Starting /dee2/code/volunteer_pipeline.sh SRR4237624 current disk space = 3051488706560 free memory = 1573514572 SRR4237624 SRAfilesize 25716b24733a8cfb10d341acd9a0dc75 SRR4237624.sra SRR4237624.sra file validated SRR4237624 is paired end SRR4237624 is conventional basespace SRR4237624 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237624_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.9035 34.0 33.0 34.0 2.0 34.0 2 32.67775 34.0 33.0 34.0 28.0 34.0 3 32.87675 34.0 33.0 34.0 31.0 34.0 4 33.16375 34.0 33.0 34.0 32.0 34.0 5 33.19625 34.0 33.0 34.0 33.0 34.0 6 36.995 38.0 37.0 38.0 36.0 38.0 7 37.36225 38.0 38.0 38.0 37.0 38.0 8 37.49225 38.0 38.0 38.0 37.0 38.0 9 37.4935 38.0 38.0 38.0 37.0 38.0 10-14 37.493550000000006 38.0 38.0 38.0 37.8 38.0 15-19 37.50175 38.0 38.0 38.0 38.0 38.0 20-24 37.2087 38.0 38.0 38.0 36.6 38.0 25-29 37.4444 38.0 38.0 38.0 37.2 38.0 30-34 37.2521 38.0 38.0 38.0 36.6 38.0 35-39 37.389250000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.3935 38.0 38.0 38.0 37.2 38.0 45-49 37.149950000000004 38.0 38.0 38.0 36.4 38.0 50-54 37.2231 38.0 38.0 38.0 36.8 38.0 55-59 37.23755 38.0 38.0 38.0 37.0 38.0 60-64 37.1918 38.0 38.0 38.0 36.4 38.0 65-69 37.14135 38.0 38.0 38.0 36.6 38.0 70-74 37.148700000000005 38.0 38.0 38.0 36.4 38.0 75-79 37.1339 38.0 38.0 38.0 36.6 38.0 80-84 37.128750000000004 38.0 38.0 38.0 36.8 38.0 85-89 37.0361 38.0 38.0 38.0 36.0 38.0 90-94 36.964549999999996 38.0 38.0 38.0 36.0 38.0 95-99 36.93785 38.0 38.0 38.0 36.0 38.0 100-104 36.87305 38.0 38.0 38.0 35.8 38.0 105-109 36.832100000000004 38.0 38.0 38.0 35.4 38.0 110-114 36.726600000000005 38.0 38.0 38.0 35.0 38.0 115-119 36.616150000000005 38.0 38.0 38.0 34.8 38.0 120-124 36.52425 38.0 38.0 38.0 34.4 38.0 125-129 36.41395 38.0 38.0 38.0 34.2 38.0 130-134 36.20354999999999 38.0 38.0 38.0 34.0 38.0 135-139 36.16289999999999 38.0 38.0 38.0 34.0 38.0 140-144 35.880849999999995 38.0 38.0 38.0 33.0 38.0 145-149 35.5184 38.0 37.8 38.0 32.2 38.0 150 29.984 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 5.0 20 3.0 21 2.0 22 6.0 23 7.0 24 7.0 25 7.0 26 21.0 27 16.0 28 19.0 29 22.0 30 34.0 31 31.0 32 68.0 33 73.0 34 106.0 35 182.0 36 405.0 37 2983.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.17957351290685 11.728395061728394 8.810325476992144 39.28170594837261 2 22.35 16.0 35.925000000000004 25.724999999999998 3 21.0 19.175 25.474999999999998 34.35 4 23.9 29.2 21.625 25.275 5 22.725 35.175 22.45 19.650000000000002 6 17.25 35.825 24.825 22.1 7 12.3 26.974999999999998 42.65 18.075 8 15.975 25.6 33.050000000000004 25.374999999999996 9 17.175 23.75 35.0 24.075 10-14 19.425 30.29 27.189999999999998 23.095 15-19 19.425 29.455 27.87 23.25 20-24 20.035 29.365000000000002 27.445000000000004 23.155 25-29 19.675 30.11 27.339999999999996 22.875 30-34 19.314999999999998 29.255 28.165000000000003 23.265 35-39 19.285 29.81 27.49 23.415 40-44 20.11 29.134999999999998 27.32 23.435 45-49 20.04 29.53 26.51 23.919999999999998 50-54 19.259999999999998 29.265 27.76 23.715 55-59 19.6 29.835 27.515 23.05 60-64 19.56 29.68 26.650000000000002 24.11 65-69 19.945 29.435 27.145000000000003 23.474999999999998 70-74 19.814999999999998 29.470000000000002 27.255000000000003 23.46 75-79 19.81 28.904999999999998 27.49 23.794999999999998 80-84 19.94599729986499 28.8114405720286 27.231361568078405 24.011200560028 85-89 19.66 29.315 27.389999999999997 23.635 90-94 19.62 29.580000000000002 27.485 23.315 95-99 20.18 29.73 26.6 23.49 100-104 20.549999999999997 29.665000000000003 26.51 23.275000000000002 105-109 20.285 29.215000000000003 26.895000000000003 23.605 110-114 20.115 29.24 26.685 23.96 115-119 20.669999999999998 29.185 26.755000000000003 23.39 120-124 21.14 29.275000000000002 26.21 23.375 125-129 20.880000000000003 29.32 26.22 23.580000000000002 130-134 21.02 29.01 26.265 23.705000000000002 135-139 21.099999999999998 29.24 25.83 23.830000000000002 140-144 20.645 28.999999999999996 26.075 24.279999999999998 145-149 20.95 29.275000000000002 25.985000000000003 23.79 150 20.674999999999997 28.999999999999996 25.95 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 3.5 26 7.0 27 12.0 28 15.5 29 19.5 30 27.5 31 34.5 32 41.5 33 50.5 34 70.5 35 93.5 36 104.5 37 116.0 38 144.5 39 170.0 40 188.5 41 213.5 42 246.0 43 264.5 44 257.5 45 278.5 46 268.0 47 231.5 48 215.0 49 189.0 50 170.5 51 148.0 52 113.0 53 75.5 54 56.5 55 44.0 56 30.0 57 27.0 58 18.5 59 6.5 60 6.5 61 9.0 62 7.0 63 5.0 64 3.0 65 3.0 66 3.0 67 2.5 68 2.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.7625000000000002 0.0 0.0 0.0 0.0 106-107 1.9874999999999998 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.5250000000000004 0.0 0.0 0.0 0.0 112-113 2.85 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 4.0 0.0 0.0 0.0 0.0 118-119 4.5875 0.0 0.0 0.0 0.0 120-121 5.2875 0.0 0.0 0.0 0.0 122-123 5.775 0.0 0.0 0.0 0.0 124-125 6.425 0.0 0.0 0.0 0.0 126-127 7.2625 0.0 0.0 0.0 0.0 128-129 8.075 0.0 0.0 0.0 0.0 130-131 8.7625 0.0 0.0 0.0 0.0 132-133 9.5625 0.0 0.0 0.0 0.0 134-135 10.3 0.0 0.0 0.0 0.0 136-137 11.162500000000001 0.0 0.0 0.0 0.0 138 11.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR4237624 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR4237624_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80225 33.0 33.0 34.0 32.0 34.0 2 32.98325 34.0 33.0 34.0 32.0 34.0 3 32.986 34.0 33.0 34.0 32.0 34.0 4 32.8965 34.0 33.0 34.0 32.0 34.0 5 32.911 34.0 33.0 34.0 32.0 34.0 6 37.0605 38.0 38.0 38.0 36.0 38.0 7 37.14225 38.0 38.0 38.0 37.0 38.0 8 37.0585 38.0 38.0 38.0 36.0 38.0 9 37.08275 38.0 38.0 38.0 36.0 38.0 10-14 36.96825 38.0 38.0 38.0 36.4 38.0 15-19 37.052699999999994 38.0 38.0 38.0 36.6 38.0 20-24 37.09015 38.0 38.0 38.0 37.0 38.0 25-29 37.0638 38.0 38.0 38.0 36.8 38.0 30-34 37.0686 38.0 38.0 38.0 36.8 38.0 35-39 37.1005 38.0 38.0 38.0 36.8 38.0 40-44 36.79195 38.0 38.0 38.0 35.0 38.0 45-49 37.057449999999996 38.0 38.0 38.0 36.4 38.0 50-54 37.0698 38.0 38.0 38.0 36.6 38.0 55-59 37.0514 38.0 38.0 38.0 36.6 38.0 60-64 37.03775 38.0 38.0 38.0 36.2 38.0 65-69 36.970150000000004 38.0 38.0 38.0 36.2 38.0 70-74 36.948249999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.84224999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.81035 38.0 38.0 38.0 36.0 38.0 85-89 36.725350000000006 38.0 38.0 38.0 35.8 38.0 90-94 36.7333 38.0 38.0 38.0 35.8 38.0 95-99 36.6587 38.0 38.0 38.0 35.4 38.0 100-104 36.5804 38.0 38.0 38.0 35.2 38.0 105-109 36.502449999999996 38.0 38.0 38.0 35.0 38.0 110-114 36.4357 38.0 38.0 38.0 34.0 38.0 115-119 36.322900000000004 38.0 38.0 38.0 34.2 38.0 120-124 36.075399999999995 38.0 38.0 38.0 33.6 38.0 125-129 35.929899999999996 38.0 38.0 38.0 33.4 38.0 130-134 35.71655 38.0 37.8 38.0 32.4 38.0 135-139 35.56895 38.0 38.0 38.0 32.0 38.0 140-144 35.18635 38.0 37.2 38.0 30.6 38.0 145-149 34.35495 38.0 36.0 38.0 27.4 38.0 150 27.69975 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 1.0 6 1.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 3.0 13 1.0 14 1.0 15 1.0 16 4.0 17 7.0 18 2.0 19 4.0 20 4.0 21 4.0 22 9.0 23 6.0 24 14.0 25 19.0 26 16.0 27 24.0 28 20.0 29 33.0 30 42.0 31 54.0 32 64.0 33 76.0 34 112.0 35 176.0 36 409.0 37 2882.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.300000000000004 19.075 13.4 28.225 2 28.475 25.074999999999996 31.775 14.674999999999999 3 21.325 28.225 32.175 18.275 4 24.775 34.449999999999996 22.95 17.825 5 26.125 36.6 22.15 15.125 6 19.225 38.875 25.15 16.75 7 20.25 20.275000000000002 41.349999999999994 18.125 8 21.9 24.3 28.375 25.424999999999997 9 22.425 24.75 31.2 21.625 10-14 23.485 28.810000000000002 26.729999999999997 20.974999999999998 15-19 23.425 27.33 28.62 20.625 20-24 23.49 28.285 27.955000000000002 20.27 25-29 23.325000000000003 27.91 27.875 20.89 30-34 22.99 27.785 28.17 21.055 35-39 23.61 27.625 28.439999999999998 20.325 40-44 22.955000000000002 27.47 29.310000000000002 20.265 45-49 23.52 27.29 28.860000000000003 20.330000000000002 50-54 23.265 27.66 28.87 20.205000000000002 55-59 23.75 27.715 28.955 19.580000000000002 60-64 23.385 27.675 29.17 19.77 65-69 23.724999999999998 27.405 28.595 20.275000000000002 70-74 24.035 26.889999999999997 28.64 20.435 75-79 23.395 27.060000000000002 29.2 20.345 80-84 23.62 27.815 28.565 20.0 85-89 23.955000000000002 27.839999999999996 28.595 19.61 90-94 22.85 27.694999999999997 28.525 20.93 95-99 24.060000000000002 27.79 28.82 19.33 100-104 23.605 27.534999999999997 29.085 19.775000000000002 105-109 23.830000000000002 27.195000000000004 28.804999999999996 20.169999999999998 110-114 23.77 27.985 28.02 20.225 115-119 24.125 27.534999999999997 28.64 19.7 120-124 24.42 27.73 27.565 20.285 125-129 24.43 28.299999999999997 27.584999999999997 19.685 130-134 25.245 27.884999999999998 27.46 19.41 135-139 25.66 27.775 27.525 19.040000000000003 140-144 26.35 27.72 26.715 19.215 145-149 26.395000000000003 27.71 26.729999999999997 19.165 150 26.775 28.849999999999998 26.3 18.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 1.0 25 2.0 26 4.0 27 5.5 28 6.0 29 9.5 30 19.5 31 23.5 32 30.5 33 44.5 34 52.0 35 63.0 36 91.5 37 121.0 38 138.0 39 162.5 40 204.5 41 230.0 42 252.0 43 281.0 44 292.5 45 292.5 46 281.5 47 248.0 48 212.0 49 209.5 50 177.0 51 121.0 52 98.5 53 81.5 54 64.0 55 44.0 56 33.0 57 31.0 58 21.5 59 14.5 60 8.5 61 4.5 62 4.0 63 3.5 64 1.5 65 2.0 66 2.0 67 0.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 4.074999999999999 0.0 0.0 0.0 0.0 118-119 4.625 0.0 0.0 0.0 0.0 120-121 5.3125 0.0 0.0 0.0 0.0 122-123 5.825 0.0 0.0 0.0 0.0 124-125 6.487500000000001 0.0 0.0 0.0 0.0 126-127 7.3375 0.0 0.0 0.0 0.0 128-129 8.162500000000001 0.0 0.0 0.0 0.0 130-131 8.837499999999999 0.0 0.0 0.0 0.0 132-133 9.6375 0.0 0.0 0.0 0.0 134-135 10.3625 0.0 0.0 0.0 0.0 136-137 11.212499999999999 0.0 0.0 0.0 0.0 138 11.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAAAG 10 0.006973645 144.0 6 CAAAAGA 10 0.006973645 144.0 7 TTTTTTT 75 0.0013041105 13.439999 20-24 >>END_MODULE Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166876 spots for SRR4237624.sra Written 2166876 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra Read 2166867 spots for SRR4237624.sra Written 2166867 spots for SRR4237624.sra SRR ids: ['SRR4237624.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3cpld9p1 SRR4237624.sra spots: 43337349 blocks: [[1, 2166867], [2166868, 4333734], [4333735, 6500601], [6500602, 8667468], [8667469, 10834335], [10834336, 13001202], [13001203, 15168069], [15168070, 17334936], [17334937, 19501803], [19501804, 21668670], [21668671, 23835537], [23835538, 26002404], [26002405, 28169271], [28169272, 30336138], [30336139, 32503005], [32503006, 34669872], [34669873, 36836739], [36836740, 39003606], [39003607, 41170473], [41170474, 43337349]] SRR4237624 file size 14579261 SRR4237624 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR4237624 SRR4237624_1.fastq SRR4237624_2.fastq Input file: SRR4237624_1.fastq Paired file: SRR4237624_2.fastq trimmed: SRR4237624-trimmed-pair1.fastq, SRR4237624-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 18:14:42 2025 >> started Wed Feb 12 18:15:32 2025 >> done (50.741s) 43337349 read pairs processed; of these: 30365 ( 0.07%) short read pairs filtered out after trimming by size control 23104 ( 0.05%) empty read pairs filtered out after trimming by size control 43283880 (99.88%) read pairs available; of these: 16973138 (39.21%) trimmed read pairs available after processing 26310742 (60.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 3 0.00% 21 7 0.00% 22 7 0.00% 23 9 0.00% 24 5 0.00% 25 7 0.00% 26 11 0.00% 27 15 0.00% 28 12 0.00% 29 17 0.00% 30 19 0.00% 31 24 0.00% 32 23 0.00% 33 19 0.00% 34 35 0.00% 35 34 0.00% 36 33 0.00% 37 40 0.00% 38 38 0.00% 39 44 0.00% 40 66 0.00% 41 76 0.00% 42 68 0.00% 43 69 0.00% 44 88 0.00% 45 93 0.00% 46 102 0.00% 47 145 0.00% 48 152 0.00% 49 166 0.00% 50 174 0.00% 51 212 0.00% 52 234 0.00% 53 246 0.00% 54 263 0.00% 55 285 0.00% 56 327 0.00% 57 359 0.00% 58 436 0.00% 59 495 0.00% 60 557 0.00% 61 658 0.00% 62 754 0.00% 63 887 0.00% 64 983 0.00% 65 1165 0.00% 66 1258 0.00% 67 1483 0.00% 68 1687 0.00% 69 2615 0.01% 70 3152 0.01% 71 2900 0.01% 72 2906 0.01% 73 3236 0.01% 74 3600 0.01% 75 4095 0.01% 76 4583 0.01% 77 5075 0.01% 78 5615 0.01% 79 6377 0.01% 80 7322 0.02% 81 8128 0.02% 82 9393 0.02% 83 10749 0.02% 84 14082 0.03% 85 15649 0.04% 86 16881 0.04% 87 18545 0.04% 88 20350 0.05% 89 22020 0.05% 90 24838 0.06% 91 26470 0.06% 92 29214 0.07% 93 31583 0.07% 94 34986 0.08% 95 37951 0.09% 96 41063 0.09% 97 44517 0.10% 98 47124 0.11% 99 50270 0.12% 100 54690 0.13% 101 57548 0.13% 102 61905 0.14% 103 66175 0.15% 104 70243 0.16% 105 75136 0.17% 106 80242 0.19% 107 83810 0.19% 108 87962 0.20% 109 91504 0.21% 110 94857 0.22% 111 99652 0.23% 112 104443 0.24% 113 108595 0.25% 114 114129 0.26% 115 119791 0.28% 116 123586 0.29% 117 129610 0.30% 118 134199 0.31% 119 135904 0.31% 120 139883 0.32% 121 144977 0.33% 122 148500 0.34% 123 153561 0.35% 124 158556 0.37% 125 162734 0.38% 126 167510 0.39% 127 172042 0.40% 128 176922 0.41% 129 180835 0.42% 130 186009 0.43% 131 189104 0.44% 132 192917 0.45% 133 199748 0.46% 134 203181 0.47% 135 209134 0.48% 136 216516 0.50% 137 223118 0.52% 138 231030 0.53% 139 240555 0.56% 140 249915 0.58% 141 261200 0.60% 142 274891 0.64% 143 293372 0.68% 144 322528 0.75% 145 368339 0.85% 146 431848 1.00% 147 576468 1.33% 148 1033660 2.39% 149 7000915 16.17% 150 26310742 60.79% 43283880 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.3 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.06 sequence-density-rank=41 fanout-score=114.29 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=17.5 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=39 prefix-density=0.17 prefix-fanout=2.3 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=4 fanout-score=44.21 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=12.2 sequence=TGTTGGTGGTGG SRR4237624 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 18:16:15 Started mapping on | Feb 12 18:16:15 Finished on | Feb 12 18:20:11 Mapping speed, Million of reads per hour | 660.26 Number of input reads | 43283880 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 41617589 Uniquely mapped reads % | 96.15% Average mapped length | 289.94 Number of splices: Total | 35125825 Number of splices: Annotated (sjdb) | 34454456 Number of splices: GT/AG | 34599576 Number of splices: GC/AG | 402408 Number of splices: AT/AC | 33044 Number of splices: Non-canonical | 90797 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 714981 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 45371 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.07% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 984561 984561 984561 N_multimapping 714981 714981 714981 N_noFeature 1336256 40998874 1656310 N_ambiguous 477113 2649 176541 UnstrandedReadsAssigned:39804220 PositiveStrandReadsAssigned:616066 NegativeStrandReadsAssigned:39784738 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR4237624 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR4237624-trimmed-pair1.fastq SRR4237624-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,283,880 reads, 39,591,792 reads pseudoaligned [quant] estimated average fragment length: 213.722 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52401 SRR4237624.ke.tsv 34699 SRR4237624.se.tsv 87100 total ==> SRR4237624.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.28 785 11.3375 Potri.005G024800.1.v4.1 1035 822.278 146 4.62942 Potri.004G059700.1.v4.1 961 748.313 8 0.27874 Potri.007G009000.2.v4.1 1416 1203.28 0 0 Potri.003G141000.2.v4.1 2943 2730.28 573.06 5.4725 Potri.016G087400.1.v4.1 270 93.1184 5505.28 1541.48 Potri.015G069301.1.v4.1 564 354.342 0 0 Potri.010G195200.1.v4.1 1773 1560.28 56 0.93579 Potri.012G127500.1.v4.1 977 764.292 5952 203.047 ==> SRR4237624.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6917 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 744 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 60 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR4237624 completed mapping pipeline successfully