 786.129 122 2.90389 Potri.004G059700.1.v4.1 961 712.151 6 0.15765 Potri.007G009000.2.v4.1 1416 1167.13 0 0 Potri.003G141000.2.v4.1 2943 2694.13 1074.19 7.46068 Potri.016G087400.1.v4.1 270 73.6491 4713.46 1197.53 Potri.015G069301.1.v4.1 564 320.617 0 0 Potri.010G195200.1.v4.1 1773 1524.13 74 0.908498 Potri.012G127500.1.v4.1 977 728.14 13687 351.728 ==> SRR4237623.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7697 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 687 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 47 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR4237623 completed mapping pipeline successfully